2.1 Fabrication and characterization of the scaffolds
Pure mHAw, Mg-doped mHAw, Sr-doped mHAw and Mg-Sr codoped mHAw were successfully synthesized. Scanning electron microscopy (SEM) observations and analysis showed that the length of the prefabricated mHAws ranged from a few microns to tens of microns, while the diameter of the mHAws were several microns (Figure 1A). The SHA, SMHA, SSHA and SMSHA scaffolds were prepared according to the mentioned method, as shown in Figure 7. Briefly, through low-temperature sintering, the doped mHAws were extruded into porous ceramics, complexed with silica to enhance their mechanical strength, and cut to the required size.
2.2 Hydrophilicity properties
As shown in Figure 1B-F, the WCAs of the SHA, SMHA, SSHA and SMSHA scaffolds were 5°, 8°, 6° and 6° after measurement. The smaller the WCA, the better the hydrophilicity. The WCAs of the four scaffolds all reflect good hydrophilicity. SHA had the smallest WCA, SMHA had the largest WCA, and SSHA and SMSHA had the same WCA, indicating that the hydrophilicity of the scaffolds will be affected after doping with different ions. These biomaterials have good hydrophilicity, which is conducive to the attachment and growth of cells[33, 34]. As SMHA has the largest WCA, SHA has the smallest WCA, and SSHA and SMSHA (both doped with Sr) have smaller WCAs than SMHA, this result indicates that Sr is more hydrophilic than Mg.
2.3 Pore sizes of the scaffold
Since a significant feature of natural bone is its porous structure, the design of the porous structure in the ceramic bone scaffolds can provide favorable conditions for bone regeneration. The average pore sizes of SHA, SMHA, SSHA and SMSHA were 267.20 ± 10.66 μm, 247.40 ± 23.66 μm, 286.20 ± 19.04 μm and 269.40 ± 33.00 μm, respectively (Figure 1G). Thus, the pore sizes of the four scaffolds are similar.
2.4 Mechanical properties
Compared with natural bone, most of the scaffolds that are developed for bone regeneration have insufficient mechanical properties. Therefore, it is necessary to develop a preparation process to improve the mechanical properties of scaffolds, and material methods and structural improvements have been used to achieve this goal. To reduce the risks of the high brittleness and fragility associated with hydroxyapatite, the prepared pure mHA scaffold, Mg-doped mHAw scaffold, Sr-doped mHAw scaffold and Mg-Sr codoped mHAw scaffold were immersed in silica gel, and the mechanical properties of the scaffolds were found to be enhanced by SiO2 complexation. The Young’s moduli of SHA, SMHA, SSHA and SMSHA were 122.43 ± 28.79 MPa, 164.56 ± 32.99 MPa, 188.44 ± 47.89 MPa and 163.28 ± 50.55 MPa, respectively, as shown in Figure 1H.
When developing a new bone tissue engineering material, in addition to other performance requirements for specific applications, the goal should be to prepare strong and stiff materials. HA is a weak bioceramic, so it cannot be used alone as the main load-bearing bone substitute in the human body. A high compressive strength can effectively support the surrounding tissues to prevent collapse[35] and the appropriate compressive strength can be adapted to the strength of natural bone. The compressive strengths of SHA, SMHA, SSHA and SMSHA were 1.72 ± 0.29 MPa, 2.47 ± 0.25 MPa, 1.87 ± 0.52 MPa and 2.04 ± 0.35 MPa, respectively (Figure 1I), and both SMHA and SMSHA were in the range of cancellous[36].
2.5 SEM observations
Promising scaffolds should have a suitable microscopic morphology to allow sufficient cell contact for the stimulation of cell responses. SEM confirmed that the four scaffolds (SHA, SMHA, SSHA and SMSHA) have a rough surface morphology, which meets the microscopic morphology required for osteogenic differentiation and the growth of BMSCs. We defined the surface of the scaffold with macropores as the macroporous surface of the scaffold (Figure 2A1-A2, B1-B2, C1-C2, and D1-D2) and the surface without macropores as the microporous surface of the scaffold (Figure 2A3-A4, B3-B4, C3-C4, and D3-D4). The macroporous surface has lotus root-like
pores, which facilitates blood penetration, blood vessel formation and the other functions mentioned above. More importantly, it also provides a bionic microenvironment for the stimulation of BMSC bioactivity. Moreover, both the macroporous surface and the microporous surface are rough, which is conducive to the attachment of cells.
2.6 Element distribution and content of the scaffolds
Except for silicon and oxygen, the EDS element mapping showed that the
distribution density of each element on the macroporous surface and the microporous surface was similar for each scaffold. Analysis showed that the main elements of SHA (Ca, P, O, and Si) (Figure S1 in the Supporting Information), SMHA (Ca, P, O, Si, and Mg) (Figure S2), SSHA (Ca, P, O, Si, and Sr) (Figure S3), and SMSHA (Ca, P, O, Si, Mg and Sr) (macroporous surface shown in Figure 3B1-H1, microporous surface shown in Figure 3B2-H2) were uniformly distributed on the corresponding scaffold. It has therefore been indicated that this doping method is effective and feasible.
Elemental content analysis showed that four main peaks of Ca, P, O and Si can be detected for the four types of scaffolds, whether it is a macroporous surface (Figure 4A1-D1) or microporous surface (Figure 4A2-D2). Of the four scaffolds, Mg and Sr had different elements, SMHA had Mg peaks, SSHA had Sr peaks, and SMSHA had both Mg peaks and Sr peaks compared with SHA (Figure 4A1-A2). However, the elemental contents of the macroporous surfaces and the microporous surfaces were slightly different, and the SMHA scaffold doped with Mg showed a lower content of Mg than the Sr content of SSHA-doped Sr scaffold, which is related to the difficulty in replacing Ca2+ in mHAws with Mg2+ during the sintering process.
2.7 In vitro cell studies
2.7.1 Cell viability and proliferation
Cell live/dead staining confirmed that these scaffolds are beneficial to cell viability and growth. Living cells were stained green by calcein-AM, and dead cells were stained red by EthD-1, as observed by upright fluorescence microscopy. Most of the cells on the scaffolds were green living cells, and the red-stained dead cells were
almost invisible (Figure 5A-D). The CCK-8 assay is a typical way to test the proliferation of cells. CCK-8 solution reacts with dehydrogenase in the mitochondria of living cells to produce yellow formazan, and the amount of formazan produced is proportional to the number of living cells. A microplate reader was used to measure the optical density (OD) values to evaluate the number of living cells, which indirectly reflects the cytotoxicity of the scaffolds. The rBMSCs cultured on the four scaffolds had good viability, as shown in the experimental results in Figure 5E. The results of the live/dead staining and CCK-8 assays both confirmed that these four scaffolds have good biocompatibility and that their biosafety is favorable for the proliferation and spread of rBMSCs.
2.7.2 The surface area and morphological shape of the rBMSCs
After culturing for 3 and 7 days, observation of the morphological shape of the rBMSCs with an upright fluorescence microscope verified that the cells cocultured with the scaffolds may be a simple way to assess the area of cell spreading organization and cytoskeletal structure[37-39]. The shapes of the rBMSCs cocultured with the four types of scaffolds all showed different spreading organization areas (Figure 5F-J). The analysis showed that SMHA and SMSHA were more conducive to an increase in cell spreading organization, which may be related to doping with Mg.
Bone regeneration in the defect site requires the proliferation and differentiation of the surrounding BMSCs to spread and cross, and cell spreading is driven by filopodia, pseudopods and the cytoskeleton in a suitable physical and chemical environment. The morphological shape and filopodia and pseudopods were observed on rBMSCs cocultured with the four scaffolds and the rBMSCs cultivated with SMHA or SMSHA had a polygonal osteoblast-like shape and the largest number of filopodia and pseudopods (Figure 6A1-D2).
2.7.3 The scaffolds induce the expression of genes related to bone formation in rBMSCs
Next, the osteogenic abilities of these scaffolds was further verified. After 7 and 14 days of culture on the scaffolds, the expression levels of rBMSC bone-specific genes, including COL1 (main organic component of bone extracellular matrix), BMP2 (a factor that strongly promotes bone regeneration), Runx2 (osteoblastic transcript factor guide BMSCs to differentiate into osteoblasts) and ALP (biochemical marker of early osteogenesis) were determined along with the angiogenic gene VEGF
(growth factor to enhance vascularization for tissue repair) and housekeeping gene GAPDH (constantly expressed gene) were analyzed and evaluated by RT-qPCR (the primer sequences are shown in Table 1). Compared with the SHA scaffold, the rBMSCs cultured on the SMHA, SSHA and SMSHA scaffolds showed higher expression of COL1, BMP2, Runx2, ALP and VEGF on the 7th and 14th days, and the SMSHA scaffold displayed the highest expression (Figure 6E-J). The gene expression profiles of COL1, ALP, Runx2 and VEGF indicated good osteoblast proliferation and maturation.
Table 1. Sequences of the primers for RT-qPCR
Gene
|
Forward (5’-3’)
|
Reverse (3’-5’)
|
COL1
|
AAGAAGACATCCCTGAAG
|
AGATACAGATCAAGCATACA
|
BMP2
|
CATCACGAAGAAGCCATC
|
TCATCAGTAGGGACAGAAC
|
Runx2
|
AATGCCTCTGCTGTTATG
|
TTGTGAAGACCGTTATGG
|
ALP
|
TGATGCTCAGGACAGGAT
|
GGACCATAAGCGAGTTTCT
|
VEGF
|
CAGCATAGCAGATGTGAATG
|
TTCTCCGCTCTGAACAAG
|
GAPDH
|
CCTGCACCACCAACTGCTTA
|
GGCCATCCACAGTCTTCTGAG
|