Tissue collection
The experimental animals in this study were raised under the same conditions. Three 20-, 75-, and 270-day-old clinically healthy Duroc and Chinese Meishan boars were selected from the Fine Farm of Hua Zhong Agricultural University. Boars were given general anesthesia (Zoletil 50, Virbac Co., France), a combination of tiletamine and zolazepam (5-9 mg/kg, i.m.) and xylazine hydrochloride (1.5–2 mg/kg, i.m.) before sampling. Testis samples were collected by castration and immediately snap-frozen in liquid nitrogen and stored at -80 °C until RNA extraction. Boars were then fed normally for meat industry.
Illumina small RNA sequencing analysis
Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. RNA quality and quantity were measured using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Then the equal amount of RNA from three individuals of the same age and breed were mixed to form 6 RNA pools, named D20, D75, D270, M20, M75, and M270. Sequencing libraries were generated using the TruSeq Small RNA Library Prep Kit (Illumina, San Diego, CA, USA), following the manufacturer’s recommendations. Briefly, the small RNA (sRNA) fragments (18-30 nt) were isolated from RNA pools by polyacrylamide gel electrophoresis (PAGE) and 3´ adaptor (TGGAATTCTCGGGTGCCAAGG) was first ligated to the RNA 3′ ends. Then the 5´end adaptor (GTTCAGAGTTCTACAGTCCGACGATC) was ligated to 5´end of the preparation. T4 RNA Ligase (Takara, Dalian, China) was used in the ligation reaction. The adaptor-ligated sRNA was then converted to cDNA using SuperScript II Reverse Transcriptase (Life Technologies, Carlsbad, CA, USA). The resulting cDNA was amplified on the PCR machine. The purified PCR products were recovered with QIAquick Gel Extraction Kit (Qiagen, Beijing, China) following the manufacturer’s instruction and assessed on an Agilent Technologies 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Each sRNA library was sequenced individually using Illumina HiSeqTM 2000 platform (BGI, Shenzhen, China) and 50 nt single-end reads were generated. To predict the genes targeted by miRNAs, two target prediction algorithms (Targetscan 5.0 and miRanda 3.3a) were used to identify miRNA binding sites. Finally, the data obtained were combined and the overlaps were calculated. Integrated analysis between mRNA and miRNA libraries was performed using miRTrail bioinformatics tool.
Quantitative real-time PCR (qRT-PCR) of miRNA and mRNA expression.
To validate the sequencing data, miRNAs and mRNAs were reversely transcribed using RevertAid First Strand cDNA Synthesis Kit (Thermo, Wuhan, k1622) in accordance with the manufacturer’s instructions. The qRT-PCR of the miRNAs and mRNAs was performed by using a standard UltraSYBR Mixture (CWBIO, Beijing, China) in the Roche LightCyler 480 system (Roche, Mannheinm, Germany) according to the manufacturer’s instructions. U6 and β-actin were used as endogenous control genes of miRNA and mRNA, respectively. The primer sequences used for the qRT-PCR were listed in Additional file 7: Table S4. At least three independent biological replicates were used for each of the miRNAs and mRNA. The qRT-PCR data were analyzed by using the 2-∆∆CT method, as previously described [42].
GO annotation and the KEGG pathway
To further investigate the biological processes and functions which DE miRNAs are involved in through the nine pairwise comparisons, we conducted GO and KEGG pathway analyses. GO enrichment analysis was performed with software Blast2GO, and genes were classified in terms of cellular component, molecular function and biological process using GO annotation. Pathway enrichment analysis was based on KEGG database (http://www.genome.jp/kegg/) and P value was used to determine the threshold of significance in multiple tests and analyses with P value <0.05 defined as significant enrichment.
Plasmid construction
The porcine PLCβ1 3´UTR was amplified with primers PLCβ1-3´UTR-F/PLCβ1-3´UTR-R in Additional file 8: Table S5, and their products were double-digested with Sac I (Takara, Dalian, China) and Xho I (Takara, Dalian, China), and then was cloned into the pmirGLO vector (Promega, Madison, WI, USA) as a wild-type plasmid. And the wild-type plasmid was used as template to construct mutated plasmid with primers PLCβ1-3´UTR-F/PLCβ1-3´UTR-MR in Additional file 8: Table S5, and the primer PLCβ1-3´UTR-R contained the binding site of ssc-mir-423-5p.
Cell culture, transfection and dual-luciferase reporter assays
Swine testis (ST) cells (ATCC CRL-1746, Shanghai, China) were cultured with Dulbecco’s modified Eagle medium (DMEM) (Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (CLARK, Worcester, MA, USA) at 37 °C in a humidified atmosphere with 5% CO2. The cells were plated into 24 wells. When these cells grew until they reached 70-80% confluent, it was time of transfection. miRNAs were co-transfected with plasmids into the cells using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). For luciferase assays, wild-type or mutated plasmids at 200 ng together with 3 µL/well of miRNA mimic, NC, miRNA inhibitor or inhibitor NC (Genepharma, Shanghai, China) were transfected into the cells. 24 h after transfection, the luciferase activities were measured with a PerkinElmer 2030 Multilabel Reader (PerkinElmer, Waltham, MA, USA).
Western blotting analysis
Cellular protein lysates were generated using RIPA Lysis Buffer (Beyotime, Jiangsu, China). Cellular proteins were extracted 72 h after transfection. Proteins were heated to 99 °C for 10 min in 5×SDS buffer, separated by SDS-PAGE, and a Mini Trans-Blot Cell (Bio-Rad, Hercules, CA, USA) was used to transfer protein onto polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA). Then the membranes were blocked with 5% non-fat dried milk and incubated overnight with primary antibodies specific for PLCβ1 (1:1000; ABclonal, USA, A1971). β-actin (1:1000; Wuhan, Hubei, China, GB13001-1) used as a loading control. An Image Quant LAS4000 mini (GE Healthcare Life Sciences, Piscataway, NJ, USA) was used to detect protein expression.
Graphics and heatmaps
A heatmap of miRNAs expression was generated using R heatmap package. All the histograms and graphs were generated with GraphPad Prism and Adobe Photoshop CS5 software, respectively. Molecular interaction network was analyzed by Cytoscape_3.3.0 [43].
Statistical analysis
All experiments are performed at least in triplicate and the corresponding results are presented in terms of the mean ± SD. Two-tailed t-test was used to reveal the differences between two groups. Significant differences were evaluated through an independent-sample t-test. P-value < 0.05 (*P < 0.05; **P < 0.01; ***P < 0.001) was considered to be significant.