Strains and Culture Conditions
The T. fuciformis haploid yeast-like cell Y32, was maintained in the Laboratory of Food Microbiology, Huazhong Agricultural University, and subcultured on potato dextrose agar (Difco, Detroit, MI, USA) slants. The LM medium (20 g·L−1 glucose, 1.32 g·L−1 (NH4)2SO4, 0.25 g·L−1 MgSO4·7H2O, 0.5 g·L−1 KH2PO4·3H2O, 0.2 mg·L−1 vitamin B1, 2 mg·L−1 ZnSO4·7H2O, and 0.5 g·L−1 CaCl2·2H2O) was designed for strain culturing. The strains were incubated at 25°C using an orbital shaker (Fuma, Shanghai, China) at 150 rpm. Escherichia coli DH5α (Takara, Dalian, China) was used as a host for vectors’ cloning and propagation. The Agrobacrerium tumefaciens strain EHA105 (Invitrogen, Shanghai, China), grown in YEB medium (Sigma-Aldrich, Shanghai, China) with the selective antibiotics (50 μg·mL−1 rifampicin and 100 μg·mL−1 kanamycin), was used to transform Y32. The T. fuciformis transformants were selected by PDSA (PDA containing 50 μg·mL−1 hygromycin and 200 μg·mL−1 cefotaxime sodium).
Full-length Gene Cloning and Bioinformatical Analysis
Gα subunit gene, named as TrGpa1, and the DNA (GenBank accession no. MH091706) and cDNA (GenBank accession no. MH101517) were acquired in our previous work. Total RNA and DNA were extracted from Y32 strain using the RNaisoTM plus (Takara, Dalian, China) and the cetyltrimethylammonium bromide (CTAB) method (Yin et al. 2015), respectively. The TrGpa1 was cloned by PCR with the specific primers listed on Table 1. The amplification procedures were carried out as follows: an initial denaturation at 94°C for 5 min; 35 cycles of 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C elongation for 90 s; and a final extension at 72°C for 10 min.
Table 1 Primers for PCR amplification in this work.
Names
|
Sequences (5’→3’)
|
Descriptions
|
TrGpa1-F
|
CATGGGGTGCACACAGTCG
|
Primers for TrGpa1
|
TrGpa1-R
|
TCAAAGCAATCCGACCTCCC
|
OE-F
|
CCTAGGATGGGGTGCACACAG
|
Primers for TrGpa1 overexpression
|
OE-R
|
TTCGAATCAAAGCAATCCG
|
F-F
|
ACGCGTGGAACGAGATCAAGATGCTC
|
Amplify a sense fragment for the RNAi vector
|
F-R
|
CCTAGGCGTGCACGGAGGATGTCTTGG
|
R-F
|
CCTAGGGGACCGCCGGGTCCTGCCAC
|
Amplify an antisense fragment for the RNAi vector
|
R-R
|
TTCGAAGGAACGAGATCAAGATGCTC
|
EH-F
|
GCAGAAGAACGGCATCAAGGTG
|
Detects the eGFP and hygromycin expression
|
EH-R
|
CAGGCTCTCGCTAAACTCCCC
|
qGpa1-F
|
CCGCCTTGGTCTTCCTCATT
|
TrGpa1 primers for qRT-PCR
|
qGpa1-R
|
TAGTTGCTCCCGCCCTTGTA
|
tubulin-F
|
GATGACCATTTCTTGCTTC
|
Tubulin primers for qRT-PCR
|
tubulin-R
|
GTTCTGACATTTGCTACCG
|
M13-F
|
CGCCAGGGTTTTCCCAGTCACGAC
|
Primers for sequencing
|
M13-R
|
AGCGGATAACAATTTCACACAGGA
|
Bioinformation analysis of TrGpa1 was performed by following steps. The amino acid sequence was deduced by Translate tool (http://web.expasy.org/translate/). The theoretical isoelectric point and molecular weight were predicted using Compute pI/Mw (http://expasy.org/tools/protparam.html). The conserved domains were identified from the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). Sequence similarity was analysed using Basic Local Alignment Search Tool (BLAST) at the NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Multi-sequence alignment was generated using ClustalW (http://www.clustal.org/). The phylogenetic tree was constructed using neighbor joining method implemented in Molecular Evolutionary Genetics Analysis (MEGA) version 6 program.
Vector Construction and Agrobacterium-mediated Transformation
The overexpression and knockdown vectors of TrGpa1 were constructed according to the vector pGEH-GH (Zhu et al. 2017) based on pCAMBIA 1302 backbone (Cambia, Brisbane, Australia). The TrGpa1 amplified using the primers with MluI and AsuII restriction sites were digested and introduced into pGEH-GH to generate the overexpression vector pTrGpa1-OE (Fig. 1a). The knockdown vector (pTrGpa1-OE) was generated by the ligation of a 439 bp fragment (flanking MluI and BlnI restriction sites) and a 325 bp (flanking BlnI and AsuII restriction sites) fragments. The plasmid was expected to encode a hairpin RNA included two 325 bp complementary regions separated by a 124 bp spacer fragment (Fig. 1b).
All vectors were transformed into the A. tumefaciens strain EHA105 component cells. Agrobacterium-mediated transformation of T. fuciformis Y32 cells were performed according to previous work (Zhu et al. 2017). The transformants were subcultured for five rounds on PDSA, then the total DNA were extracted. The existence of enhanced green fluorescent protein gene (egfp)-hygromycin B phosphotransferase gene (hph) fusion gene was assessed by PCR using primers EH-F and EH-R. The integration of genes in the genome was analysed by Southern blot with digoxigenin (Roche Diagnostics, Mannheim, Germany) labeled hph. DNA of Y32 was used as the negative control, and plasmid of pGEH-GH was applied as the positive control. Transformants were measured by using a fluorescence microscope (DM 6000 B, Leica Microsystems, Germany) to analyze the egfp expression. The images were captured under 40 × objective and samples were measured with a green fluorescence filter (546 nm).
Gene Expression Analysis
Total RNA was extracted and reverse transcribed (TransScript® first-strand cDNA synthesis supermix, Transgen, China) according to the manufacturer’s protocol. Quantitative real-time PCR (qRT-PCR) was performed on the ABI ViiA7 Real-Time PCR System (Applied Biosystems, USA) according to the manufacturer's protocol (Takara), using β-tubulin as the endogenous control. The primer sequences for the qRT-PCR of TrGpa1 and β-tubulin are listed on Table 1. The qRT-PCR conditions were 95°C for 10 min, followed by 30 cycles of 95°C for 30 s, and 60°C for 30 s. The expression ratios were calculated according to the 2-△△Ct method and each qRT-PCR reaction was carried out in triplicate independently. Data were analysed by one-way analysis of variance (ANOVA), followed by Ducan’s multiple range tests using SPSS 26.0 software.
Transformants selected based on the qRT-PCR assays and Y32 were performed with Western blots. Cells were lysed in buffer containing protease and phosphatase inhibitor cocktails (Sigma, St. Louis, MO, USA). Then total protein content was measured with BCA Protein Assay Kit according to the manufacturer’s protocol, and 40 μg of proteins were separated on 10% SDS polyacrylamide gels and transferred to PVDF membrane (Thermo Fisher Scientific, USA) using a Semi Dry Blotter (Thermo Fisher Scientific, USA) for 1 h at 20 volts. After blocking with TBST buffer (5% dry milk powder in tris-buffered saline and Tween 20) for 1 h, the membrane was incubated with the primary rabbit antibodies against TrGpa1 at 4°C overnight. After 5 washing steps with TBST buffer, blots were incubated with the secondary antibodies: anti-rabbit IgG in the dilution of 1:2000 in 5% milk/TBST at room temperature for 2 h. The membranes were performed using the SuperSignal ECL Solution for Western blot (Willget Biotech, Shanghai, China). Densitometric evaluation was performed with ImageJ software (National Institute of Health, New York, NY).
Phenotypic Analysis
The sub-cultured cells in LM medium were aseptically collected by centrifugation at 5000 × g for 5 min, washed three times and distributed in 50 mL of medium to obtain final concentration of 105 cells·mL−1. Except the given situations, the 50 mL of LM medium containing cells were incubated at 25°C on an orbital shaker at pH 7 for 3 to 5 d. The pH of the medium was adjusted by the addition of dibasic phosphate-citric acid buffer to the desired pH value.
The transformants and Y32 were cultured under different conditions to test the morphological changes in Y32 and transformants. 20°C, 25°C, 28°C, 30°C, 37°C were chosen as the temperature parameters and 3, 4, 5, 6, 7, 8 as the pH parameters. The cells were incubated for 2 to 9 d for the culture time parameters. Each LM medium containing different concentrations of cells (103, 104, 105, 106, and 107 cells·mL−1) was cultured respectively. Quorum sensing molecules (QSMs) including farnesol and tyrosol (Sigma, USA) in different concentrations (5, 25, 50, 100, 200 μmol·L−1) were also prepared to observe their effects on morphological changes. Strains supplemented with 1% methanol were the controls for each assay. All experiments were performed in triplicate of each treatment. Data were analysed by ANOVA, followed by Ducan’s multiple range tests.
Samples were observed at 20 × objective by an optical microscope (Leica, Germany). Three or more cells connected at the end of the long axes or in a definite direction or an elongated cell with a daughter cell and an ellipsoidal cell having two branched daughter cells were counted as a pseudohypha. Only differentiated cells were quantified and normalized to 100% (yeast/pseudohypha cells). For each repetition, at least 300 cells were counted under the microscopy.