Myocardial ischemia and reperfusion mice model
The animal experiment according to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1985). All experimental procedures involving animals were approved by the Ethics Committee of the Animal Care and the Ethics Committee of Sichuan University. For diabetic mice model, 8-10 weeks old male C57BL/6J mice were fed with high fat diet for 4 weeks and then given a single intraperitoneal injection of low-dose STZ (90 mg/kg, Sigma). One week after STZ injection, mice with 12-hours fasting blood glucose level ≥ 11.1 mmol/L were considered to have developed diabetes[16,17]. For myocardial ischemia reperfusion model, the left anterior descending (LAD) coronary artery was ligated with a 7–0 suture for 1 hour and then reperfusion for 24 hours. For the sham group, the similar surgical procedure was performed, while the LAD coronary artery was not ligated. RvD1 (Cayman Chemical) was administered to a dose of 50ug/Kg/day by intraperitoneal injection.
Echocardiography
Echocardiography analysis was performed 14 days after the IR surgery. Mice were anaesthetized with isoflurane, and cardiac function was assessed by an echocardiographic imaging system (GE Vivid 7 equipped with a 12-MHz imaging transducer). Measurements were performed at the midpapillary level from well-aligned M-mode images from the parasternal short axis view, left ventricular ejection fraction (EF%) and fractional shortening (FS%), interventricular septum (IVS), left ventricularend diastolic dimension (LVID: d), left ventricularend-systolic dimension, (LVID: s), left ventricular-posterior-wall (LVPW), end-diastolic volume (EDV), and end-systolic volume (ESV) were measured.
TTC staining and Evans blue staining
Following myocardial IR (1 hour/24 hours), 2,3,5-Triphenyltetrazolium chloride (TTC) (Sigma-Aldrich) and Evans blue (Sigma-Aldrich) dye were applied for the measurement of myocardial infract size. Briefly, at the end of reperfusion, 1 mL 1% Evans blue was injected through abdominal aorta after re-ligating the LAD. The heart was then extracted and sectioned once it hardened at −20 °C, then cut into slices (2–3 mm). The slices were incubated in the TTC staining solution for 15 minutes at 37°C. Subsequently, the slices were then fixed in 4% formaldehyde for 1 hour. Generally, the area stained with Evans blue represented the non-IR myocardium, whereas the unstained area was the I/R myocardium, the red area was at risk, and the white area was infarct size. Images were captured using a camera and the area of the infarcted myocardium in percentage of risk area was analyzed by ImageJ software.
Vascular permeability analysis
Vascular permeability was evaluated by Evans blue staining as reported[18-20]. In brief, following myocardial IR, at 3 hours before termination of the experiment, Evans blue dye (20 mg/kg) was injected intravenously, the mice were then euthanized and immediately subjected to aorta perfusion with phosphate buffer saline (PBS). The hearts were then excised, and Evans blue dye was eluted in formamide for 18 hours at 70°C. The absorbance of Evans blue dye at 620 nm was measured by Spectra Max 250 spectrophotometer (Molecular Devices, Sunnyvale, CA, USA)
Cell culture
Human cardiac microvascular endothelial cells (HCMECs) were purchased from Shanghai Huzhen Biotechnology. HCMECs were cultured in DMEM containing10% fetal bovine serum and 1% penicillin/streptomycin in an incubator with 5% CO2 at a temperature of 37°C. The cells were cultured with a final concentration of 30 mM glucose as a high glucose concentration, 5.5 mM glucose condition served as control. Permeability across endothelial cell monolayer was measured in transwell units (with polycarbonate filter, 0.4 µm pore; Corning Costar) under following conditions in the presence or absence of RvD1 (100 ng/ml), (1) Hypoxic conditions (5% CO2 and 94% N2, 1% O2,) used fresh DMEM with 1% FBS to mimic ischemic conditions for 12 hours, reoxygenation at the 5% CO2 incubator and with DMEM containing10% fetal bovine serum and 1% penicillin/streptomycin for another 12 hours. H2O2 (400 μM) for 12 hours, LPS (500 ng/ml) for 12 hours. FITC-dextran (0.5 mg/ml, average molecular mass 40,000; Sigma) as a fluorescent indicator was added into the upper-chamber for 2 hours before the end experiments. And 100 μl sample was taken from the lower-chamber and the fluorescence of FITC-dextran was measured (485/535 nm, absorption/emission wavelengths) by Spectra Max 250 spectrophotometer (Molecular Devices, Sunnyvale, CA, USA).
Immunofluorescence
At the final of the cellular experiments, remove the medium, and phosphate buffered saline (PBS) washed for 3 times, then fixed in 4% paraformaldehyde, permeabilized with 1% Triton X-100 in PBS, 5% bovine serum albumin in PBS was used to block cells for 15 min. A primary antibody against VE-cadherin for overnight and a secondary antibody were used for immunostaining 30 minutes, DAPI was used for staining the nucleus for 15 minutes, images were captured by a confocal microscope (N-STORM & A1, NiKON).
MitoSOX staining
HCMECs were cultured were seeded in 24-well plates with a density of 5 × 10 4 /ml. The cells were cultured with a final concentration of 30 mM glucose as a high glucose concentration, 5.5 mM glucose condition served as control. RvD1 (100 ng/ml) was pretreaed for 12 hours, followed by 400 μM H2O2 for 4 hours, then cells were washed three times with warm Hank's Balanced Salt Solution (HBSS). MitoSOX-Red (4 μM, ThermoFisher Scientific) dye was added to each well, incubated for 30 minutes in the dark at 37°C, then washed three times with warm HBSS. Finally, fluorescence intensity was determined by Celigo imaging cytometer, images were captured by a confocal microscope (N-STORM & A1, NiKON).
Mitochondrial transmembrane potential (MMP) assay
Mitochondrial membrane potential detection was used JC-1 (MedChemExpress Cat. No.: HY-K0601). According to the manufacturer’s instructions, JC-1 (2 μM) was added to per well, and incubated at 37°C for 20 minutes, followed by centrifuged for 3 minutes at 400g, washed cells twice with PBS, and finally added 500 μL PBS to suspend cells. JC-1 fluorescence was measured with a flow cytometer.
Western blotting
HCMECs or heart tissue were lysed using Lysis Buffer (Beyotime) with protease inhibitors (CST). Protein lysates were separated by SDS‐PAGE, then transferred to a PVDF membrane, and blotted with antibodies against the target proteins [VE‐cadherin (BIOSS), 1:1000 dilution; GAPDH (Affinity Biosciencesy), 1:1000 dilution], followed by a goat Horseradish Peroxidase (HRP)‐conjugated antibody (1:10,000 dilution), bands were detected by an ECL system.
Immunostaining analysis
Immunostaining for heart sections, hearts were excised from mice after euthanasia, fixed in 4% paraformaldehyde overnight, embedded in paraffin, and sectioned. The sections were then deparaffinized, rehydrated, retrieved for antigens, and subjected to immunohistochemical analysis using against CD45 (Abcam), CD68(Abcam), followed by staining with a secondary antibody (goat anti‐rabbit antibody). Images were captured by ZEISS IX83.For Masson staining, heart sections were deparaffinized, stained with Masson's composite staining solution and a bright‐green staining solution and dehydrated in absolute ethanol. Acetic acid was used for washing. Finally, the sections were subjected to transparency in xylene and then mounted with neutral gum for analysis.
Quantitative real-time reverse transcription-polymerase chain reaction(qRT-PCR)
The total RNA was extracted from tissues or cell lysates using Trizol (Invitrogen), after extracting using chloroform and precipitating with isopropanol, the RNA was washed twice using 75% ethanol, and the concentration of RNA was measurement after dissolved in RNase-free water. Subsequently the RNA was reversely transcribed by the PrimeScript RT Reagent Kit (Takara). qRT-PCR assay was performed on the CFX96TM Real-time PCR Detection System (BioRad) using EvaGreen Supermix Kit (Bio-Rad). Relative mRNA expression was normalized to GAPDH. The qPCR primer sequences were as following Table 1:
Table 1. Primers for quantitative real-time PCR.
Genes
|
Forward primer sequence (5’-3’)
|
Reverse primer sequence (5’-3’)
|
mGAPDH
|
ATGGTGAAGGTCGGTGTGAACG
|
GGTCTCGCTCCTGGAAGATGGT
|
m-IL-1β
|
CTTCAGGCAGGCAGTATC
|
CAGCAGGTTATCATCATCATC
|
m-MCP-1
|
CCACTCACCTGCTGCTACTCA
|
TGGTGATCCTCTTGTAGCTCTCC
|
m-IL-6
|
TGTGCAATGGCAATTCTGAT
|
GGTACTCCAGAAGACCAGAGGA
|
hGAPDH
|
TGACCACAGTCCATGCCATCAC
|
ACGCCTGCTTCACCACCTTCT
|
h-IL-1β
|
AAG CTG ATG GCC CTA AAC AG
|
AGG TGC ATC GTG CAC ATA AG
|
h-IL‐6
|
ATGAACTCCTTCTCCACAAGC
|
AAGAGCCCTCAGGCTGGACTG
|
h-MCP-1
|
CATAGCAGCCACCTTCATTC
|
TCTGCACTGAGATCTTCCTATTGG
|
Transmission electron microscope (TEM)
Heart tissues were harvested and quickly fixed in 2.5% glutaraldehyde for 1 hours, exposed to 1% osmium tetroxide, then sectioned to 60 nm and mounted on Cu-grids contrasted with uranyl acetate and lead citrate, and analyzed using a JEM-1400 electron microscope.
Statistical analysis
All experimental data were presented as means ± SD. The difference between 2 groups of variables was compared by the 2‐tailed, unpaired T-test. For data analysis of more than 2 groups, one-way ANOVA test was used. A value of P < 0.05 was considered to be statistically significant.