2.1 Cell culture & transfection
Newborn male Large White piglets (3 days old) were procured from the experimental piglet of Northwest A&F University (Yangling, China). All animals were maintained on a 12:12-h light cycle, and feeding conditions and slaughter methods were in accordance with national animal welfare regulations. In this study, all experiments on animals were approved by the Experimental Animal Management Committee of Northwest A & F University and comply with animal welfare regulations.
Intramuscular preadipocytes were isolated from the longissimus dorsi (LD) and semitendinosus (SD) muscles of these piglets using the method previously described by [10]. To summarize, LD and SD muscles were quickly excised, rinsed twice in sterile pre-cooled phosphate-buffered saline (PBS), and then cut into 1 mm3. Muscle fragments were incubated in Dulbecco’s Modified Eagle’s Medium/F12 (DMEM/F12; Hyclone, Logan, UT, USA) containing 0.1% I type collagenase (270 U/mg; Gibco, Carlsbad, CA) for 1.5 hours in a 37 ℃ water bath, with continuous shaking. The products were then sequentially passed through a 70 mesh and then a 200 mesh to obtain single cells. The cells were seeded in a dish with DMEM/F12 medium containing 10% fetal bovine serum (Gibco, Grand Island, NY, USA). After two hours, we changed the medium to keep only adherent cells.
When cells reached 70–80% density, Lipofectamine® RNAiMAX Reagent (Thermo Fisher, Waltham, MA, USA) mixed with siRNA (Rib-bio, Guangzhou, China) was used for transfection. When cells got to 100% confluence, a mixture containing 10% FBS, 5 µg/mL (872 nM) insulin, 1 µM dexamethasone, and 0.5 mM isobutyl methylxanthine (IBMX, Sigma − Aldrich, St. Louis, MO) was used to induce adipogenic differentiation. Two days later, a DMEM/F12 medium containing 10% FBS and 5 µg/mL (872 nM) insulin was changed to maintain differentiation. Cells at 0, 2, and 8 days of adipogenic differentiation were harvested for RNA-seq.
2.2 RNA extraction and transcriptome sequencing
Trizol (Takara Bio, Otsu, Japan) was used to extract total RNA as per the manufacturer's instructions. The concentration of RNA was measured using NanoDrop 2000 (Thermo Fisher, Waltham, MA, USA), and the RNA was then stored in a -80℃ refrigerator for storage.
The mRNA fragment was then reverse transcribed into first-strand cDNA using reverse transcriptase (Takara Bio, Otsu, Japan) and random primers. The RNA template was then removed, and double-stranded cDNA was produced. End repair, poly-A tail processing, adapto r ligation and cDNA purification and enrichment were then performed. Sequencing was carried out using an Illumina HiSeq 2500 sequencing system, with 100 bp paired-end sequencing.
Next, raw data were measured by each internal script in the fastq format. Moreover, with the strict screening criteria, the clean data from raw data were collected. Synchronously, the related indicators of clean data were calculated, including Q20, Q30, and GC content. The high quality clean data were used for further downstream analyses.
Scripture (beta2) [11] and Cufflinks (v2.1.1) [12] were used to combine the mapping metrics of each sample. Scripture was run with default parameters, while Cufflinks was run with ‘min-frags-per-transfrag = 0’ and ‘--library-type’, while other parameters set to default. Coding-Non-Coding Index (CNCI), Coding Potential Calculator (CPC) and Pfam-scan were used to predict the encoding ability of novel lncRNA.
2.3 Quantification of gene expression level
Cuffdiff (V2.1.1) was used to calculate the abundance of lncRNA. The FPKM of lncRNA was calculated by summing the FPKM of the transcripts in each sample genome. The Cuffdiff program was used to perform statistical modelling based on a negative binomial distribution to determine differential expression in digital transcripts of gene expression data. Statistical results were considered differential expressed when P* <0.05.
2.4 Bioinformatic analysis
PhyloFit was used to compute phylogenetic models for conserved and non-conserved regions between species, and HMM transition parameters were set to phyloP to compute a set of conservation scores for lncRNA and coding genes [13].
For cis-acting lncRNA, coding genes 10 kb/100 kb upstream and downstrea m of each lncRNA were searched for functional analysis of lncRNA. Meanwhile, for trans-acting lncRNA, the correlation between lncRNA and the coding gene was calculated using a custom script; these genes are considered as target genes of lncRNA predicted by position. KOBAS software (http://kobas.cbi.pku.edu.cn) was used to perform KEGG pathway enrichment analysis for each target gene predicted by lncRNA.
2.5 Real-time quantitative PCR
Approximately 500 ng of RNA was reverse transcripted using the PrimeScript RT Enzyme Mix (Takara Bio, Otsu, Japan) system to produce cDNA. Real-time quantitative PCR was performed on ABI StepOne Plus using the SYBR Premix Ex Taq™ system (Vazyme Biotech, Nanjing, China). The relative expression level of target genes was evaluated by the 2-ΔΔCt method, with β-actin acting as an internal reference gene. Sequences for all primers are shown in Table 1.
Table 1
Primer sequences for real-time qPCR
Gene | Primer Sequences |
ALDBSSCT0000011643 | F:CGCTTTGCTTCTTCTAGCCC R:GTTCATTAGCTTGGTTTGCTGC |
ALDBSSCT0000004851 | F:CGGCGGGTGACATTCTAAG R:GGCCAATCCGGCTCGC |
LNC_000368 | F:CGGCCAAGACTAACCAAGGG R:TGCCCACTGTCACCCTAACT |
LNC_000359 | F:GCCATGAGGAAGCCAAACTG R:TAAAGTTGGTGCGGGTGTCA |
LNC_000170 | F:TTTCTGGAATGCCCGCTCTG R:TGGGGTGGTTGATTGTAGCC |
LNC_000076 | F:TTTCTGGAATGCCCGCTCTG R:TGGGGTGGTTGATTGTAGCC |
LNC_000108 | F:GACAAGCTCCCAGACACCTC R:GGCTACAGATGAGGTCAGCC |
β-actin | F:GGACTTCGAGCAGGAGATGG R:AGGAAGGAGGGCTGGAAGAG |
PPARγ | F:AGGACTACCAAAGTGCCATCAAA R:GAGGCTTTATCCCCACAGACAC |
aP2 | F:GAGCACCATAACCTTAGATGGA R:AAATTCTGGTAGCCGTGACA |
C/EBPβ | F:GCACAGCGACGAGTACAAGA R:TATGCTGCGTCTCCAGGTTG |
ATGL | F:CCTCATTCCACCTGCTCTCC R:GTGATGGTGCTCTTGAGTTCGT |
HSL | F:CACTGACTGCTGACCCCAAG R:TCCTCACTGTCCTGTCCTTCAC |
2.6 RNA-FISH
Firstly, the back subcutaneous fat pad was removed and fixed in 4% polyformaldehyde. Tissues were cut into 3 µm sections using a freezing microtome (Leica, CM1950). After washing the sample with PBS, 200 µl of the pre-hybrid solution was added and kept at 37℃ for 30 min. Next, the hybridization solution containing 2.5 µl of lncRNA FISH Probe Mix (Invitrogen™) (or ‘internal reference FISH probe’) was added to the mixture and incubated overnight at 37 °C in the dark. The slices were then washed with PBS 3 times, 5 min per wash. DAPI was added to stain the nuclei. Preparation complete, the fluorescence was observed under a fluorescence microscope (Nikon, TE2000-S). The specific FISH probe sequence designed based on the lnc_000368 sequence was 5ʹ-DIG-GCCACCCAACCCCAGACCACAGCCTAC-DIG-3ʹ.
2.7 Oil Red O staining
Porcine primary intramuscular preadipocytes were washed 3 times with pre-cooled PBS, fixed in 4% paraformaldehyde for 30 min, and then washed with PBS 3 times. Cells were incubated in filtered 0.5% Oil Red O working solution for 30 min; the Oil Red O solution was then discarded. Cells were washed 3 times with PBS and observed under a microscope (Olympus, CKX53). Isopropanol was then used to extract cellular triglycerides, and the absorbance was measured at a wavelength of 510 nm for use in further quantitative analysis.
2.8 Western Blot
Polyacrylamide gels were used to separate and mark proteins of different sizes. The proteins were then transferred to a PVDF membrane. Next, the membrane was soaked in 5% skim milk for 2 hours, and then incubated with primary antibodies overnight (PPARγ, Abcam, ab59256; HSL, #2435, CST; aP2, sc-18661, Santa Cruz; ATGL, #2138, CST; CEBP/β, sc-7962, Santa Cruz; β-actin, KM9001T, Sungene). Dilute the antibody to the manufacturer's recommended concentration. After incubation, the membrane was washed 3 times with TBST solution, and secondary antibodies (Goat Anti-Mouse IgG, Boster, BA1038; Goat Anti-Rabbit IgG, Boster, BA1039) were added. Finally, the western blots were exposed to the Bio-Rad imaging system.
2.9 Statistical analysis
Each experiment was repeated at least three times independently, and representative results are shown. Differences between groups were assessed for significance with the t test, and the results are presented as mean ± SEM. P* < 0.05 was considered statistically significant. P * <0.01 is considered to have a very significant relationship.