Study area
The study was conducted in two malaria sentinel sites in Ethiopia namely Shewa Robit health centre at North East and Metehara health center at Eastern Ethiopia. The health care facilities are located in the malaria elimination targeted areas of Ethiopia. EPHI in collaboration with Federal Ministry of Health established 25 malaria sentinel surveillance sites, representing regional malaria cover in Ethiopia. These sites are eco-epidemiologically representative and focal area of malaria infection.
Study design and period
Facility based cross sectional study was conducted from December, 2019 to March, 2020 on malaria suspected febrile outpatients referred to the laboratory.
Participant Selection Criteria
Inclusion criteria
All malaria suspected febrile patients of any age referred to the laboratory for malaria testing were included in this study.
Exclusion criteria
Patients who take antimalarial therapy in the past 4 weeks before sample collection and critically ill patients were excluded from the study.
Sample Size Calculation And Sampling Technique
Sample size calculation
Sample size was calculated using Buderer’s formula (15) as follows:
Z 2 1−α/2 x SN x (1- SN)
L 2 x Prevalence
Z1−α/2 (standard normal deviate corresponding to the specified size of the critical region (α) = 1.96, SN (anticipated sensitivity) = 0.9, Prevalence = 13%, L (absolute precision desired on either side of sensitivity) = 0.1. Because we couldn’t find previous malaria prevalence studies done using multiplex real time PCR, we estimated (intellectual guess) malaria prevalence of 13% and the anticipated sensitivity of this method as 90%(95%CI: 80–100%) for P. falciparum, compared to conventional PCR. Then, a total of 271 participants were enrolled into this study.
Sampling technique
Convenient sampling technique was used on consecutive basis to recruit the study subjects referred to the laboratory for malaria testing.
Data Collection Procedure
After getting patient consents, demographic profiles and clinical data were collected using structured questionnaire. Using capillary blood taken from each patient, thick and thin smears were prepared for microscopy. RDT testing was performed at spot and five circles of dried blood spot (DBS) were collected on Whatman filter paper and transported by cold chain to EPHI laboratory for the molecular tests.
Laboratory Analysis
Rapid diagnostic test (RDT)
RDT testing was performed as per the manufacturer instruction using CareStart™ malaria HRP2/pLDH combo test. This test detects HRP2 and pLDH proteins specific to falciparum and vivax, respectively. The tests were performed in the field laboratory by health centers’ laboratory personnel as a routine malaria testing.
Malaria microscopy
After preparation of thick and thin blood films, slides were allowed to air-dry at room temperature and fixed using absolute methanol then stored at 2–8°C until transported to EPHI. In the EPHI parasitology laboratory, slides were stained with 10% Giemsa solution for 10 minutes, after being air dried, both thick and thin smear were examined by an experienced laboratory technologist. An expert microscopist rechecked all positive slides, and 10% of negative slides. According to WHO malaria microscopy standard operating procedure, at least 100 high power fields (HPFs) were examined for parasites detection.
DNA extraction
Genomic DNA extraction was performed using QiagenQIAamp® 96 DNA Blood Kit (QIAGEN Inc.) from DBS sample. Briefly, three 3-mm circles of the DBS punched out and placed into a 1.5-mL tube for processing as per manufacturer instructions. Finally, with 100µl volume of elution buffer the DNA was eluted and stored at -20°C until assayed.
Multiplex real time PCR
The PCR amplification was done by using primer and probes that targeting Plasmodium genus specific small unit of ribosomal RNA (18S rRNA), specific small unit of ribosomal RNA (P.v18S rRNA), and P. falciparum specific var gene acidic terminal sequence (varATS) (16). TaqMan fluorescence based DNA amplification and detection were performed using QuantStudio 5 Real time PCR system. For this study, the multiplex real time PCR assay were run in two round during the first run all samples were tested by multiplexing Pan-plasmodium specific and falciparum specific primers and the second were by multiplexing P. falciparum and P. vivax specific primers. Briefly, each reaction mixture was prepared by mixing 2µl of purified DNA template, 5µl Luna Universal Probe qPCR Master Mix (New England Biolabs, Inc.), 2µl PlasQ Primer Mix and 1µl molecular biology grade H2O with a final reaction mixture volume of 10µl. Amplifications were carried out using thermal cycling conditions: for the first PCR run 95℃ for 1 minute, followed by 45 cycles of 95℃ for 15 seconds and 57℃ for 45 seconds and for the second run 95℃ for 1 minute, followed by 45 cycles of 95℃ for 15 seconds and 53℃ for 45 seconds. The 3D7 DNA standard was run in each experiment and used as a positive control and nuclease free water used for a negative control.
Table 1
Primers and probes sequences used for qPCR assays in this study.
Target Gene | Oligo sequence | Fluorophores | TM ◦C |
Pspp18S F | GCTCTTTCTTGATTTCTTGGATG | | 51.71 |
Pspp18S R | AGCAGGTTAAGATCTCGTTCG | | 52.4 |
Pspp18S Cy5 | ATGGCCGTTTTTAGTTCGTG | Cyanine 5 | 52 |
PfvarATS F | CCCATACACAACCAAYTGGA | | 51.78 |
PfvarATS R | TTCGCACATATCTCTATGTCTATCT | | 52.76 |
PfvarATS FAM | TRTTCCATAAAGGT 5’- 3’ | Fluorescein | NA |
Pv18S F | ACTAGGCTTTGGATGAAAGATTTTA | | 53.23 |
Pspp18S R | AACCCAAAGACTTTGATTTCTCATAA | | 51.65 |
Pv18S probe | GAATTTTCTCTTCGGAGTTTAT | Cy5-BHQ2 | 46 |
HsRNaseP F | AGATTTGGACCTGCGAGCG | | 53.25 |
HsRNaseP R | GAGCGGCTGTCTCCACAAGT | | 55.88 |
HsRNaseP_1 | TTCTGACCTGAAGGCTCTGCGCG | HEX | 60.62 |
Data Quality Assurance
Onsite training was given to all data collectors. All blood films, DBS samples and RDT testing were performed based on standard operating procedures. The quality of each reagent was cheeked before the laboratory analysis was performed. Samples and reagents were stored at appropriate temperature as indicted on the manufacturer inserts. Internal and external quality controls were run as required during analysis, all remaining samples stored at -20℃, the collected data were checked for its consistency and completeness before any attempt to enter code and analyze the data. Data was double checked manually for completeness and consistency before data entry. Finally, Epi-Info version-7 was used to control and manage errors resulting from data entry process.
Data Analysis And Interpretation
The collected data were coded, entered into Epi-Info version-7, and was exported to STATA version 20 software before analysis and interpretation. Descriptive statistics was used to describe patient’s socio demographic and clinical characteristics. The sensitivity, specificity, predictive values and kappa coefficient was estimated by comparing results from all three assays and 95% confidence interval was computed.
Ethical Considerations
This study was approved by Institutional Ethical Review board of College of Health Sciences, Addis Ababa University and Scientific and ethical review office of EPHI (Protocol number: EPHI-IRB-219-2019). Official letter was written to sentinel sites. The confidentiality of patient related data was maintained by avoiding possible identifiers such as name of the patient. Finally, after the whole process of data collection, all data was kept safe throughout the whole process of the research work.