Cell culture and cell infection
Hepatocellular carcinoma cell lines Huh7, MHCC-97L, SK-HEP-1, BEL-7404 and HepG2 were purchased from BeNa Technology (Hangzhou, China) and cultured in a cell incubator with a humid condition at 37°C with 5% CO2. Cells were cultured in 90% RPMI-1640 (31800022, GIBCOA) supplemented with 10% fetal bovine serum (FBS) (10099-141, GIBCO). The shPOLQ SK-HEP-1 and BEL-7404 cells and the control cells were established by knockdown lentiviral vector (1×108 TU/mL) infection with ENI.S and Polybrene. After culturing for 72 h, the infection efficiency was detected by GFP fluorescence.
Clinical specimens
To assess the protein POLQ (NM_199420) expression level, we analyzed 180 pathological sections via IHC assay. Endogenous peroxidase was deactivated by 3% H2O2 and non-specific-binding sites were blocked with 4% skim milk powder for 30 min. Sections were immersed into antigen-retrieval solution for antigen retrieval at 95°C for 30 min. The sections were then incubated with primary antibody for POLQ protein overnight at 4°C. The corresponding secondary antibody was then added to incubate for 30 min at room temperature. All slides were stained DAB solution and counterstained with 10% Harris haematoxylin. IHC results were judged by positive cell score and staining color intensity score. POLQ expression positive cell scored as follows: negative: no positive signal; positive: 1 point, 0% < positive cells accounted for <25%; 2 points, 25%≤ positive cells proportion <50%; 3 points, 50%≤ positive cells <75%; 4 points, positive cells proportion ≥75%. The intensity was scored as: 0 point, no positive signal; 1 point, weak; 2 points, moderate; 3 points intense.
Lentiviral vector construction
According to the principle of RNA interference sequence design, multiple 19-21nt were designed based on the POLQ template RNA interferes with the target sequence. After the evaluation and determination of the design software, the following sequences are selected as interference targets. Human-POLQ-1, AAGGATAAAGCTTAATACAGA, Human-POLQ-2, TATTTCAAACTTGGAGACAAA, Human-POLQ-3, GTGGAAGAAGCCAGAATGATT. POLQ cDNA was generated by PCR, and subsequently cloned into BR-V108. The plasmids were extracted with TIANgel Midi Purification Kit (TIANGEN, DP209-03) and EndoFree Maxi Plasmid Kit (TIANGEN, DP117) and POLQ lentivirus was packaged.
qRT PCR
Total RNA was extracted from cell following Sigma Trizol instructions, the concentration and quality of RNA was determined by Nanodrop 2000/2000c spectrophotometer (Thermo Fisher Scientific). RNA was reverse transcribed into cDNA by M-MLV kit (Promega). Real-time PCR was performed with SYBR premix EX Tap (TAKARA). PCR cycling program was conducted, holding at 95°C for 30 s, two steps PCR at 95°C for 5 s, 60°C for 30 s, dissociation at 95°C for 15 s, 60°C for 30 s, and 95°C for 15 s. The relative quantitative analysis in gene expression data was analyzed by 2−ΔΔCt method and the melt curve was drawn. The primers sequences were showed as follow and GAPDH was served as inner control:
POLQ Forward primer: 5’-TCCTACACCCATTCCAACATCTG-3’,
Reverse primer: 5’-GTCTTTGAACCCATTTCTACTCCC-3’;
GAPDH Forward primer: 5’-TGACTTCAACAGCGACACCCA-3’,
Reverse primer: 5’-CACCCTGTTGCTGTAGCCAAA-3’.
Western blot assay
Sample protein from shPOLQ and shCrol SK-HEP-1 and BEL-7404 cells were subjected to western blot analysis. Briefly, after bathed in boiling water for 10 min, the total cellular proteins were subjected to SDS-PAGE (10%). After transferring to polyvinylidene difluoride (PVDF) membranes, blots were incubated with 5% BSA (Gibco) in Trisbuffered saline containing 0.5% Tween 20 for 60 min and incubated overnight at 4°C on a rocker with the following primary antibodies: anti-POLQ (biorbyt, # orb48495), anti-mTOR (abcam, # ab2732), anti-p-mTOR (abcam, # ab137133), anti-CCND1 (CST, # 2978), anti-Bcl-2 (abcam, # ab196495), anti-c-Myc (CST, # 5605) and anti-GAPDH (Bioworld, # AP0063). Following washing three times with TBST for 5 min, the plots were then incubated with horseradish peroxidase (HRP) conjugated goat anti-rabbit IgG polyclonal secondary antibody (1:3000, Beyotime, # A0216) at room temperature for 1 h. Amersham’s ECL + plusTM western blotting system kit was used for color developing. Signals were detected with enhanced chemiluminescence, using GAPDH as the internal standard (Kodak), and analyzed by ImageJ software.
Cell apoptosis detection
Apoptotic cells were identified using Annexin V-FITC Apoptosis kit (eBioscience, 88-8007-74) by flow cytometric methods. Transfected cells and corresponding control cells were plated in a six-well plate (2 mL/well) and cultured to 85% confluence. Cells were collected and centrifuged at 1300 rmp for 5 min, supernatant was discarded and cells were washed with 4°C pre-cooled D-Hanks (pH=7.2-7.4) and resuspended in the 1 × binding buffer. 10 μL Annexin V-APC was stained for 15 min in the dark. Apoptotic cells were measured using Guava easyCyte HT FACScan (Millipore) to assess the apoptotic rate.
Colony formation Assay
Transfected cells and corresponding control cells suspension was seeded into 6-well plates with 500 cell/well. Continuously cultured for 14 days, cells were immobilized with 4% paraformaldehyde and stained with GIEMSA (DingGuo Biotechnology). Colonies (containing more than 50 cells) were photographed with a digital camera. The proliferative potential was assessed by counting clone numbers.
MTT assay
The viability of lentivirus infected cells were assessed using MTT assay. 0.1 mL cell suspension was seeded into a 96-well plate (2 000 cells/well) (Cornning, # 3599) and cultured. Before detection, 20 μL 5 mg/mL MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) (Genview, # JT343) solution was added to each well reacted for 4 h, and 100 μL DMSO were added to lyse the Formazan crystal. OD490 was determined for each well using a microplate reader (Tecan infinite) at the same time of 5 continuous days. The cell viability ratio was calculated by the following formula: cell viability (%) = OD (shPOLQ)/OD (shCtrl) × 100%.
Wound healing assay
Infected cells and corresponding control cells (1 × 106 cells) were seeded in 6-well plates and cultured for 24 h to 90% confluence. Then, wounds were created using a 200 µL plastic pipette tip, and images were acquired at 0, 8 h and 24 h after wounding using a microscope. The speed of wound closure in multiple fields reflected the migratory ability of the tumor cells.
Transwell assay
Infected cells and corresponding control cells (1 × 104) were seeded in the upper chamber of a Transwell filters (Corning) with polycarbonate membrane (8 µm). 600 µL medium with 30% FBS was added into the lower chamber and cultured at 37°C for 24 h. Then the chamber was reversed on the absorbent paper to remove the medium and non-migrated cells were removed with cotton swabs. Migrated cells on the lower membrane surface were fixed and stained, 100× and 200× magnification pictures were plotted (five random fields per well were selected).
Animal tumor formation experiment and vivo animal imaging
Sufficient number of cells were prepared, and the tumor cells in the logarithmic growth stage were digested with trypsin, and then the medium was completely suspended. Then, the cells was injected subcutaneously into the 4-week-old, female BALB/c nude mice (purchased from Shanghai Jiesijie Experimental Animal Co., Ltd.) and the tumor-forming condition was observed. The tumor size and mice weight were measured. Tumor size and animal weight were measured every other day. The animal experiments were approved by the Ethics Committee of Hunan Provincial People's Hospital. Before being executed, mice were intraperitoneal injected 0.7% pentobarbital sodium solution (10 μL/g, SIGMA). After completely entered the coma state, the mice were put into the darkroom of the IVIS Spectrum imaging instrument (Perkin Elmer) for live animals, in vivo imaging detection is performed on mice according to the established detection procedures to observe the fluorescence expression in mice.
Statistical analyses
Each cell experiment was carried out at least 3 time under the same conditions. Qualitative data were shown as mean ± SD. The significance of the differences was determined using the two-tailed Student’s t test analyzed by SPSS version 21.0 with P values less than 0.05 as statistically significant. Mann-Whitney U and Pearson analysis were applied to explain the relationships between POLQ expression and tumor characteristics in patients with HCC.