Tissue specimens
Fresh or formalin-fixed and paraffin-embedded cervical tissue specimens were collected from Uighur women with CSCC and CIN, or from women without cervical diseases that underwent hysterectomy surgery. All CC patients between June 2010 and March 2013 at the First Affiliated Hospital of Xinjiang Medical University and the First Hospital of Kashi were asked to participate in our study during their initial visit to the Department of Gynecology. All cancer and control patients were provided with written informed consent, and the clinical study was approved by the ethics committee of the First Affiliated Hospital of Xinjiang Medical University.
Gynecological examinations were performed in all CC patients and staging was completed in accordance with the International Federation of Gynecology and Obstetrics (FIGO) criteria. In addition, experienced pathologists reviewed slides, which resulted in the inclusion of 220 cases of formalin-fixed, paraffin-embedded (FFPE) tissue specimens. The FFPE specimens (or fresh frozen cervical tissues, described below) were collected during the initial visit to the outpatient department, at a gynecologic examination, or after operative treatment under general anesthesia. Among the patients with CSCC that were enrolled in this study, 74 were FIGO stage ≤ⅠB and 58 were FIGO stage >ⅡA. There were 60 cases that were pathologically characterized as well-differentiated and 72 that were characterized as moderately or poorly differentiated tumors. Lymph node metastasis was documented in 55 tumor patients. A total of 56 patients with CIN were selected for this study, including 20 cases with CIN I-II and 36 with CIN-III. The median age of the CC patients was 48.5 years (IQ range 25–67 years). Control cases (n = 32) were obtained from patients without a history of cervical lesions or any other form of cancer that had a planned hysterectomy for nonmalignant reasons. Indications for hysterectomy were fibroids, uterine prolapse, adenomyosis, or a combination of fibroids and uterine prolapse.
In addition, 40 frozen biopsies, including 20 CSCC cases and 20 normal adjacent tissues (NATs), were collected according to the criteria described above for gene transcription and GNB2L1 copy number studies.
Immunohistochemistry
To examine the staining patterns of various target proteins in CSCC, CIN, and NC tissues, fixed preparations were dewaxed in dewaxing agent (Zhong Shan Goldenbridge Biotechnology Co. Ltd, Beijing, China), rehydrated in alcohol, and then blocked with an endogenous peroxidase inhibitor (Zhong Shan Goldenbridge Biotechnology Co. Ltd, Beijing, China) at room temperature for 30 min. The samples were then incubated with primary antibodies against GNB2L1 (Abcam, Cambridge, MA, USA) overnight at 4°C. Immunohistochemistry of clinical samples was performed as previously reported [11]. Two experienced pathologists independently scored the staining patterns, which were semi-quantitatively estimated according to the staining intensity and distribution. A score of 9–12 was classified as high expression, a score of 5–8 was classified as moderate expression, and a score 1–4 was classified as low expression.
RNA extraction and quantitative real-time (qRT)-PCR
Total RNA from the clinical specimens and CC cells was extracted with TRIzol reagent (Invitrogen) and reverse transcribed into 2 mg of cDNA with the Revert Aid First Strand cDNA Synthesis kit (Roche Diagnostics, Mannheim, Germany). Real-time (RT)-PCR was performed using the SYBR Green Premix PCR Master Mix (Roche Diagnostics, Mannheim, Germany), according to the manufacturer’s protocols. The quantitative RT-PCR (qRT-PCR) analysis was performed using the FastStart Universal SYBR Green Master (Roche, Mannheim, Germany) on an Applied Biosystems ABI 7900 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Gene expression levels were normalized using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the internal reference. The average relative change in gene expression was calculated using 3–5 determinations by relative quantification and applying the delta-delta cycle threshold method. All reactions were performed in triplicate. The oligonucleotide primers for human GNB2L1 and GAPDH were as follows: GNB2L1-F: 5’-TGAGTGTGGCCTTCTCCTCT–3; GNB2L1-R: 5’-GCTTGCAGTTAGCCAG GTTC–3; GAPDH-F: 5′-GGACCTGACCTGCCG TCTAG–3’; GAPDH-R: 5′-GTAGCCCAG GATGCCCT TGA–3’.
Genomic DNA isolation and quantitative DNA gene copy analysis
Genomic DNA was extracted from human cervical tissue samples using the QIAamp DNA Mini Kit (QIAGEN, Valencia, CA) and the GNB2L1 gene was detected with qRT-PCR according to the manufacturer’s protocols [13]. The oligonucleotide primers for human GNB2L1 were as follows: GNB2L1-F: 5’GCAGCAACCCTATCATCGTC3’ and GNB2L1-R: 5’CGGTAGCCATTTCTC ATTCA3’. The PCR products were linked to the pEASY-T1 vector, which was ampicillin and kanamycin resistant. The identification of successful cloning was performed using primers that were specific to the target genes. The sequencing reaction was performed with the universal primers, M13-F and M13-R, and the cycle threshold value of each sample was detected with qRT-PCR to calculate the GNB2L1 copy number.
Cell culture and lentiviral infection
Two human CC cell lines (SiHa and C33a) and a human immortalized cervical squamous epithelial (H8) cell line were purchased from Shanghai Cell Collection (Shanghai, China). The cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (BI, Cromwell, CT, USA) and maintained at 37°C with 5% CO2. The cells were routinely passaged at a density of 90%. The culture medium was supplemented with 10% fetal bovine serum (FBS) and 100 units/mL of penicillin and streptomycin (BI, Cromwell, CT, USA). The lentiviral vector constructs and the lentivirus were produced by GENECHEM (Shanghai, China). The cell lines were treated with two RNAi sequences targeting GNB2L1, which were as follows, shGNB2L1–2: 5’-GCAAGATCATTGTAGATGA–3’ and shGNB2L1–2: 5’-GCTAAAG ACCAACCACATT–3’. Nonsense shRNA was the negative control. Briefly, the cell lines were plated in 6-well plates with serum-free DMEM and incubated at 37°C in the presence of 8 μg/mL polybrene for 72 h, according to the manufacturer’s guidelines. The medium was then removed and replaced with culture medium that contained 10% FBS. The cells were then continuously cultured for 6–8 days, followed by flow cytometry selection.
Antibodies and western blot analysis
Lysate protein concentrations were quantified with the BCA protein assay kit (Bio-Rad Hercules, CA, USA) and the appropriate amount of lysate was loaded into a 10% polyacrylamide gel. The samples were then resolved by SDS-PAGE and the proteins were transferred to polyvinylidene difluoride membranes. The membranes were blocked and incubated with antibodies against GNB2L1 (ab62735, Abcam, Cambridge, MA, USA) and GAPDH (Proteintech, Rosemont, IL, USA). Protein detection was performed with the Western Breeze Chromogenic Immunodetection System (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s protocol.
Gene regulatory network construction
To identify network pathways related to differentially expressed proteins or genes in CSCC, bioinformatics and the STRING database were used to construct an interaction network. First, genes with consistent expression and significant expression differences from our previous proteomic and microarray studies were selected as the experimental differential genes [14]. Then, the 19 differential genes were inputted into the STRING database to identify potential relationships among the protein subunits and to construct a network of their interactions.
Oil Red O staining
Stable GNB2L1-knockdown CC cells (shGNB2L1) were washed with phosphate-buffered saline (PBS) and fixed with Paraformaldehyde Fix Solution for 20 min at 37°C. The cells were then washed with PBS, followed by a 60% isopropanol wash for 1 min. Next, the cells were stained with a filtered 0.3% Oil Red O (Sigma-Aldrich, St. Louis, MO, USA) solution for 30 min at 37°C, followed by washing in PBS. The total cell number was obtained by counting. Twenty random fields were analyzed (×20) using a Nikon ECLIPSE TS100 epifluorescence microscope. To quantify the lipid content, the cell-incorporated Oil Red O was extracted in 6-well plates by shaking in 500 μL of isopropanol for 10 min at room temperature. The supernatant was then collected and absorbance at 490 nm was measured with a spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).
Statistical analyses
All statistical analyses were performed using SPSS software (version 17.0; SPSS, Inc. Chicago, IL, USA) and Prism 5.0 software (GraphPad Software, Inc., La Jolla, CA). All data are presented as the mean ± standard deviation (SD) of at least three independent experiments. The Mann-Whitney test was used to analyze differences in GNB2L1 immunohistochemistry scores between tumors, CIN, and NC tissues. The relationships between GNB2L1 expression and clinicopathological characteristics were tested by the chi-squared test or Fisher’s exact test, as appropriate. GNB2L1 copy number in different tissues was analyzed with a Student’s t-test.