Downregulation of Chemokine CCL20&nbsp;Involved in Myeloma Cells Resistant to Elotuzumab and Lenalidomide

doi:10.21203/rs.3.rs-61639/v1

Download PDF

Research article

Downregulation of Chemokine CCL20 Involved in Myeloma Cells Resistant to Elotuzumab and Lenalidomide

https://doi.org/10.21203/rs.3.rs-61639/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 01 Apr, 2021

Read the published version in OncoTargets and Therapy →

Version 1

posted

You are reading this latest preprint version

Background: Immunotherapy has received an increasing amount of attention in the field of multiple myeloma treatment because it has low-level toxicity however, there are very few studies on immunotherapy drug resistance. This study aimed to initially explore the relevant factors and possible mechanisms of immunotherapy drugs Elotuzumab (Elo) and Lenalidomides’ resistance both in vivo and in vitro.

Methods: Cell models which are resistant to Elotuzumab and Lenalidomide were constructed; Different expression genes in UW, UR, UE, and URE cell lines were detected by using gene expression microarray; RT-qPCR validated CCL20 mRNA expression of four cell lines and patient samples; Bioinformatics Analysis of CCL20 expressions in NDMM and RRMM; ELISA detected the presence of CCL20 in the plasma of MM patients; Recovered CCL20 levels could increase the sensitivity of drug-resistant cell lines to immunomodulatory drugs; Constructed lenalidomide-resistant (UR) mouse subcutaneous xenograft model to explore whether or not CCL20 and lenalidomide treatment influenced the tumor volume’s growth.

Results: Cell models of drug resistance were successfully constructed and we found that the mRNA expression of CCL20 was down-regulated in resistant UR, UE, and URE cell lines; RT-qPCR confirmed these, and also identified the downregulation of CCL20 in RRMM patients compared with NDMM; bioinformatics analysis found that the mRNA expression of CCL20 was also down-regulated in RRMM patients; Furthermore, RRMM patients were found to have lower levels of CCL20 protein in their plasma when compared to NDMM. CCL20 could increase the sensitivity of UR,UE, and URE cell lines to immunomodulatory drugs in vitro and in vivo.

Conclusions: The expression of CCL20 was decreased in lenalidomide and elotuzumab resistant U266 cells and RRMM patients.CCL20 could possibly increase the sensitivity of lenalidomide in vitro and in vivo.

Cancer Biology

CCL20

Elotuzumab

Lenalidomide

Drug resistance

Multiple myeloma

Multiple myeloma (MM) is the second common hematologic malignancy and is commonly seen in the elderly. In recent years, new drugs have greatly improved the response rates and overall survival rate of MM patients, however, the disease is still incurable [1]. Many patients eventually progress to relapse/ refractory MM (RRMM). Immunotherapy has attracted increasing attention in the treatment of multiple myeloma due to its advantages of targeting and low toxicity [2]. While there are few studies on the mechanism of immunotherapy resistance. Because of the ability to regulate the immune function, lenalidomide, as the second generation of immunomodulators, has been widely used in the treatment of multiple myeloma. Elotuzumab (ELO) is the second monoclonal antibody drug approved for the treatment of RRMM. In 2015, the FDA approved ELO for use in combination with lenalidomide and dexamethasone (E-RD regimen) in the treatment of relapsed/refractory multiple myeloma patients [3, 4]. The therapeutic target of Elotuzumab is a member of the signal lymphocyte activating molecule family 7 (slamf7, also known as cd319, CS1, etc.). CS1 is a cell surface glycoprotein molecule, which has shown to be highly expressed on the surface of myeloma cells and NK cells, but not on the surface of normal tissues and hematopoietic stem cells, and is involved in the regulation of bone marrow microenvironment [5]. Elotozumab can directly activate NK cells and induce CD16 mediated cytotoxicity to kill myeloma cells with high expressions of CS1, but has little effect on normal tissues. Although the E-RD regimen achieved satisfactory results, some patients still developed drug resistance. In this present study, myeloma cell lines resistant to erlotozumab, and lenalidomide were constructed in order to explore the mechanism of monoclonal antibody and immunotherapy resistance. We aim to provid new targets for immunotherapy and providi new ideas for reversing drug resistance.

Myeloma cells culture

Bone marrow samples of MM patients were sorted by CD138 and magnetic beads were collected from Shengjing Hospital of China Medical University and approved by the ethics committee of Shengjing Hospital (approval No.: ps270k).

Myeloma U266 cell line and Lenalidomide resistant cell line (U266 / R10R, UR) were presented by Professor Orlowski Robert in the MD Anderson Cancer Center. Lenalidomide sensitivity (U266 / WT, UW) and single resistance UR were co-cultured with human peripheral blood mononuclear cells (PBMC) respectively. They were then added with a great amount of concentration of elotuzumab and cultured for 48 hours. Then, the surviving cells were collected and sorted with CD138 antibody while the myeloma cells were collected by flow cytometry. The drug stimulation was continued and the above process was repeated until the cell lines were stable with Elo single resistance (U266 / elor, UE) and double resistance (U266 / r10r / elor, URE).

Cell viability assay

Four kinds of cells (UW, UR, UE, URE) were detected. Different concentrations of erlotozumab (0,1,10,50,100,500,1000ug / ml) with PBMC were treated. According to the manufacturer’s instruction, cells were processed with CCK-8 kits to detect cell proliferation.

Gene expression profiling

IlIumina gene expression microarray data were obtained as described previously.

Real-time RT-PCR to detect the CCL20 gene expression

To detect CCL20 mRNA expressions in cell lines and MM patient samples, qPCR was performed on an Appplied Biosystems Step One Plus Real Time PCR system. CCL20 Forward:ATGTGCTGTACCAAGAGTTTGC;

CCL20 Reverse:CCAATTCCATTCCAGAAAAGCC.

Enzyme-linked immunosorbent assay to detect CCL20 protein expression

To detect CCL20 protein expression in the plasma of MM patients, we used CCL20 (MIP 3alpha) (peprotech, USA) KIT following the instruction.

Bioinformatics analysis

R language was used to download the chip expression spectrum data of GSE16791, GSE31504, and GSE51317 for probe conversion, data standardization, and batch correction. To analyze the expression of CCL20, the Ggpurb package was used.

Xenograft model

Female NOD-SCID mice aged 4–5 weeks were purchased from Beijing Hua Fukang Bioscience Company (Beijing, China) and were housed and monitored in a pathogen-free environment. All animal studies were approved by the Research Ethics Committee of China Medial University. 1×10⁷U266/R10R cells were injected subcutaneously into NOD-SCID mice. The animal treatment was initiated after the detection of palpable tumors, approximately 12 days following injection. Mice were randomized in two groups using a computer based random order generator, three mice per group, control group (lenalidomide + NS) and experimental group (lenalidomide + CCL20) to observe the effect of CCL-20 reverse the lenalidomide resistance. Investigators could not be blinded to the mouse.Tumor growth was monitored every 3 days for about 3 weeks. Serial measurements of xenograft growth were performed, and tumor volume (V) was calculated using the formula: V=0.5×a×b2, where a and b represent the longest and shortest tumor diameters, respectively. At the end of study, animals were killed and tumors were collected.

Statistical analysis

To analyse the data, the Spss23.0 software was used to analyse the difference between the two samples, and an independent sample t-test was used. To analyze the difference between multiple groups, the one way ANOVA was used P < 0.05 was regarded as statistically significant.

Generation of Elotuzumab and lenalidomide resistant myeloma cells

The single drug resistance (U266 / elor, UE), and dual drug resistance (U266/ r101r/ elor, URE) were constructed by using the continuous stimulation culture of elotuzumab. With the increasing concentration of elotuzumab, the cell viability of sensitive cell lines (UW) decreased gradually, while the cell viability of erlotozumab resistant cell line (UE) did not change significantly (Figure 1A); The cell viability of the dual drug-resistant cell line (URE) has lower cell viability compared with lenalidomide resistant but ELO sensitive cell line (UR) treated with different concentration of elotuzumab by adding PBMC (Figure 1B). The results showed that the single ELO resistant cell line UE and the dual drug-resistant cell line URE had stable resistance to Erlotozumab.

CCL20 expression decreased in resistant myeloma cell

We used the gene expression microarray to detect the gene expression differences of four myeloma cells: UW, UR, UE, URE in order to further explore the possible mechanism of resistance. The results showed that the expression of CCL20 was significantly down-regulated in drug-resistant cell lines (Figure 2A). RT-qPCR data further confirmed this result (Figure 2B). We then detected CCL20 expressions in MM patients. We collected 27 samples of bone marrow fluid from patients with newly diagnosed mm (NDMM), and 5 samples of bone marrow fluid from patients with relapsed refractory MM (RRMM) exposed to lenalidomide. The results showed that compared with NDMM, the expression level of CCL20 mRNA in RRMM was lower (p < 0.01) (Figure 2C). Furthermore, the data from the GEO database showed that the expression of CCL20 in bone marrow plasma cells of RRMM patients was lower than that of NDMM patients, especially the MM exposed to lenalidomide, which was consistent with PCR results (Figure 2D). Finally, fresh plasma was collected from 5 NDMM patients and 5 RRMM exposed to lenalidomide. The average content of CCL20 was 24.44 ±0.88pg/ml in the plasma of patients with NDMM and 8.97±1.88pg/ml in RRMM(p < 0.01) (Figure 2E).These data supported the CCL20 expression decreased in resistant myeloma cells

CCL20 increased the sensitivity of drug-resistant myeloma cells to immunomodulatory drugs

The experimental units were divided into three groups, namely, lenalidomide, elotozumab, and lenalidomide + erlotozumab. The results showed that in each group, the cell viability with CCL20 adding were significantly lower than that without CCL20 (Figure 3A), which indicated that CCL20 could partially restore the drug sensitivity of drug-resistant myeloma cells. All the group are added PBMC.

CCL20 increases the sensitivity of resistant myeloma mice to lenalidomide in vivo.

We constructed UR resistant NOD-SCID mice in order to verify the effect of CCL20 on the myeloma resistance in vivo. With the prolongation of the lenalidomide treatment, the tumor volume growth rate of mice in the experimental group (lenalidomide + CCL20) was significantly slower than that in the control group (lenalidomide + NS) (Figure 3B). The tumor volume of mice in the experimental group was significantly smaller than that in the control group (Figure 3C).

In recent years, the emergence of new drugs and new therapies have brought hope for myeloma patients. However, most patients eventually progress to relapse and refactory states due to the occurrence of drug resistance. Compared to traditional chemotherapy, the effect of immunotherapy is improved while the side effects are decreased. However, there are still patients who are resistant to immunotherapy. It is therefore paramount to explore the mechanism of immunotherapy resistance in order to improve the response to immunotherapy. Two vital immunotherapeutic drugs are immunomodulators and monoclonal antibodies. Lenalidomide is a widely used immunomodulator, which can inhibit the secretion of inflammatory factors, directly inducing the phosphorylation of CD28 on T cells, leading to the activation of downstream target factors, and then activating T cells and enhancing various mechanisms mediated by NK cells to achieve the anti-tumor effect. Elotuzumab can target and label CS1 protein on the surface of multiple myeloma cells, inhibit the adhesion between myeloma cells and bone marrow stromal cells, regulate the MM bone marrow microenvironment and reduce the growth-stimulating factors on myeloma cells[6-9]. A phase III clinical trial included 646 patients with multiple myeloma (RRMM) [10], the E-Rd (Elotuzumab, lenalidomide plus low-dose dexamethasone) has obvious advantages compared with Rd: the median progression-free survival (PFS) is 14.9 (Rd) months vs.19.4 months (E-Rd) (p < 0.001). However, the E-Rd regimen is still not sensitive to some patients. The mechanism of resistance to Elotuzumab and lenalidomide is not clear yet.

To further improve the efficacy of immunotherapy and in order to clarify the mechanism of immunotherapy resistance, the myeloma cell model of resistance to Elotuzumab, and dural resistance to both Elotuzumab and lenalidomide were firstly constructed. We then found that the CCL20 decreased expression in drug-resistant cells. We also verified CCL20 down-regulation involved in the development of drug resistance in immunotherapy of myeloma cells both in vivo and in vitro. CCL20 (chemokine (C-C motif) ligand 20; macrophage infectious protein-3 α, mip-3 α) is one of the important members of chemokine family. The gene is located on chromosome 2. CCL20 mRNA encodes and synthesizes 96 amino acid precursor proteins, which are finally cut into 70 amino acid mature proteins [11]. CCL20 is mainly expressed in immune cells, activated T cells, dendritic cells and monocytes. Additionally, it can also be expressed in endothelial cells. Its receptor is CCR6, which can be expressed in lymphoid tissue, liver, and lung [12]. The expression of CCL20 is regulated by a variety of cytokines. Research shows that TNF-α, IL-17, and IFN-γ can induce the expression of CCL20, causing the chemotaxis of inflammatory cells, and affecting the proliferation and metastasis of tumor cells [13, 14]. An increasing number of studies have shown that CCL20 has abnormal expression in a variety of cancers such as; esophageal cancer, lung cancer, colorectal cancer, etc. Studies have also shown that CCL20 has increased expression in paclitaxel chemotherapy in triple-negative breast cancer, thus activating NF-κB, promoting the self-renewal of breast cancer stem cells/stem like cells, and participating in the occurrence of drug resistance [15-17]. Recently, it has been shown that CCL20 is related to the regulation of bone marrow microenvironment of myeloma cells and participates in the occurrence of myeloma osteopathy [18, 19]. Besides, it has been discovered that the increase of CCL20 can promote T-cell-mediated antitumor immunity through CCL20-CCR6-dependent dendritic cell regulation, thus providing a new target for immunotherapy [20]. We discovered that increasing CCL-20 can enhance the anti-myeloma effect of lenalidomide. We speculated that the mechanism may be through increasing lymphocyte chemotaxis to tumor area and assisting in cell-mediated immunity. In RRMM, the down-regulation of CCL20 results in the decrease of the immunotherapeutic effect.

Progressive attention has been paid to the role of CCL20-CCR6 axis in immune regulation and mechanism in autoimmune diseases. Our study preliminarily found the role of CCL20-CCR6 axis in the resistance of immunotherapy of myeloma. In order to provide a new target for immunotherapy, reverse the resistance of myeloma cells to immunotherapy, and improve the efficacy and safety of RRMM treatments, further studies on its downstream effector cells and mechanism will be expected.

We found that the expression of CCL20 was decreased in lenalidomide and elotuzumab resistant U266 cells and RRMM patients.CCL20 could possibly increase the sensitivity of lenalidomide in vitro and in vivo. Our study preliminarily found the role of CCL20-CCR6 axis in the resistance of immunotherapy of myeloma and may provide a new target for immunotherapy, reverse the resistance of myeloma cells .

Multiple myeloma (MM)

relapse/ refractory MM (RRMM)

newly diagnosed mm (NDMM)

Elotuzumab (ELO)

peripheral blood mononuclear cells (PBMC)

Ethics approval and consent to participate

The studies involving client-owned animals were approved by The Ethic Committee of Shengjing Hospital of China Medical University (approval No.: ps270k). The client or owner provided their written informed consent to participate in this study.

Consent for publication

Not applicable.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

This study was supported by the Natural Science Foundation of Liaoning Province (201800875, 20180551257). The funder Aijun Liao design the study and the funder Huihan Wang perform the experiment and write the manuscript.

Authors' contributions

Study conception and design: HW and AL. Quality control: AL. Statistical analysis: HS and XH. Manuscript preparation: WY and HW. Manuscript review: WY, AL, and HW. All authors contributed to the article and approved the submitted version.

Acknowledgements

Not applicable.

[1] Rajkumar SV. Treatment of multiple myeloma. Nat Rev Clin Oncol. 2011; 8: 479-91.

[2] Al-Hujaily EM, Oldham RA, Hari P, Medin JA. Development of Novel Immunotherapies for Multiple Myeloma. Int J Mol Sci. 2016;17: 1506.

[3] Einsele H, Schreder M. Treatment of multiple myeloma with the immunostimulatory SLAMF7 antibody elotuzumab. Ther Adv Hematol. 2016;7: 288-301.

[4] Lonial S, Kaufman J, Reece D, Mateos MV, Laubach J, Richardson P. Update on elotuzumab, a novel anti-SLAMF7 monoclonal antibody for the treatment of multiple myeloma. Expert Opin Biol Ther. 2016;16: 1291-301.

[5] Magen H, Muchtar E. Elotuzumab: the first approved monoclonal antibody for multiple myeloma treatment. Ther Adv Hematol. 2016;7: 187-95.

[6] Grosicki S, Barchnicka A. Elotuzumab: a novel immune-stimulating therapy to treat multiple myeloma. Expert Rev Hematol. 2016;9: 621-8.

[7] Balasa B, Yun R, Belmar NA, Fox M, Chao DT, Robbins MD, et al. Elotuzumab enhances natural killer cell activation and myeloma cell killing through interleukin-2 and TNF-alpha pathways. Cancer Immunol Immunother. 2015;64: 61-73.

[8] Collins SM, Bakan CE, Swartzel GD, Hofmeister CC, Efebera YA, Kwon H, et al. Elotuzumab directly enhances NK cell cytotoxicity against myeloma via CS1 ligation: evidence for augmented NK cell function complementing ADCC. Cancer Immunol Immunother. 2013,;62: 1841-9.

[9] Veillette A, Guo H. CS1, a SLAM family receptor involved in immune regulation, is a therapeutic target in multiple myeloma. Crit Rev Oncol Hematol. 2013;88: 168-77.

[10] Lonial S, Dimopoulos M, Palumbo A, White D, Grosicki S, Spicka I, et al. Elotuzumab Therapy for Relapsed or Refractory Multiple Myeloma. N Engl J Med. 2015;373: 621-31.

[11] Comerford I, Bunting M, Fenix K, Haylock-Jacobs S, Litchfield W, Harata-Lee Y, et al. An immune paradox: how can the same chemokine axis regulate both immune tolerance and activation?: CCR6/CCL20: a chemokine axis balancing immunological tolerance and inflammation in autoimmune disease. Bioessays. 2010;32: 1067-76.

[12] Lee AY, Phan TK, Hulett MD, Körner H. The relationship between CCR6 and its binding partners: does the CCR6-CCL20 axis have to be extended?. Cytokine. 2015;72: 97-101.

[13] Frick VO, Rubie C, Keilholz U, Ghadjar P. Chemokine/chemokine receptor pair CCL20/CCR6 in human colorectal malignancy: An overview. World J Gastroenterol. 2016;22: 833-41.

[14] Lee AY, Korner H. CCR6 and CCL20: emerging players in the pathogenesis of rheumatoid arthritis. Immunol Cell Biol. 2014;92: 354-8.

[15] Chen W, Qin Y, Wang D, Zhou L, Liu Y, Chen S, et al. CCL20 triggered by chemotherapy hinders the therapeutic efficacy of breast cancer. PLoS Biol. 2018;16: e2005869.

[16] Wei W, Zhao X, Zhu J, Zhang L, Chen Y, Zhang B, et al. lncRNAu50535 promotes the progression of lung cancer by activating CCL20/ERK signaling. Oncol Rep. 2019;42: 1946-56.

[17] Wang D, Yuan W, Wang Y, Wu Q, Yang L, Li F, et al. Serum CCL20 combined with IL-17A as early diagnostic and prognostic biomarkers for human colorectal cancer. J Transl Med. 2019;17: 253.

[18] Palma BD, Guasco D, Pedrazzoni M, Bolzoni M, Accardi F, Costa F, et al. Osteolytic lesions, cytogenetic features and bone marrow levels of cytokines and chemokines in multiple myeloma patients: Role of chemokine (C-C motif) ligand 20. Leukemia. 2016;30: 409-16.

[19] Giuliani N, Lisignoli G, Colla S, Lazzaaretti M, Storti P, Mancini C, et al. CC-chemokine ligand 20/macrophage inflammatory protein-3alpha and CC-chemokine receptor 6 are overexpressed in myeloma microenvironment related to osteolytic bone lesions. Cancer Res. 2008;68: 6840-50.

[20] Lu Y, Yi Q. Utilizing TH9 cells as a novel therapeutic strategy for malignancies. Oncoimmunology. 2013;2: e23084.

Download PDF

Journal Publication

published 01 Apr, 2021

Read the published version in OncoTargets and Therapy →

Version 1

posted

You are reading this latest preprint version

Downregulation of Chemokine CCL20 Involved in Myeloma Cells Resistant to Elotuzumab and Lenalidomide

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Journal Publication

Version 1