Occurrence, distribution and virulence factors of clinically important Acinetobacter species recovered from selected freshwater resources in the Eastern Cape Province, South Africa

doi:10.21203/rs.2.14951/v1

Download PDF

Research article

Occurrence, distribution and virulence factors of clinically important Acinetobacter species recovered from selected freshwater resources in the Eastern Cape Province, South Africa

https://doi.org/10.21203/rs.2.14951/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Background : Several Acinetobacter species live in different ecosystems such as soil, freshwater, wastewater, and solid wastes. In this study, we assessed the occurrence of A. baumannii and A. nosocomialis , which are the major two clinically important species of the genus Acinetobacter , in three freshwater resources (Great Fish, Keiskemma, and Tyhume rivers) in the Eastern Cape Province, South Africa over a one year sampling regime (April 2017 - March 2018). Presumptive Acinetobacter species were subjected to molecular identification by using Acinetobacter genus-specific primers targeting the recA gene. The confirmed Acinetobacter species were further delineated into A. baumannii and A. nosocomialis using species-specific primer sets. Similarly, virulence genes, namely; afa/draBC, epsA, fimH, OmpA, PAI, sfa/focDE , and traT in the two Acinetobacter species were also determined using molecular techniques. Result : A total of 1107 presumptive Acinetobacter isolates were recovered from the freshwater resources of which 844 was confirmed positive for the Acinetobacter genus. Of the 844 Acinetobacter isolates, 285 (77%), 219 (70.9%) and 340 (79%) were recovered from Great Fish, Keiskemma and Tyhume rivers respectively. Our finding revealed that 410 (48.58%) and 23 (2.7%) of the isolates were confirmed to be A. baumannii and A. nosocomalis , respectively. The presence of these clinically-important Acinetobacter species in the freshwater studied suggests possible contamination of the selected rivers and also that A. baumannii and A. nosocomialis can thrive in aquatic environments. Besides, 308 (75.12%) A. baumannii and 3 (13.04%) A. nosocomialis isolates exhibited one or more virulence genes out of the seven tested, whereas 102 (24.88%) and 20 (86.95%) of the A. baumannii and A. nosocomialis isolates did not harbour any virulence gene. Additionally, OmpA was the most prevalent (p<0.05) virulence gene in A. baumannii with 69 (45.10%), 52 (50.98%) and 77 (49.68%) isolates in Great Fish, Keiskamma and Tyhume rivers respectively. Conclusion : The occurrence of these pathogens in rivers which are consumed by humans and livestock, as well as being used for irrigation system constitutes a risk to public health. Keywords: Freshwater resources, Molecular characterisation, Acinetobacter species, virulence gene s.

General Microbiology

Freshwater resources

Molecular characterisation

Acinetobacter species

virulence genes

The majorities of Acinetobacter species are free-living and are ubiquitous in nature, but the clinically-important species, most especially the Acinetobacter calcoaceticus- baumannii (ACB) complex, are frequently isolated from the hospital environs. Among members of this complex, A. baumannii, A. nosocomialis, and A. pittii are well-reported causative agents of Acinetobacter-related infections in hospitals around the globe [1, 2]. The most virulent Acinetobacter species, A. baumannii, is known to cause disease outbreaks in intensive care units (ICUs). Owing to the importance of this disease-causing species in the clinical settings, some scientists have reported that it is a nosocomial pathogen and its occurrence in other natural environments is likely not possible (Peleg et al., 2008). However, in recent discoveries, A. baumannii has been reported to thrive in other natural environment such as freshwater, soil, healthy human skin just like other non-pathogenic species in the Genus [3, 4]. The occurrence of A. baumannii and other pathogenic species of the genus Acinetobacter in the natural environment could be associated with the indiscriminate disposal of wastewater and materials from the hospital into the environment [5].

The isolation of A. baumannii from hospitalized patients is often associated with serious ailment, with corresponding mortality rate of approximately 30% [6, 7]. Additionally, A. baumannii has been implicated in a range of diseases which includes; Acinetobacter pneumonia-bronchiolitis and tracheobronchitis [8, 9], bloodstream infection [2, 10], wound infection [11], urinary tract infection [2, 11] and meningitis [8, 12]. Similarly, A. nosocomialis was responsible for bacteremia [13, 14], pneumonia [15], and induction of epithelial cell death and host inflammatory responses [16].

The pathogenicity of Acinetobacter species like other microorganisms is strongly associated with the virulence factors they harbour. These factors include porins (OmpA), capsular polysaccharides, lipopolysaccharides (LPS), phospholipase, outer membrane vesicles (OMVs), protein secretion systems, metal acquisition system etc. [8, 17, 18, 19]. The OmpA is a protein located on the outer cell membrane of the bacteria, which is responsible for the selective permeation of materials in and out of the cell. The OmpA also binds to the host epithelial cells in order to gain entry into the cell cytoplasmic environment. As such, it causes cell death (apoptosis) by releasing the cytochrome c. OmpA was also noted as one of the factors with which A. nosocomialis initiates its pathogenesis [20]. Pathogenic Gram-negative bacteria are known to secret outer membrane vesicles (OMVs) [17, 21, 22], for interaction between the bacterial pathogens and the host cell [23]. Kim and others [20] showed that A. nosocomialis uses its outer membrane vesicles (OMVs) for secretion of cytotoxic factors with which it elicits an immune response from host epithelial cell. Phospholipase, like other factors, also contributes to the virulence of the pathogenic Acinetobacter species, by hydrolysing phospholipid bilayer of the host cell membrane in order to destabilize the entire cell [17, 24].

As a result, an investigation of the occurrence and distribution of these pathogens in other environments, other than hospital, is very necessary for the understanding of what the nature and diversity of these pathogens truly represent [25, 26]. As such, the time has come to redefine the environmental coverage by these organisms, beyond a clinical setting. Therefore, the focus of this study was to assess the occurrence, distribution and the virulence factors of clinically-important Acinetobacter species such as A. baumannii and A. nosocomialis in the selected freshwater resources in the Eastern Cape, South Africa.

Isolation and distribution of presumptive Acinetobacter species

A total of 1107 presumptive Acinetobacter spp. was recovered from the three rivers studied, of which 370, 309 and 428 isolates belonged to Great fish, Keiskemma and Tyhume respectively as summarized in Table 1.

PCR amplification of the recA gene

To further validate the occurrence and distribution of the bacteria in the genus Acinetobacter in this study, the identification was achieved by using the PCR-based assay to detect internal recA genes that are specific to all Acinetobacter species. Figure 1 presents the PCR product of the gel electrophoresis and staining for the amplification of the 425 bp fragment, which correlates to recA gene. Out of the 1107 presumptive isolates, 844 were confirmed to belong to the genus Acinetobacter of which 285 (77%), 219 (70.9%) and 340 (79%) were recovered from Great fish, Keiskemma and Tyhume rivers respectively. The confirmed isolates belonging to the genus Acinetobacter is summarized and presented in Table 1.

Delineation of Genus Acinetobacter into species

The speciation of the genus Acinetobacter was also performed using PCR assay to amplify the gyrB gene specific primers of A. baumannii and A. nosocomailis at 208 bp and 294 bp fragments respectively. Figures 2 and 3 shows the PCR products of the gel electrophoresis and staining for the delineation of the genus Acinetobacter into A. baumannii and A. nosocomailis accordingly. From the result, 410 (48.58%) and 23 (2.73%) of the confirmed Acinetobacter isolates were delineated to be A. baumannii and A. nosocomailis. The occurrence of A. baumannii was 153 (53.68%) in Great Fish river, 102 (46.58%) in Keiskamma river, and 155 (45.59%) in Tyhume river, while 16 (5.61%), 3 (1.37%) and 4 (1.18 %) represent A. nosocomialis from the respective rivers. The presence of A. baumannii in the three rivers studied was significantly higher (p<0.05) than the A. nosocomialis isolates. The delineation into A. baumannii and A. nosocomailis are summarized and presented in Table 1.

Detection of Virulence Genes

The schematic representations showing the gel electrophoresis of the virulence genes; afa/draBC, epsA, fimH, OmpA, PAI, sfa/focDE, and traT, are presented in Figure 4. The virulence genes haboured by the two clinically important Acinetobacter species in this study is presented in Figure 5 and summarized in Table 2. Additionally, the virulence gene(s) associated with each of the Acinetobacter species as well as the river source from which they were isolated is described. The statistical significance of the prevalence virulence genes with respect to rivers was also emphasized.

Three hundred and eight (75%) of the 410 A. baumannii and 3 (13%) of the 23 A. nosocomialis isolated from the rivers were observed to exhibit one or more virulence genes, out of the seven tested. Respectively, 102 (24.88%) and 20 (86.95%) of the A. baumannii and A. nosocomialis isolates from the three rivers did not harbour any of the virulence gene tested in this study. However, there was a significant difference (p<0.05) in the prevalence of virulence genes harboured by A. baumannii compared to A. nosocomialis, though the population of the former was significantly higher than the latter in all cases.

The prevalence of virulence gene afa/draBC was significantly higher (p<0.05) in the isolates from Great Fish river in comparison to Keiskamma and Tyhume rivers. However, there was a significant difference (p<0.05) in prevalence between the afa/draBC genes haboured by the bacteria recovered from the Tyhume river when compared to those from Keiskamma river. Besides, the prevalence of traT gene in Acinetobacter species from Great Fish and Tyhume rivers showed no statistical difference (p<0.05), but both were significantly higher (p<0.05) than those detected in isolates from Keiskamma river. Similarly, the prevalence of fimH gene detected in isolates recovered from Great Fish river was significantly higher (p<0.05) than those detected in isolates from both Keiskamma and Tyhune river. Nonetheless, the proportion of isolates harbouring the gene in Keiskamma was significantly (p<0.05) lower than those from Tyhume river. The prevalence of the PAI virulence gene was not significantly (p<0.05) different in all the rivers studied. In Great Fish and Keiskamma rivers, there was no significant difference (p<0.05) in the prevalence of sfa/focDE in isolates recovered from the rivers, but the proportion of Acinetobacter species in Tyhume harbouring the gene was significantly higher (p<0.05) than in those from both Great Fish and Keiskamma rivers. The number of Acinetobacter species harbouring epsA virulence gene in the Great Fish river was significantly higher (p<0.05) than those recovered from Keiskamma river, but significantly lower (p<0.05) than in Acinetobacter species recovered from Tyhume river. The prevalence of the OmpA virulence gene was significantly higher (p<0.05) in A. baumannii isolates than all other virulence genes in this study. Besides, OmpA was the most prevalent virulence gene in the rivers, which represented 69 (45.10%), 52 (50.98%) and 77 (49.68%) A. baumannii isolates in Great Fish, Keiskamma and Tyhume rivers respectively. The Acienotobacter species harbouring OmpA gene in Great fish river were significantly higher (p<0.05) than isolates from Keiskamma river, whereas Tyhume river maintained the highest level of statistical significance (p<0.05) of the total Acinetobacter species exhibiting the virulence gene.

Summarily, OmpA was the most prevalent virulence gene detected in Acinetobacter species in all the three rivers studied followed by fimH and epsA genes, whereas PAI and Sfa/focDE genes were the least exhibited respectively. Furthermore, the amount of Acinetobacter species habouring the highest number of virulence genes was isolated from the Tyhume River followed by the Great Fish River, while Kieskamma River was the least.

Bacteria in the genus Acinetobacter have been known to colonize a wide array of ecological systems of which water, soil, sludge, wastewater, plants' root, and animals have been prominent. In this study, water samples were collected from three selected rivers in the Eastern Cape Province, South Africa for the assessment of the incidence of Acinetobacter species, and quite a good number of bacteria in the genus Acinetobacter were presumptively recovered from the water samples. In recent times, freshwater resources have been noted to be a hotspot of Acinetobacter species. Maravić et al. [27] carried out an assessment of the microbial community in the urban riverine environment in Croatia, where 57 of the isolates belong to the genus Acinetobacter. Krizova et al. [28] also noted the widespread of Acinetobacter bohemicus sp. nov. in the water environment in the Czech Republic. In India, Arsenic-resistant Acinetobacter soli, Acinetobacter venetianus, Acinetobacter junii, Acinetobacter baumannii and Acinetobacter calcoaceticus were reported [29].

Besides, the composition of the bacterial community in a freshwater aquaculture environment was investigated in China by [30]. The study reported that the relative abundance of Acinetobacter species was 0.5% of the total bacterial community. In 2014, Zhao and others [31] isolated a set of bacteria from the zinc and arsenic polluted river in Northeastern China, where bacteria belonging to the genus Acinetobacter were found to be prominent. The occurrence and distribution of Acinetobacter spp. in freshwater resources in the study further validated the findings in other reports [29, 31].

All isolates that were positive for the recA (425 bp) (Figure 1) were taken as belonging to the Acinetobacter genus. Chen et al [32] developed a multiplex PCR amplification assay for the initial molecular identification of Acinetobacter species using a recA gene-specific primer before delineating them into species namely, Acinetobacter baumannii, Acinetobacter nosocomialis and Acinetobacter pittii by using species-specific primers. Comparably, Chiang et al. [33] demonstrated a PCR assay targeting recA gene for the detection of Acinetobacter baumannii in patients suffering from endotracheal aspirates in the intensive care unit (ICU) of Taipei Veterans General Hospital.

Eight hundred and fourty-four isolates positive for the Acinetobacter genus were further delineated into its species. Figure 2 and 3 represents gel images of the amplicons of the expected band size of 208 bp for Acinetobacter baumannii and 294 bp for Acinetobacter nosocomialis with respect to the gyrB gene. Acinetobacter baumannii, Acinetobacter nosocomialis, and Acinetobacter pittii are known nosocomial pathogens, which could cause multiple antibiotic resistant infections [2, 32, 34] in immune-compromised patients [2]. Park and others [35] investigated the presence of Acinetobacter species in the bloodstream of patients with a blood infection in a tertiary-care hospital in Korea between August 2003 and February 2010. Their findings showed that Acinetobacter baumannii and Acinetobacter nosocomialis were prevalent in the samples collected. Similarly, Anh et al. [36], recovered 160 A. baumannii isolates from sputum, blood, pus and fluid aspirates of patients in three Hospitals in Vietnam within a period of two years (between 2012 and 2014). These findings showed that the nosocomial pathogens could colonize any part of the human body to cause infections. Sileem et al. [37], in addition to others, carried out a study on the occurrence of Acinetobacter baumannii in the ICU and its impact on the mortality rate.

In the present study, Acinetobacter baumannii and Acinetobacter nosocomialis were recovered from freshwater resources. Several Acinetobacter species have been recovered from soil, water, and wastewater environments; however, the occurrence of A. baumannii and Acinetobacter nosocomialis in a natural environment, besides hospital settings, has been uncommon in the past few years. But in recent times, it is now very clear that such nosocomial pathogens could be isolated from other ecosystems [3, 4, 38]. Fernando et al. [26] showed evidence of the occurrence of Acinetobacter baumannii in the surface water resources collected from the South Nation River (SNR) drainage basin in Eastern Ontario, Canada, in 2013. Goswami et al. [29] also isolated A. baumannii from the river in West Bengal, India. The isolation of the pathogen from water sources might be due to contamination coming from hospital wastewater and materials.

The virulence traits of the clinically important Acinetobacter species such as A. baumannii and A. nosocomialis have been a major research focus in recent times [17, 39]. This is due to the nature of A. baumannii infections as well as the role virulence genes play in the pathogenicity of the emerging waterborne pathogen. Virulence genes are the mechanisms through which A. baumannii initiates pathogenesis [39, 40, 41], most especially in the clinical settings. In this study, the occurrence of these pathogens in the freshwater resources was evaluated, and the virulence factors harboured by them were also considered. Although, A. baumannii had been confirmed to harbour several virulence factors (genes), seven of these (afa/draBC, epsA, fimH, OmpA, PAI, sfa/focDE, and traT) are reported in this study. Most of the reports on the virulence genes harbored by A. baumannii are usually associated with isolates from clinical environment, whereas there are rare reports on A. baumannii from a natural environment harboring virulence genes. Findings of this study showed that OmpA gene was predominantly exhibited by the A. baumannii in all the rivers sampled, fimH and epsA genes were also detected in many of the isolates, whereas afa/draBC, PAI, Sfa/focDE, and traT were detected in a few Acinetobacter isolates. As such, the exhibition of virulence genes varies from one isolate to the other, which was also reported among clinical isolates known for nosocomial infections [42]. The OmpA gene is the main outer membrane protein (OMP) located on the A. baumannii membrane [43, 44], which readily influence the virulence of an A. baumannii isolate [39]. These observations corroborate the findings of this current study which report that the virulence profiles of individual isolate varied greatly and OmpA was mostly detected [39].

Generally, the outer membranes of Gram-negative bacteria are made up of the OMPs, lipopolysaccharides and phospholipids layer [41]. The presence of outer membrane protein A gene (OmpA) in the A. baumanni isolated from the natural environment is of a major concern based with respect to pathogenesis [39, 40, 41]. Besides, studies have shown that A. baumannii uses OmpA for adhesion to the lung epithelial cell by interacting with a cell cytoskeleton such as fibronectin on the cell surface and thereby inducing pneumonia [45, 46, 47, 48, 49]. It also causes cell death through caspase-3 activation [50, 51]. Similarly, A. baumannii could be responsible for apoptosis through the translocation of its OmpA into the mitochondria and the nucleus of host cells [47, 52, 53]. The combination of the roles played by OmpA makes it an important virulence factor in the pathogenesis of A. baumannii infection. Moreover, antibiotic resistance in A. baumannii is also associated with OmpA [54, 55]. It was suggested that OmpA was involved in the removal of antibiotics from the periplasmic space membrane efflux systems [55]. The survival and persistence of A. baumannii in the cell are enhanced by OmpA due to the formation of biofilms and surface motility.

In this study, three selected freshwater resources in the Eastern Cape Province, South Africa were evaluated for the occurrence, distribution and virulence genes fingerprints of clinically important Acinetobacter species namely; Acinetobacter baumannii and Acinetobacter nosocomialis. This study suggests that these pathogenic Acinetobacter species could also inhabit aquatic environment. As a result, the natural environment is an important reservoir for pathogenic Acinetobacter species as detected in this study. Besides, the OmpA is the major virulence factor associated with Acinetobacter baumannii and Acinetobacter nosocomialis in this study. As such, identification of these opportunistic and virulent waterborne pathogens in the freshwater resources requires public awareness and recognition as important to public health risks.

Description of study areas

Collection of water samples was carried out on three rivers namely; Great Fish, Keiskamma and Tyhume, in the Eastern Cape Province, South Africa between April 2017 and March 2018. The Great Fish River is located in Chris Hani District Municipality in the Eastern Cape Province and it is one of the major rivers used for irrigation and livestock farming in the area. This river is prone to agricultural and municipal runoffs and also serves as the receiving stream of effluents from many wastewater treatment plants (WWTPs), especially those situated in urban communities such as Craddock. Keiskamma and Tyhume rivers are located in the Amathole District Municipality in the Eastern Cape Province and are exposed to different anthropogenic activities from the rural and urban communities along the river courses, such as livestock drinking and irrigation farming. In addition, these rivers receive effluents from wastewater treatment plants (WWTPs) situated close to their banks. Different sampling points on these rivers were selected based on where humans and animals come into direct contact with them, for example, points where they are used for fishing, drinking and swimming purposes, downstream of the WWTPs, points where irrigation water is released to the water bodies and proximity to hospital facilities.

Sampling

Water samples were collected from Great Fish, Keiskamma and Tyhume rivers respectively, for a period of one year to cover the four seasonal patterns in South Africa (autumn, winter, spring, and summer). Water samples were collected aseptically in sterile 1L glass bottles from different sampling points by midstream-dipping of sample bottles at 25–30 cm down the water column, with the mouth tilting against the flow of the river. All water samples were labelled properly and safely taken to the laboratory (in an ice chest) where they were processed within 6 h of collection [27]. Aliquots of water samples were used for isolation of Acinetobacter species based on standard microbiological procedures [56].

Isolation and purification of presumptive Acinetobacter species

The isolation of the presumptive density of Acinetobacter species in the water samples was determined by membrane filtration technique [57]. Cellulose membrane of pore size 0.45 𝜇m was used to filter three volumes of 100 mL of the water samples under vacuum [57]. These membranes were aseptically placed on plates with Acinetobacter species selective medium- CHROMagar Acinetobacter base plus selective supplement (CHROMagar, Paris, France) which was prepared according to the manufacturer’ instruction. Each sample plate was subjected to incubation at 37^oC for 24 h after inoculation. Each sample was analysed in triplicate. All bacterial colonies with red colouration on the CHROMagar plates were counted as presumptive Acinetobacter spp. and were expressed as CFU/100ml. All isolates were sub-cultured on nutrient agar using a streak plate method (Oxoid, UK) and purified for further species identification. Fifty percent (50%) glycerol stocks of the pure culture was prepared and stored at -80 ^∘C.

Molecular identification of Acinetobacter species by PCR assays

Extraction of genomic DNA: Presumptive Acinetobacter spp. in glycerol stocks was first being resuscitated on tryptic soy broth and incubated for 18 to 24h at 37 ^∘C. DNA extraction from the bacterial isolates was carried out using the direct boiling method according to [58]. The broth culture was centrifuged at 15000 rpm for 5 min using a Mini Spin Microcentrifuge (Lasec, RSA), then the supernatant was dispensed out and the pellet rinsed with sterile normal saline. The pellet was re-suspended in sterile distilled water and boiled in a heating block for 10 minutes using an AccuBlock (Digital dry bath, Labnet).

Amplification of unique Acinetobacter species DNA

Polymerase chain reaction (PCR) assay of was used for the amplification of the Acinetobacter spp recA gene as previously described [32]. The forward and reverse primers used were P-rA1 (5′-CCTGAATCTTCTGGTAAAAC-3′) and P-rA2 (5′-GTTTCTGGGCTGCCAAACATTAC-3′) respectively. Briefly, an aliquot of 25 µl containing Taq PCR (12.5 µl) Master Mix (Qiagen, Hilden, Germany), each of the primers (1 µl) (Inqaba, SA), nuclease-free water (6.5 µl) and DNA template (5 µl) was used for the PCR amplification assay. The condition for the amplification included initial denaturation step (94 ^oC, 5 min), followed by 35 cycles (92 ^oC, 40 s), annealing (58 ^oC, 40 s), and the final extension step (72^oC,10 min) was performed using a thermocycler (Bio-Rad Thermal cycler, USA). Five microlitres (5 µl) of the amplicon was subjected to gel (1.5% agarose) electrophoresis at 100 Volts for 45 min in Tris Boric EDTA buffer (pH 8.0) (0.089 M Tris, 0.089 M boric acid, and 0.002 M EDTA). Ethidium bromide (5 µl of 0.5 mg/ml) (Sigma-Aldrich, USA) was used for gel staining and DNA ladder (100 bp) (Thermo Scientific, (EU) Lithuania) was added into the gels as a standard. Finally, DNA bands were visualized under an ultraviolet transilluminator (Alliance 4.7, France).

Delineation of Genus Acinetobacter into strains

The confirmed Acinetobacter isolates were delineated into species accordingly [32] using a PCR assay. The sequences of the primer used are listed in Table 3. Here, PCR amplification was performed as stated in the previous section.

Detection of virulence genes

Polymerase chain reactions were also carried out for the identification of some Acinetobacter virulence genes including afa/draBC, epsA, fimH, OmpA, PAI, sfa/focDE, and traT genes, which have been previously found in clinical samples [61, 62]. The list of primers used and their annealing temperatures are shown presented in Table 4. The standard strain of A. baumannii DSM-30007 (DSMZ, Germany) was used as positive control. There was no positive control available for A. nosocomialis. The PCR assay and electrophoresis were conducted as earlier described.

Statistical Analysis

All statistical analyses were performed using the Statistica software v13.4.0.14 (64-bits). A simple factorial ANOVA was performed for the comparison of normally distributed data. The p-values of less than 0.05 were considered statistically significant for all the statistical tests performed.

ACB: Acinetobacter calcoaceticus- baumannii complex;

ANOVA: Analysis of Variance;

APHA: American Public Health Association;

CFU: Colony Forming Unit;

CHROMagar: Chromogenic agar;

DNA: Deoxyribonucleic Acid;

EDTA: Ethylenediamine tetraacetic acid;

EspA: Exopolysaccharide A;

EU: European Union;

ICU: Intensive care unit;

L: Ladder;

LPS: Lipopolysaccharides;

N: Negative control;

ND: Not determined;

NRF: National Research Foundation;

ompA: Outer membrane protein A precursor;

OMVs: Outer membrane vesicles;

P: Positive control;

PAI: Pathogenicity Island;

PCR: Polymerase Chain Reaction;

RSA: Republic of South Africa;

SAMRC: South African Medical Research Council;

TWAS: The World Academy of Science;

UFH: University of Fort Hare;

UK: United Kingdom;

USA: United States of America;

WWTPs: Wastewater treatment plants.

Ethics approval and consent to participate

Collection of freshwater samples for research purposes in this region does not require governmental permission since freshwater resources investigated are within the University jurisdiction and also the need for ethical approval was waived by the Research Ethics Committee, University of Fort Hare, since samples analysed in this study do not require human or animal subjects.

Consent for publication

Not applicable

Availability of data and materials

The data used and analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

The research was funded by the National Research Foundation, South Africa/The World Academy of Science, Italy (NRF/TWAS) (grant numbers: 99767 and 116387) and the South African Medical Research Council (grant number: SAMRC/UFH/P790). The funders had no role in the study design, data collection and analysis, decision to publish, or manuscript preparation.

Authors’ contributions

MAA conceived and designed the experiment, collected the water samples, isolated the Acinetobacter spp., performed the experiments, data and statistical analyses, and writing of the manuscripts.

AIO supervised the research, provided financial support, and reviewed the manuscript.

All authors read and approved the final manuscript.

Acknowledgements

Not applicable

Authors’ information

Not applicable.

De Vos D, Jean-Paul P, Florence B, Serge J, Gilbert V, Thomas R, Elkana K, Petra B, Thierry P, Mony H, Walter H, Frank DP, Patrick S, Maia M, Pieter D, Mario V, Pierre B, Youri G, Bruno P, Tanny JR, Dijkshoorn L. Molecular Epidemiology and Clinical Impact of Acinetobacter calcoaceticus-baumannii complex in a Belgian Burn Wound Center. PLoS ONE. 2016; 11(5): e0156237.

Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: emergence of a successful pathogen. Clin Microbiol Rev. 2008; 21, 538–582.

Hamouda A, Findlay J, Al Hassan L, Amyes SG. Epidemiology of Acinetobacter baumannii of animal origin. J. Antimicrob. Agents. 2011; 38, 314–318.

Huys G, Bartie K, Cnockaert M, Hoang Oanh DT, Phuong NT, Somsiri T, Chinabut S, Yussoff FD, Shariff M, Giacomini M, Teale A, Swings J. Biodiversity of chloramphenicol-resistant mesophilic heterotrophs from Southeast Asian aquaculture environments. Microbiol. 2007; 158, 228–235. doi:10.1016/j.resmic.2006.12.011.

Hrenovic J, Durn G, Goic-Barisic I, Kovacic A. Occurrence of an Environmental Acinetobacter baumannii Strain Similar to a Clinical Isolate in Paleosol from Croatia. Applied and Environmental Microbiology, 2014; 80(6): 2860–2866.

Almasaudi SB. Acinetobacter as nosocomial pathogens: Epidemiology and resistance features. Saudi Journal of Biological Sciences. 2018; 25, 586–596.

Jung J, Park W. Acinetobacter species as model microorganisms in environmental microbiology: current state and perspectives. Appl. Microbiol. Biotechnol. 2015; 99, 2533–2548.

Doughari HJ, Ndakidemi PA, Human IS, Benade S. The ecology, biology and pathogenesis of Acinetobacter spp.: an overview. Microbes Environ. 2011; 26, 101–112.

Whitman TJ, Qasba SS, Timpone JG, Babel BS, Kasper MR, English JF, Sanders JW, Hujer KM, Hujer AM, Endimiani A. Occupational transmission of Acinetobacter baumannii from a United States serviceman wounded in Iraq to a health care worker. Infect. Dis. 2008; 47, 439–443.

Garnacho-Montero J, Amaya-Villar R, Ferrandiz-Millon C, Dıaz-Martın A, Lopez-Sanchez JM, Gutierrez-Pizarraya A. Optimum treatment strategies for carbapenem-resistant Acinetobacter baumannii Expert Rev. Anti. Infect. Ther. 2015; 13(6): 769-77.

Falagas ME, Vardakas KZ, Kapaskelis A, Triarides NA, Roussos NS. Tetracyclines for multidrug-resistant Acinetobacter baumannii International Journal of Antimicrobial Agents. 2015; 45, 455–460.

Basri R, Zueter AR, Mohamed Z, Alam MK, Norsa’adah B, Hasan SA, Hasan H, Ahmad F. Burden of bacterial meningitis: a retrospective review on laboratory parameters and factors associated with death in meningitis, Kelantan Malaysia. Nagoya J. Med. Sci. 2015; 77: 59-68.

Lai HH, Liou BH, Chang YY, Kuo SC, Lee YT, Chen TL, Fung CP. Risk factors and clinical outcome of sulbactam non-susceptibility in monomicrobial Acinetobacter nosocomialis Journal of Microbiology, Immunology and Infection. 2016; 49, 371-377.

Liu YM, Lee YZ, Kuo SC, Chen TL, Liu CP, Liu CE. Comparison between bacteremia caused by Acinetobacter pittii and Acinetobacter nosocomialis. Journal of Microbiology, Immunology and Infection. 2017; 50, 62–67.

Lee YT, Kuo SC, Yang SP, Lin YT, Chiang DH, Tseng FC, Chen TL, Fung CP. Bacteremic nosocomial pneumonia caused by Acinetobacter baumannii and Acinetobacter nosocomialis: a single or two distinct clinical entities. European Society of Clinical Microbiology and Infectious Diseases, CMI. 2012; 19, 640–645.

Nho JS, Jun SH, Oh MH, Park TI, Choi CW, Kim S, Choi CH, Lee JC. Acinetobacter nosocomialis secretes outer membrane vesicles that induce epithelial cell death and host inflammatory responses. Microbial Pathogenesis. 2015; 81, 39-45.

Lee CR, Lee JH, Park M, Park KS, Bae IK, Kim YB, Cha CJ, Jeong BC, Lee SH. Biology of Acinetobacter baumannii: Pathogenesis, Antibiotic Resistance Mechanisms, and Prospective Treatment Options. Frontiers in Cellular Infection Microbiology. 2017; 7(March) https://doi.org/10.3389/fcimb.2017.00055.

Kurcik-Trajkovska B. Acinetobacter – a serious enemy threatening hospitals worldwide. Macedonian Journal of Medical Science. 2009; 2, 157–162.

Kanafani AZ, Kanj SS. Ministry of Health, Kingdome of Saudi Arabia. 2014. http://www.uptodate.com/contents/acinetobacterinfection-treatment-and-prevention.

Kim SW, Oh MW, Jun SH, Jeon H, Kim S, Kim K, Lee YC, Lee JC. Outer Membrane Protein A plays a role in pathogenesis of Acinetobacter nosocomialis. Virulence. 2016; 7:4, 413-426, DOI: 10.1080/21505594.2016.1140298.

Ellis TN, Kuehn MJ. Virulence and immunomodulatory roles of bacterial outer membrane vesicles. Microbiology and Molecular Biology Review. 2010; 74, 81–94. doi: 10.1128/MMBR.00031-09.

Kwon SO, Gho YS, Lee JC, Kim SI. Proteome analysis of outer membrane vesicles from a clinical Acinetobacter baumannii FEMS Microbiology Letter. 2009; 297, 150–156. doi: 10.1111/j.1574-6968.2009.01669.

Jun SH, Lee JH, Kim BR, Kim SI, Park TI, Lee JC, Lee YC. Acinetobacter baumannii outer membrane vesicles elicit a potent innate immune response via membrane proteins. PLoS ONE. 2013; 8, e71751. doi: 10.1371/journal.pone.0071751.

Fiester SE, Arivett BA, Schmidt RE, Beckett AC, Ticak T, Carrier MV, Ghosh R, Ohneck EJ, Metz ML, Jeffries MKS, Actis LA. Iron-regulated phospholipase C activity contributes to the cytolytic activity and virulence of Acinetobacter baumannii. PLoS ONE. 2016; 11:e0167068. doi: 10.1371/journal.pone.0167068.

Diancourt L, Passet V, Nemec A, Dijkshoorn L, Brisse S. The population structure of Acinetobacter baumannii: expanding multiresistant clones from an ancestral susceptible genetic pool. PLoS ONE. 2010; e10034.doi: 10.1371/journal.pone.0010034.

Fernando DM, Khan IUH, Patidar R, Lapen DR,Talbo G, Topp E, Kumar A. Isolation and Characterization of Acinetobacter baumannii recovered from Campylobacter Selective Medium. Frontiers in Microbiology; 2016; 7:1871.

Maravic A, Skocibusic, M, Fredotovic Z, Samanic I, Cvjetan S, Knezovic M, Puizina J. Urban riverine environment is a source of multidrug-resistant and ESBL-producing clinically important Acinetobacter Environ Sci Pollut Res. 2016; 23, 3525–3535.

Krizova L, Maixnerovaa M, Sedob O, Nemec A. Acinetobacter bohemicus nov.wide spread in natural soil and water ecosystems in the Czech Republic.Systematic and Applied Microbiology. 2014; 37, 467–473.

Goswami R, Mukherjee S, Rana VS, Saha DR, Raman R, Padhy PK, Mazumder S. Isolation and Characterization of Arsenic-Resistant Bacteria from Contaminated Water-Bodies in West Bengal, India. Geo microbiology Journal. 2015; 32, 17–26.

Xiong W, Sun Y, Zhang T, Ding X, Li Y, Wang M, Zeng Z. Antibiotics, Antibiotic Resistance Genes, and Bacterial Community Composition in Fresh Water Aquaculture Environment in China. Microb Ecol. 2015; 70:425–432.

Zhao J, Zhao X, Chao L, Zhang W, You T, Zhang J. Diversity change of microbial communities responding to zinc and arsenic pollution in a river of northeastern China. J Zhejiang Univ-Sci B (Biomed and Biotechnol). 2014; 15(7):670–680.

Chen TL, Lee YT, Kuo SC, Yang SP, Fung CP, Lee SD. Rapid identification of Acinetobacter baumannii, Acinetobacter nosocomialis and Acinetobacter pittii with a multiplex PCR assay. Journal of Medical Microbiology, 2014; 63, 1154–1159.

Chiang MC, Kuo SC, Chen YC, Lee YT, Chen TL, Fung CP. Polymerase chain reaction assay for the detection of Acinetobacter baumannii in endotracheal aspirates from patients in the intensive care unit. Journal of Microbiology, Immunology and Infection. 2011; 44, 106–110.

Dijkshoorn L, Nemec A, Seifert H. An increasing threat in hospitals: multidrug-resistant Acinetobacter baumannii. Nat Rev Microbiol. 2007; 5, 939–951.

Park YK, Jung SI, Park KH, Kim DH, Choi JY, Kim SH, Ko KS. Changes in antimicrobial susceptibility and major clones of Acinetobacter calcoaceticus–baumannii complex isolates from a single hospital in Korea over 7 years. Journal of Medical Microbiology. 2012; 61(1) 71–79.

Anh NT, Thieu Nga TV, Tuan HM, Tuan NS, Dao Y, Chau NVV, Baker S, Duong HHT. Molecular epidemiology and antimicrobial resistance phenotypes of Acinetobacter baumannii isolated from patients in three hospitals in southern Vietnam. Journal of Medical Microbiology. 2017; 66:46–53.

Sileem AE, Said AM, Meleha MS. Acinetobacter baumannii in ICU patients: A prospective study highlighting their incidence, antibiotic sensitivity pattern and impact on ICU stay and mortality. Egyptian Journal of Chest Diseases and Tuberculosis. 2017; 66 693–698.

Berlau J, Aucken HM, Houang E, Pitt TL. Isolation of Acinetobacter spp including baumannii from vegetables: implications for hospital-acquired infections. Journal of Hospital Infection. 1999; 42: 201–204.

Ambrosi C, Scribano D, Aleandri M, Zagaglia C, Di Francesco L, Putignani L, Palamara AT. Acinetobacter baumannii Virulence Traits: A Comparative Study of a Novel Sequence Type with Other Italian Endemic International Clones. Front. Microbiol. 2017; 8:1977. doi: 10.3389/fmicb.2017.01977.

Eijkelkamp BA, Stroeher UH, Hassan KA, Paulsen IT, Brown MH. Comparative analysis of surface-exposed virulence factors of Acinetobacter baumannii. BMC Genomics. 2014; 15 (1020): 1-12.

Sato Y, Unno Y, Kawakami S, Ubagai T, Ono Y. Virulence characteristics of Acinetobacter baumannii clinical isolates vary with the expression levels of omps. Journal of Medical Microbiology. 2017; 66:203–212.

Antunes LCS, Imperi F, Carattoli A, Visca P. Deciphering the Multifactorial Nature of Acinetobacter baumannii PLoS ONE. 2011; 6(8): e22674. doi:10.1371/journal.pone.0022674.

Smith MG, Gianoulis TA, Pukatzki S, Mekalanos JJ, Ornston LN, Gerstein M, Snyder M. New insights into Acinetobacter baumannii pathogenesis revealed by high-density pyrosequencing and transposon mutagenesis. Genes and Development. 2007; 21:601–614.

McConnell MJ, Actis L, Pachon J. Acinetobacter baumannii: human infections, factors contributing to pathogenesis and animal models. FEMS Microbiol Rev. 2013; 37: 130–155.

Gaddy JA, Tomaras AP, Actis LA. The Acinetobacter baumannii 19606 OmpA protein plays a role in biofilm formation on abiotic surfaces and in the interaction of this pathogen with eukaryotic cells. Infection and Immunity. 2009; 77(8), 3150–3160.

Smani Y, Dominguez-Herrera J, Pachon J. Association of the outer membrane protein Omp33 with fitness and virulence of Acinetobacter baumannii. Journal of Infectious Disease. 2013; 208, 1561–1570. doi: 10.1093/infdis/jit386.

Choi CH, Hyun SH, Lee JY, Lee JS, Lee YS, Kim SA, Chae JP, Yoo SM, Lee JC. Acinetobacter baumannii outer membrane protein A targets the nucleus and induces cytotoxicity. Cell. Microbiol. 2008; 10: 309–319.

Lee JC, Koerten H, van den Broek P, Beekhuizen H, Wolterbeek R, van den Barselaar M, van der Reijden T, van der Meer J, van de Gevel J, Dijkshoorn L. Adherence of Acinetobacter baumannii strains to human bronchial epithelial cells. Res. Microbiol. 2006; 157:360–366.

Lee HW, Koh, YM, Kim J, Lee JC, Lee YC, Seol SY, Cho DT. Capacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to form biofilm and adhere to epithelial cell surfaces. Clin. Microbiol. Infect. 2008; 14:49–54.

Lee JC, Oh JY, Kim KS, Jeong YW, Park JC, Cho JW. Apoptotic cell death induced by Acinetobacter baumannii in epithelial cells through caspase-3 activation. APMIS. 2001; 109:679–684.

Smani Y, Domnguez-Herrera J, Pachon J. Rifampin protects human lung epithelial cells against cytotoxicity induced by clinical multi and pandrug-resistant Acinetobacter baumannii. European Congress of Clinical Microbiology and Infectious Diseases. 2011; Vienna, Austria, April 2010.

Choi CH, Lee EY, Lee YC, Park TI, Kim HJ, Hyun SH, Kim SA, Lee SK, Lee JC. Outer membrane protein 38 of Acinetobacter baumannii localizes to the mitochondria and induces apoptosis of epithelial cells. Cellular Microbiology. 2005; 7, 1127–1138. doi: 10.1111/j.1462-5822.2005.00538.

Lee JS, Choi CH, Kim JW, Lee JC. Acinetobacter baumannii outer membrane protein A induces dendritic cell death through mitochondrial targeting. Journal of Microbiology, 2010; 48, 387–392. doi: 10.1007/s12275-010-0155-1.

Sugawara E, Nikaido H. OmpA is the principal nonspecific slow porin of Acinetobacter baumannii. Bacteriol. 2012; 194, 4089–4096. doi: 10.1128/JB.00435-12.

Smani Y, Fabrega A, Roca I, Sanchez-Encinales V, Vila J, Pachon J. Role of OmpA in the multidrug resistance phenotype of Acinetobacter baumannii. Antimicrob. Agents Chemother. 2014; 58, 1806–1808. doi: 10.1128/AAC.02101-13.

Sibanda T, Chigor VN, Koba S, Obi CL, Okoh AI. Characterisation of the physicochemical qualities of a typical rural-based river: ecological and public health implications. Int. J. Environ. Sci. Technol. 2014; 11:1771–1780.

American Public Health Association, APHA. Standard Methods for the Examination of Water and Wastewater, 20th Ed.; (APHA): Washington, DC, USA. 2005.

Maugeri TL, Carbone M, Fera MT, Gugliandolo C. Detection and differentiation of Vibrio vulnificus in seawater and plankton f a coastal zone of the Mediterranean Sea. Research in Microbiology. 2006; 157(2), 194–200.

Chen TL, Siu LK, Wu RCC, Shaio MF, Huang LY, Fung CP, Lee CM, Cho WL. Comparison of one-tube multiplex PCR, automated ribotyping and intergenic spacer (ITS) sequencing for rapid identification of Acinetobacter baumannii. Clin Microbiol Infect; 2007; 13: 801–806.

Higgins PG, Wisplinghoff H, Krut O, Seifert H. A PCR-based method to differentiate between Acinetobacter baumannii and Acinetobacter genomic species 13TU. Clin Microbiol Infect. 2007; 13:1199–1201.

Thummeepak R, Kongthai P, Leungtongkam U, Sitthisak S. Distribution of virulence genes involved in biofilm formation in multi-drug resistant Acinetobacter baumannii clinical isolates. International Microbiology. 2016; 19:121-129 doi:10.2436/20.1501.01.270.

Momtaz H, Seifati SM, Tavakol M. Determining the prevalence and detection of the most prevalent virulence genes in Acinetobacter baumannii isolated from hospital infections. Int J Med Lab. 2015; 2(2):87–97.

Braun G, Vidotto MC. Evaluation of Adherence, Hemagglutination, and Presence of Genes Codifying for Virulence Factors of Acinetobacter baumannii Causing Urinary Tract Infection. Mem Inst Oswaldo Cruz, Rio de Janeiro, 2004; 99(8): 839-844.

Table 1: Summary of the relative abundance of the genus Acinetobacter and two clinically important species in the freshwater studied

Rivers sampled	Presumptive isolates	**Acinetobactergenus**	*Delineated Acinetobacterspecies*		Other species (ND)
Rivers sampled	Presumptive isolates	**Acinetobactergenus**	*A. baumannii*	*A. nosocomialis*	Other species (ND)
Great Fish	370	285(77.01%)	153(53.68%)	16(5.61%)	116(40.70%)
Keiskamma	309	219(70.87%)	102(46.58%)	3(1.37%)	114(52.06%)
Tyhume	428	340(79.44%)	155(45.59%)	4(1.18%)	181(53.24%)
Total	1107	844(76.24%)	410(48.58%)	23(2.73%)	411(48.70%)

ND= not determined

Table 2: Virulence gene factors of A.baumannii and A. nosocomialis isolates in addition to which river they belong to.

Virulence gene	Sample sites
	Great Fish		Kieskamma		Tyhume
	A. baumannii (n=153)	A. nosocomialis (n=16)	A. baumannii (n=102)	A. nosocomialis (n=3)	A. baumannii (n=155)	A. nosocomialis (n=4)
*Afa/draBC*	16(10.46%)	-	4 (3.92%)	-	8 (5.81)	1 (25%)
*espA*	36 (23.53%)	-	15 (14.71%)	-	44 (28.39%)	1 (25%)
*fimH*	44 (28.76%)	-	26 (25.49%)	1(33.33%)	30 (19.36%)	1 (25%)
*OmpA*	69 (45.10%)	-	52 (50.98%)	-	77 (49.68%)	-
PAI	2 (1.31%)	1(6.26%)	3 (2.94%)	-	-	-
*Sfa/focDE*	3 (1.96%)	-	4 (3.92%)	-	7 (4.52%)	-
*traT*	19 (12.42%)	-	4 (3.92%)	-	22 14.19%)	-

Table 3: The list of primers used for delineation of the presumptive Acinetobacter isolates into species.

Target gene	Primer name	Primer sequence(5ˈ-3ˈ)	Amplicon size (bp)	Reference
gyrB	P-Ab-ITSF	CATTATCACGGTAATTAGTG	208	[59]
	P-Ab-ITSR	AGAGCACTGTGCACTTAAG
gyrB	sp4F	CACGCCGTAAGAGTGCATTA	294	[60]
	sp4R	AACGGAGCTTGTCAGGGTTA

Table 4: PCR primers for determination of virulence genes in Acinetobacter isolates

Gene	Virulence factor	Primer sequences	Amplicon size	Tm (^oC)	Reference
afa/draBC	Dr fimbriae	GCTGGGCAGCAAACTGATAACTCTC CATCAAGCTGTTTGTTCGTCCGCCG	750	63	[63]
epsA	Exo-polysaccharide	AGCAAGTGGTTATCCAATCG ACCAGACTCACCCATTACAT	451	50	[61]
fimH	Type 1 fimbriae	TGCAGAACGGATAAGCCGTGG GCAGTCACCTGCCCTCCGGTA	508	63	[63]
OmpA	Outer membrane protein	CGCTTCTGCTGGTGCTGAAT CGTGCAGTAGCGTTAGGGTA	531	50	[61]
PAI	Pathogenicity-associated island	GGACATCCTGTTACAGCGCGCA TCGCCACCAATCACAGCCGAAC	930	50	[63]
Sfa/focDE	S fimbriae	CTCCGGAGAACTGGGTGCATCTTAC CGGAGGAGTAATTACAAACCTGGCA	410	63	[63]
traT	Serum resistance	GGTGTGGTGCGATGAGCACAG CACGGTTCAGCCATCCCTGAG	290	63	[63]

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Occurrence, distribution and virulence factors of clinically important Acinetobacter species recovered from selected freshwater resources in the Eastern Cape Province, South Africa

Status:

Version 1

Abstract

Figures

Background

Results

Discussion

Conclusions

Methods

Abbreviations

Declarations

References

Tables

Status:

Version 1