Differential Effects of WRAP53 Transcript Variants on the Biological Behaviours of Human Non-Small Cell Lung Cancer Cells

doi:10.21203/rs.3.rs-618474/v1

Download PDF

Research article

Differential Effects of WRAP53 Transcript Variants on the Biological Behaviours of Human Non-Small Cell Lung Cancer Cells

https://doi.org/10.21203/rs.3.rs-618474/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: The WD40-encoding RNA antisense to p53 (WRAP53) gene, an antisense gene of TP53, has 3 different transcriptional start sites that yield 3 transcript variants. One of these variants WRAP53-1β encodes a WD repeat-containing protein WRAP53β, whereas WRAP53-1α is a noncoding RNA that regulates p53 mRNA levels. These variants are involved in the progression of non-small cell lung cancer (NSCLC). However, how the different transcript variants regulate NSCLC cell behaviours is to be elucidated.

Methods: Wild-type p53 NSCLC A549 cells and p53-mutated H1975 cells were transfected with WRAP53-1α and WRAP53-1β siRNAs, and their behaviours were examined colony formation, cell viability, apoptosis, cell cycle, wound healing, and cell invasion assays.

Results: WRAP53-1α knockdown increased the mRNA and protein levels of p53, whereas depletion of WRAP53-1β had no effect on p53 expression. WRAP53-1α knockdown suppressed colony formation and proliferation of A549 cells, but had the opposite effects on H1975 cells. However, WRAP53-1β knockdown promoted A549 cell growth. Depletion of WRAP53-1α and WRAP53-1β promoted apoptosis in A549 but not H1975 cells. WRAP53-1α knockdown increased the proportion of A549 but not H1975 cells at the G0/G1 phase. However, WRAP53-1β knockdown decreased the proportion of cells at the G0/G1 phase in A549 cells. Depletion of WRAP53-1α suppressed A549 cell migration and invasion, and promoted H1975 cell migration and invasion. However, depletion of WRAP53-1β had the opposite effects.

Conclusions: The 2 WRAP53 transcript variants exerted opposite functions in NSCLC cells and regulated NSCLC cell behaviours in a p53-dependent manner.

Cancer Biology

Non-small cell lung cancer

p53

Wrap53 transcript variant

Alternative splicing is a crucial process in gene regulation, enabling a single gene to encode different protein products. It occurs in approximately 95% of multi-exon genes in eukaryotes, and is involved in various disorders including cancers [1, 2]. The different transcript variants of a single gene usually have different and even opposite biological functions in physiological and pathological processes.

Mutations in the tumour suppressor p53 cause loss of its tumour suppressor function, promoting malignant transformation. TP53 mutations are found in over 50% of human cancers[3], and TP53 is the most commonly mutated gene in non-small cell lung cancer (NSCLC)[4]. Previous studies reported that mutant p53 plays important roles in the occurrence and progression of NSCLC[5]. Furthermore, recent studies suggested that TP53 mutation was a negatively prognostic factor in advanced NSCLC, and that different mutations had different prognostic values[6]. High expression levels of mutated p53 were correlated with poor survival, regardless of epidermal growth factor receptor mutations[7].

The TP53 5'-untranslated region flanking gene, WD40-encoding RNA antisense to p53 (WRAP53), has 3 different transcriptional start sites that yield 3 different variants: 1α, 1β, and 1γ. The start site for the 1α variant corresponds to the first exon of p53 in a cis-antisense manner. WRAP53-1α is an antisense transcript that stabilizes TP53 [8]. The WRAP53-1β transcript is not complementary to TP53, but encodes the WD repeat-containing protein WRAP53β, also known as WD repeat domain 79 and telomerase Cajal body protein 1, which is involved in multiple cellular processes. WRAP53β was reported to regulate the maintenance of the nuclear organelles known as Cajal bodies via recruiting motor neuron proteins, small Cajal body-specific RNAs, and telomerases[9-11]. WRAP53β also targeted telomerase to telomeres, promoting their elongation[9]. In addition, WRAP53β was reported to facilitate DNA damage repair via recruiting the ubiquitin ligase ring finger protein 8 to DNA breaks during both homologous recombination and non-homologous end joining. The effects of WRAP53β on DNA damage repair were p53-independent, as it also functioned in p53-deficient cells[12, 13].

The effects of WRAP53 on cancer progression are controversial. WRAP53 is believed to be associated with cancer pathogenesis, because WRAP53-1α regulates the expression of TP53. Loss of WRAP53β impairs telomere maintenance and DNA repair, increasing genomic instability and the probability of carcinogenesis. It is conceivable that WRAP53-1α and WRAP53-1β play different roles in NSCLC cells. In order to test this hypothesis, we examined the distinct biological functions of these 2 WRAP53 transcript variants in cell function assays in vitro.

Cell culture

NSCLC cell lines, A549 and H1975, were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Both cell lines were cultured in RPMI-1640 medium (Hyclone, USA) supplemented with 10% foetal bovine serum (Hyclone), 100 U/mL penicillin, and 100 mg/mL streptomycin (Sangon, China). All cells were maintained in a humidified incubator (Sanyo, Japan) at 37 °C and 5% CO₂.

RNA extraction and quantitative real-time polymerase chain reaction

Total RNA was isolated using TRIzol (Vazyme, China). The RNA concentrations and the A260/A280 ratios were assessed with a Nanodrop spectrophotometer (Thermo, USA). Total RNA (500 ng) was reverse-transcribed using the HiScript® Q RT SuperMix for qPCR kit (Vazyme) according to the manufacturer’s instructions. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using the ChamQ TM SYBR ® qPCR Master Mix (Vazyme) on the CFX Connect^TM RealTime PCR Detection System (Bio-Rad, USA). Glyceraldehyde-3-phosphate dehydrogenase was used as the reference for normalization. The relative fold change of mRNAs was calculated using the 2^−ΔΔCtmethod. The primers used for qRT-PCR are presented in Table 1.

RNA interference

Small interfering RNAs (siRNAs) targeting WRAP53-1α and WRAP53-1β [8] and negative control (NC) siRNAs were purchased from Genepharm Technologies (GenePharma, China). Transient transfection was performed using jetPRIME transfection reagent (Polyplus-transfection® SA, France) following the manufacturer’s recommendations. The cells were transfected with NC or target siRNAs at 30-50% confluence.

Immunoblotting

Cells were lysed in RIPA cell lysis buffer (Beyotime, China) supplemented with phosphatase inhibitors and protease inhibitors (Sigma, USA). The lysates were then centrifuged (13300 rpm) at 4 °C for 15 min. The supernatants were collected, and protein concentration was measured using a bicinchoninic acid kit (Beyotime). Equal amount of proteins were applied to 10-12% sodium dodecyl sulphate-polyacrylamide separating gels and transferred to polyvinylidene fluoride membranes. After blocking with 5% non-fat milk, the membranes were incubated with primary antibodies at 4 °C overnight. After washing, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies at room temperature for 1 h. An enhanced chemiluminescence kit (Bio-Rad) was used to detect the proteins under a gel imaging analyser (Bio-Rad). Antibodies used for immunoblotting are listed in Table 2.

Colony formation assay

Tumour cells were plated in 6-well plates (500 cells/well) and cultured for 2 weeks. Cell colonies were fixed with 4% paraformaldehyde (Sangon) for 20 min and stained with 0.5% crystal violet (Beyotime) at room temperature for 30 min. After washing with water, the numbers of colonies in each well were counted under a microscope. This assay was repeated 3 times and performed in triplicates.

Cell viability assay

Cells were seeded into 96-well plates (3000 cells/well in 100 µL medium). After culturing for 24, 48, 72, and 96 h, the supernatant was replaced with 100 µL serum-free medium with 10 µL CCK-8 (Dojindo, Japan) and incubated at 37 °C in the dark for 1 h. The absorbance was measured at 450 nm by a microplate reader (Rayto, China). Each group had 5 wells, and the experiment was conducted 3 times.

Apoptosis assay

Cells were harvested 48 h after transfection, washed twice with cold phosphate-buffered saline (PBS), and stained with fluorescein isothiocyanate-conjugated annexin V (BioLegend, China) for 20 min and propidium iodide (BD, USA) in the dark for 5 min. The stained cells were assessed by flow cytometry and analysed by CytExpert 2.3 software (Beckman, China). Each experiment was conducted at least 3 times.

Cell cycle analysis

After washing with cold PBS, cells were treated with a cell cycle staining kit (MultiSciences, China). Flow cytometry was used to detect the percentage of cells at different cell cycle phases. This assay was repeated at least 3 times.

Wound healing assay

Cells were seeded in 6-well plates and transfected with NC or WRAP53 siRNAs. When the cells were confluent, they were scratched with a 10-μL pipette tip and washed with PBS gently to remove cell debris. After that, 2 mL serum-free medium was added into each well, and pictures were taken using a phase contrast microscope (Nikon, Japan) at 0, 24, and 48 h. The migration rate was calculated as:

Wound closure (%) = (distance of initial scratch - distance of closed scratch) / distance of initial scratch.

Cell invasion assays

Cells (1 × 10⁵ cells/well) transfected with NC or WRAP53 siRNAs were seeded in the upper chambers of transwell units pre-coated with 100 μL Matrigel (Becton-Dickinson, USA, dilution 1:40). After incubation for 24 h, the filters were fixed with 4% paraformaldehyde for 20 min and stained with 0.5% crystal violet for 20 min. The cells on the upper surface of the filter were completely removed using a cotton swab. The cells that invaded through the Matrigel and reached the lower surface of the filter were counted. Experiments were independently repeated 3 times.

Statistical analysis

All statistical analyses were performed with GraphPad software. All data are presented as the mean ± standard deviation. Unpaired 2-tailed student's t-test was used to compare 2 groups. P < 0.05 was considered statistically significant.

Knockdown of WRAP53-1α, but not WRAP53-1β, induced p53 expression

Transcript-specific siRNAs were designed to specifically target WRAP53-1α and WRAP53-1β. There was no marked difference in WRAP53-1α mRNA levels between cells transfected with si-Control and si-WRAP531β, whereas there was significantly less WRAP53-1α mRNA in A549 and H1975 cells transfected with si-WRAP531α (P < 0.05; Figure 1A). Similarly, si-WRAP53-1β reduced WRAP53-1β RNA levels in A549 and H1975 cells (P < 0.01 and P < 0.05, respectively; Figure 1A). Knockdown of WRAP53-1α significantly increased TP53 mRNA levels in both A549 and H1975 cells, whereas knockdown of WRAP53-1β had no effect on TP53 levels (Figure 1B). Immunoblotting showed that there was no difference in WRAP53β protein levels between cells transfected with si-Control and si-WRAP531α, whereas the protein levels of WRAP53β were decreased in cells transfected with si-WRAP531β. Moreover, knockdown of WRAP53-1α increased p53 protein levels in both A549 and H1975 cells, whereas knockdown of WRAP53-1β had no effect (Figure 1C).

WRAP53-1α and WRAP53-1β had opposite effects on NSCLC cell growth and proliferation

To investigate the functions of WRAP53-1α and WRAP53-1β in NSCLC cell growth, both A549 and H1975 cells were transfected with si-WRAP531α or si-WRAP531β. The colony formation assay revealed that knockdown of WRAP53-1α significantly decreased colony formation in A549 cells, whereas knockdown of WRAP53-1β significantly increased colony formation (Figure 2A). However, in H1975 cells, knockdown of WRAP53-1α promoted colony formation, and knockdown of WRAP53-1β had no significant effect (Figure 2B). The results of the cell viability assay indicated a significant decrease in A549 cell proliferation with WRAP53-1α knockdown, whereas WRAP53-1β deficiency significantly promoted A549 cell proliferation (Figure 2C). In H1975 cells, knockdown of WRAP53-1α induced cell proliferation, and depletion of WRAP53-1β had no significant effect (Figure 2C). These results suggested that WRAP53-1α and WRAP53-1β had opposite effects on NSCLC cell proliferation and function in a p53-dependent manner.

WRAP53-1α and WRAP53-1β deficiency induced apoptosis in NSCLC cells

Flow cytometry was used to measure apoptosis in NSCLC cells transfected with si-WRAP531α or si-WRAP531β. Knockdown of either WRAP53-1α or WRAP53-1β induced A549 cells apoptosis (P < 0.05; Figure 3A), but had no significant effect on H1975 cells (Figure 3B). Immunoblotting results indicated that knockdown of either WRAP53-1α or WRAP53-1β upregulated Bcl-2 associated X protein and downregulated B cell lymphoma 2 in A549 cells. However, these changes were mild in H1975 cells transfected with si-WRAP531α or si-WRAP531β (Figure 3C). These results suggested that WRAP53-1α and WRAP53-1β negatively regulated apoptosis in cells with wild-type p53 (A549) but not in cells with mutant p53 (H1975).

WRAP53-1α and WRAP53-1β had opposite effects on cell cycle progression in NSCLC cells

Cell cycle distribution was assessed by flow cytometry. In A549 cells, knockdown of WRAP53-1α induced a significant G0/G1 arrest, whereas knockdown of WRAP53-1β decreased the proportion of cells at the G0/G1 phase (Figure 4A). However, in H1975 cells, knockdown of WRAP53-1α decreased the proportion of cells at the G0/G1 phase (P < 0.05), and depletion of WRAP53-1β had no significant effect on the cell cycle (Figure 4B). To verify the impacts of WRAP53-1α and WRAP53-1β on the cell cycle, the levels of cell cycle regulation and checkpoint proteins were measured by immunoblotting. Cyclin-dependent kinase 4 (CDK4) was downregulated by knockdown of WRAP53-1α and upregulated by depletion of WRAP53-1β in A549 cells. However, in H1975 cells, the levels of CDK4 were increased by knockdown of WRAP53-1α, but not affected by depletion of WRAP53-1β (Figure 4C). These results suggested that WRAP53-1α and WRAP53-1β had opposite effects on NSCLC cell cycle arrest, and the regulation was p53-dependent.

WRAP53-1α and WRAP53-1β had opposite effects on migration and invasion in NSCLC cells

The impacts of WRAP53-1α and WRAP53-1β on NSCLC cells migration and invasion were examined by wound healing and modified Boyden chamber assays. Knockdown of WRAP53-1α significantly suppressed A549 cell migration, whereas WRAP53-1β deficiency promoted A549 cell migration (Figure 5A). In H1975 cells, knockdown of WRAP53-1α induced cell migration (P < 0.05), and depletion of WRAP53-1β had no significant effect (Figure 5A). The results of the modified Boyden chamber assay demonstrated that knockdown of WRAP53-1α reduced A549 cell invasion, whereas WRAP53-1β deficiency increased A549 cell invasion (Figure 5B). In H1975 cells, knockdown of WRAP53-1α promoted cell invasion (P < 0.05), whereas depletion of WRAP53-1β had no significant effect (Figure 5B). In addition, the results of immunoblotting indicated that matrix metalloproteinase 9 (MMP9) was downregulated by knockdown of WRAP53-1α and upregulated by depletion of WRAP53-1β in A549 cells. However, in H1975 cells, MMP9 was upregulated by knockdown of WRAP53-1α and not affected by depletion of WRAP53-1β (Figure 5C). These results suggested that WRAP53-1α and WRAP53-1β had opposite effects on migration and invasion in NSCLC cells in a p53-dependent manner.

In the present study, the 2 WRAP53 transcript variants, WRAP53-1α and WRAP53-1β, were knocked down in A549 cells with wild-type p53 and H1975 cells with mutated p53. WRAP53-1α not only regulates wild-type p53 expression, but also regulates mutant p53 expression. Knockdown of WRAP53-1α had anti-tumor effects in A549 cells, but had the opposite effects on H1975 cells. WRAP53-1α regulates NSCLC cell behaviours in a p53-dependent manner. WRAP53-1β does not regulate expression of either wild-type or mutant p53. WRAP53-1β acts as a tumour suppressor in A549 cells, but has no effect in H1975 cells. Our results suggest that the 2 WRAP53 transcript variants have distinct effects on p53 and NSCLC cells.

Natural antisense transcripts (NATs), a type of long non-coding RNAs (lncRNAs), occur naturally and play important roles in carcinogenesis, invasion, and metastasis[14]. The lncRNA WRAP53-1α is a naturally occurring p53 antisense transcript that acts as a crucial effector in several cancers[15, 16]. WRAP53-1α is upregulated by anti-cancer drugs, and miR-4732-5p has a binding site in the 5'-untranslated region of WRAP53[17-19]. In addition, WRAP53-1α methylation is significantly associated with worse survival in NSCLC. It is worth noting that WRAP53-1α stabilizes TP53 mRNA to increase the tumour suppressor activity of wild-type p53, leading to better prognosis. However, downregulation of WRAP53-1α by promoter methylation does not affect survival in p53-mutated tumours[20]. These results suggest that WRAP53-1α regulates p53 signalling.

WRAP53β also acts as a tumour suppressor to regulate various cancer cellular activities[21]. The significance of WRAP53β in tissue homeostasis is demonstrated by the finding that inherited mutations in WRAP53β lead to telomere dysfunction and dyskeratosis congenita, increasing the risk of tumorigenesis[22]. Moreover, single nucleotide polymorphisms and downregulation of WRAP53β are associated with various sporadic forms of cancer, including breast and ovarian cancer[23-26]. In addition, WRAP53β downregulation is correlated with resistance of head and neck cancer to radiotherapy[27], as well as disruption of the DNA damage response in ovarian tumours[28].

Previous studies indicated that WRAP53β was a potential oncoprotein, whose overexpression led to transformation and promoted cancer cell survival, and whose downregulation induced massive cell death[29-32]. In addition, overexpression of WRAP53β was related to NSCLC progression. Knockdown of WRAP53β significantly inhibited NSCLC cell proliferation both in vitro and in vivo via inducing cell cycle arrest and apoptosis. WRAP53β induced cell cycle arrest at the G0/G1 phase and regulated the expression of G0/G1-related cyclins and cyclin-dependent kinase complexes. WRAP53β deficiency was also reported to induce apoptosis through the mitochondrial pathways[33]. WRAP53β colocalized and interacted with USP7, which reduced the ubiquitination of MDM2 and p53, thereby extending the half-life of these proteins and increasing their stability[34]. Moreover, WRAP53β exerted proliferative effects on NSCLC cells via stabilizing UHRF1[35]. Recent studies revealed that WRAP53β might be related to p53 mutations and acted as an independent biomarker to predict poor prognosis of patients with surgically resected NSCLC[36].

The involvement of WRAP53 in disease progression is evident in lung cancer, but whether different targets of WRAP53 variants exert different biological functions still requires further investigation. In the present study, we used different variant-specific siRNAs to knockdown WRAP53-1α and WRAP53-1β and evaluated the functions of these variants in NSCLC cells. First, significant associations were found between WRAP53-1α and p53 expression, whereas WRAP531β expression was not associated with p53 expression, which was consistent with previous reports[8]. However, knockdown of WRAP531α upregulated p53 in A549 and H1975 cells, which conflicted with a previous study wherein WRAP53-1α stabilized p53[8, 20]. At the molecular level, NATs can have a concordant or discordant relationship with the sense transcript, and this interaction may result in higher stability or translational repression of the sense RNA[37]. Therefore, we believe that WRAP53-1α might play different roles based on the p53 mutation status.

We further demonstrated that WRAP53-1α had different effects on NSCLC cell behaviours. It is highly probable that the different mutation statuses of p53 led to these contradictory biological functions. The tumour suppressor p53 is a cellular gatekeeper that guards against genetic abnormality and instability via sensing multiple stress signals, including DNA damage and oncogene activation[38]. In addition, mutations in p53 usually result in increased half-life and nuclear accumulation, which can promote cancer progression via subverting multiple tumour suppression pathways[39]. In A549 cells, knockdown of WRAP53-1α induced upregulation of wild-type p53 and activation of cell cycle arrest and apoptosis. However, in H1975 cells with p53 mutations, the knockdown of WRAP53-1α exerted the opposite effects on cell cycle arrest and had no effect on apoptosis.

Cell function assays indicated that WRAP53-1β acted as a tumour suppressor in A549 cells. Knockdown of WRAP53-1β induced slight apoptosis and promoted the G1/S phase transition in A549 cells, but had no effect on H1975 cells. These findings concerning the contribution of WRAP53β to cancer might occur in a p53-dependent manner, which was consistent with the results of animal models[36]. Inactivation of WRAP53-1β could help initiate tumour development by impairing telomere maintenance and DNA repair, leading to genomic instability. Our data suggested that WRAP53-1β was a putative tumour suppressor during the progression and metastasis of NSCLC, whereas WRAP53-1α might have a dual function. These findings suggest potential interactions between the 2 transcript variants. This study provides a foundation for further examining the mechanisms by which WRAP53-1α and WRAP53-1β exert their functions in NSCLC, but more in vivo validation is needed.

In summary, our results indicated that different transcript variants of WRAP53 played different and even opposite roles in NSCLC cells. Specifically targeting WRAP53 variants may contribute to NSCLC therapeutic strategies.

NSCLC non-small cell lung cancer

WRAP53 WD40-encoding RNA antisense to p53

TP53 tumor protein 53

qRT-PCR Quantitative real-time polymerase chain reaction

siRNAs small interfering RNAs

NC negative control

CCK-8 cell counting kit-8

PBS phosphate-buffered saline

SD standard deviation

GAPDH glyceraldehyde-3-phosphate dehydrogenase

Bax Bcl-2 Associated X Protein

Bcl-2 B cell lymphoma 2

CDK4 cyclin-dependent kinase 4

MMP matrix metalloproteinase 9

NATs natural antisense transcripts

lncRNAs long non-coding RNAs

USP7 ubiquitin-specific protease-7

MDM2 murine double minute 2

UHRF1 ubiquitin-like containing PHD and RING finger domains 1

Ethics approval and consent to participate Not applicable

Consent for publication Not applicable

Availability of data and materials Not applicable

Competing interests The authors declare that they have no competing interests.

Funding This study was supported by National Natural Science Foundation of China (81773236, 81800429 and 81972852), Key Research & Development Project of Hubei Province (2020BCA069), Nature Science Foundation of Hubei Province (2020CFB612), Health Commission of Hubei Province Medical Leading Talent Project, Young and Middle-Aged Medical Backbone Talents of Wuhan (WHQG201902), Application Foundation Frontier Project of Wuhan (2020020601012221), Zhongnan Hospital of Wuhan University Science, Technology and Innovation Seed Fund (znpy2019001, znpy2019048, and ZNJC201922), and Chinese Society of Clinical Oncology TopAlliance Tumor Immune Research Fund (Y-JS2019-036). The funders had no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Author contributions (I) Conception and design: Y Zhu, Y Gong, C Xie; (II) Administrative support: C Xie; (III) Provision of study materials or patients: Y Zhu, W Sun, X Jiang; (IV) Collection and assembly of data: Y Zhu, R Bai, Y Luo, Y Gao; (V) Data analysis and interpretation: Y Zhu, S Li, Z Huang; (VI) Manuscript writing: Y Zhu, Y Gong, C Xie; (VII) Final approval of manuscript: All authors.

Acknowledgements Not applicable

1. Venables JP: Unbalanced alternative splicing and its significance in cancer. BioEssays : news and reviews in molecular, cellular and developmental biology 2006, 28(4):378-386.

2. Black DL: Mechanisms of alternative pre-messenger RNA splicing. Annual review of biochemistry 2003, 72:291-336.

3. Binayke A, Mishra S, Suman P, Das S, Chander H: Awakening the "guardian of genome": reactivation of mutant p53. Cancer Chemother Pharmacol 2019, 83(1):1-15.

4. Surget S, Khoury MP, Bourdon JC: Uncovering the role of p53 splice variants in human malignancy: a clinical perspective. Onco Targets Ther 2013, 7:57-68.

5. Shi J, Hua X, Zhu B, Ravichandran S: Somatic Genomics and Clinical Features of Lung Adenocarcinoma: A Retrospective Study. PLoS Med 2016, 13(12):e1002162.

6. Jiao XD, Qin BD, You P, Cai J, Zang YS: The prognostic value of TP53 and its correlation with EGFR mutation in advanced non-small cell lung cancer, an analysis based on cBioPortal data base. Lung cancer (Amsterdam, Netherlands) 2018, 123:70-75.

7. Zhu WY, Hu XF, Fang KX, Kong QQ, Cui R, Li HF, He JY, Zhang YK, Le HB: Prognostic value of mutant p53, Ki-67, and TTF-1 and their correlation with EGFR mutation in patients with non-small cell lung cancer. Histology and histopathology 2019, 34(11):1269-1278.

8. Mahmoudi S, Henriksson S, Corcoran M, Méndez-Vidal C, Wiman KG, Farnebo M: Wrap53, a Natural p53 Antisense Transcript Required for p53 Induction upon DNA Damage. Mol Cell 2016, 64(5):1009-1009.

9. Venteicher AS, Abreu EB, Meng Z, McCann KE, Terns RM, Veenstra TD, Terns MP, Artandi SE: A human telomerase holoenzyme protein required for Cajal body localization and telomere synthesis. Science 2009, 323(5914):644-648.

10. Tycowski KT, Shu M-D, Kukoyi A, Steitz JA: A conserved WD40 protein binds the Cajal body localization signal of scaRNP particles. Mol Cell 2009, 34(1):47-57.

11. Mahmoudi S, Henriksson S, Weibrecht I, Smith S, Söderberg O, Strömblad S, Wiman KG, Farnebo M: Correction: WRAP53 Is Essential for Cajal Body Formation and for Targeting the Survival of Motor Neuron Complex to Cajal Bodies. PLoS Biol 2018, 16(9):e3000030-e3000030.

12. Henriksson S, Rassoolzadeh H, Hedström E, Coucoravas C, Julner A, Goldstein M, Imreh G, Zhivotovsky B, Kastan MB, Helleday T et al: The scaffold protein WRAP53β orchestrates the ubiquitin response critical for DNA double-strand break repair. Genes Dev 2014, 28(24):2726-2738.

13. Henriksson S, Farnebo M: On the road with WRAP53β: guardian of Cajal bodies and genome integrity. Front Genet 2015, 6:91-91.

14. Nie L, Wu HJ, Hsu JM, Chang SS, Labaff AM, Li CW, Wang Y, Hsu JL, Hung MC: Long non-coding RNAs: versatile master regulators of gene expression and crucial players in cancer. American journal of translational research 2012, 4(2):127-150.

15. Kamel MM, Matboli M, Sallam M, Montasser IF, Saad AS, El-Tawdi AHF: Investigation of long noncoding RNAs expression profile as potential serum biomarkers in patients with hepatocellular carcinoma. Transl Res 2016, 168:134-145.

16. Braicu C, Zimta A-A, Harangus A, Iurca I, Irimie A, Coza O, Berindan-Neagoe I: The Function of Non-Coding RNAs in Lung Cancer Tumorigenesis. Cancers (Basel) 2019, 11(5):605.

17. Yuan JM, Li XD, Liu ZY, Hou GQ, Kang JH, Huang DY, Du SX: Cisplatin induces apoptosis via upregulating Wrap53 in U-2OS osteosarcoma cells. Asian Pac J Cancer Prev 2011, 12(12):3465-3469.

18. Bug M, Dobbelstein M: Anthracyclines induce the accumulation of mutant p53 through E2F1-dependent and -independent mechanisms. Oncogene 2011, 30(33):3612-3624.

19. Pouladi N, Kouhsari SM, Feizi MH, Gavgani RR, Azarfam P: Overlapping region of p53/wrap53 transcripts: mutational analysis and sequence similarity with microRNA-4732-5p. Asian Pac J Cancer Prev 2013, 14(6):3503-3507.

20. Kim DS, Lee WK, Park JY: Promoter methylation of Wrap53α, an antisense transcript of p53, is associated with the poor prognosis of patients with non-small cell lung cancer. Oncol Lett 2018, 16(5):5823-5828.

21. Jain BP, Pandey S: WD40 Repeat Proteins: Signalling Scaffold with Diverse Functions. Protein J 2018, 37(5):391-406.

22. Zhong F, Savage SA, Shkreli M, Giri N, Jessop L, Myers T, Chen R, Alter BP, Artandi SE: Disruption of telomerase trafficking by TCAB1 mutation causes dyskeratosis congenita. Genes Dev 2011, 25(1):11-16.

23. Garcia-Closas M, Kristensen V, Langerød A, Qi Y, Yeager M, Burdett L, Welch R, Lissowska J, Peplonska B, Brinton L et al: Common genetic variation in TP53 and its flanking genes, WDR79 and ATP1B2, and susceptibility to breast cancer. Int J Cancer 2007, 121(11):2532-2538.

24. Mędrek K, Magnowski P, Masojć B, Chudecka-Głaz A, Torbe B, Menkiszak J, Spaczyński M, Gronwald J, Lubiński J, Górski B: Association of common WRAP 53 variant with ovarian cancer risk in the Polish population. Mol Biol Rep 2013, 40(3):2145-2147.

25. Sedaie Bonab A, Pouladi N, Hosseinpourfeizi MA, Ravanbakhsh Gavgani R, Dehghan R, Azarfam P, Montazeri V, Fakhrjou A: Single-strand conformational polymorphism analysis of a common single nucleotide variation in WRAP53 gene, rs2287499, and evaluating its association in relation to breast cancer risk and prognosis among Iranian-Azeri population. Med Oncol 2014, 31(9):168-168.

26. Pouladi N, Abdolahi S, Farajzadeh D, Hosseinpour Feizi MA: Haplotype and linkage disequilibrium of TP53-WRAP53 locus in Iranian-Azeri women with breast cancer. PLoS One 2019, 14(8):e0220727-e0220727.

27. Garvin S, Tiefenböck K, Farnebo L, Thunell LK, Farnebo M, Roberg K: Nuclear expression of WRAP53β is associated with a positive response to radiotherapy and improved overall survival in patients with head and neck squamous cell carcinoma. Oral Oncol 2015, 51(1):24-30.

28. Hedström E, Pederiva C, Farnebo J, Nodin B, Jirström K, Brennan DJ, Farnebo M: Downregulation of the cancer susceptibility protein WRAP53β in epithelial ovarian cancer leads to defective DNA repair and poor clinical outcome. Cell Death Dis 2015, 6(10):e1892-e1892.

29. Mahmoudi S, Henriksson S, Farnebo L, Roberg K, Farnebo M: WRAP53 promotes cancer cell survival and is a potential target for cancer therapy. Cell Death Dis 2011, 2(1):e114-e114.

30. Sun C-k, Luo X-b, Gou Y-p, Hu L, Wang K, Li C, Xiang Z-t, Zhang P, Kong X-l, Zhang C-l et al: TCAB1: a potential target for diagnosis and therapy of head and neck carcinomas. Mol Cancer 2014, 13:180-180.

31. Rao X, Huang D, Sui X, Liu G, Song X, Xie J, Huang D: Overexpression of WRAP53 is associated with development and progression of esophageal squamous cell carcinoma. PLoS One 2014, 9(3):e91670-e91670.

32. Zhu Y, Ding L, Chen B-F, Song J-G, Yao Y-S: Oncogenic Activity of Wrap53 in Human Colorectal Cancer In Vitro and in Nude Mouse Xenografts. Med Sci Monit 2018, 24:6129-6136.

33. Sun Y, Yang C, Chen J, Song X, Li Z, Duan M, Li J, Hu X, Wu K, Yan G et al: Overexpression of WDR79 in non-small cell lung cancer is linked to tumour progression. J Cell Mol Med 2016, 20(4):698-709.

34. Sun Y, Cao L, Sheng X, Chen J, Zhou Y, Yang C, Deng T, Ma H, Feng P, Liu J et al: WDR79 promotes the proliferation of non-small cell lung cancer cells via USP7-mediated regulation of the Mdm2-p53 pathway. Cell Death Dis 2017, 8(4):e2743-e2743.

35. Chen J, Sheng X, Ma H, Tang Z, Yang C, Cao L, Sun Y, Deng T, Feng P, Hu B et al: WDR79 mediates the proliferation of non-small cell lung cancer cells by regulating the stability of UHRF1. J Cell Mol Med 2018, 22(5):2856-2864.

36. Peng J, Zhan Y, Feng J, Fan S, Zang H: Expression of WDR79 is associated with TP53 mutation and poor prognosis in surgically resected non-small cell lung cancer. J Cancer 2019, 10(13):3046-3053.

37. Werner A, Swan D: What are natural antisense transcripts good for? Biochem Soc Trans 2010, 38(4):1144-1149.

38. Green DR, Kroemer G: Cytoplasmic functions of the tumour suppressor p53. Nature 2009, 458(7242):1127-1130.

39. Yue X, Zhao Y, Xu Y, Zheng M, Feng Z, Hu W: Mutant p53 in Cancer: Accumulation, Gain-of-Function, and Therapy. Journal of molecular biology 2017, 429(11):1595-1606.

Table 1 Primer sequences and siRNA sequences used in this study.

Gene	sequences or target sequence (5'→3')
GAPDH-F	GGAGCGAGATCCCTCCAAAAT
GAPDH-R	GGCTGTTGTCATACTTCTCATGG
Wrap531α-F	CCGGAGCCCAGCAGCTACCTG
Wrap531α-R	CATGGCGACTGTCCAGCTTTG
Wrap531β-F	AGGAGGGAAGCACAGTATGAAGAC
Wrap531β-R	GGCATCAGTTCAGAGTCCGCA
P53-F	ACGACGGTGACACGCTTCCC
P53-R	AGGGGGCTCGACGCTAGGAT
siControl sense	UUCUCCGAACGUGUCACGUTT
siControl Antisense	ACGUGACACGUUCGGAGAATT
siWrap531α sense	AAAACCCCAATCCCATCAACC
siWrap531α Antisense	AAGGTTGATGGGATTGGGGTT
siWrap531β sense	AATCGGAAGGTGGACCGAAAT
siWrap531β Antisense	AAATTTCGGTCCACCTTCCGA

Table 2 Antibodies used in this study.

Antibody	Company	Dilution
GAPDH (10494-1-AP)	Proteintech	1:2500
WRAP53 (14761-1-AP)	Proteintech	1:1000
P53 (10442-1-AP)	Proteintech	1:1000
E-Cadherin (20874-1-AP)	Proteintech	1:1000
Vimentin (10366-1-AP)	Proteintech	1:1000
MMP9 (10375-2-AP)	Proteintech	1:1000
BAX (60267-1-lg)	Proteintech	1:5000
BCL-2 (60178-1-lg)	Proteintech	1:1000
CDK2 (10122-1-AP)	Proteintech	1:1000
CDK4 (11026-1-AP)	Proteintech	1:1000
CyclinE1 (11554-1-AP)	Proteintech	1:1000
CyclinD1 (60186-1-lg)	Proteintech	1:5000
P21 (10355-1-AP)	Proteintech	1:1000
Tubulin (10094-1-AP)	Proteintech	1:1000

SupplementaryMaterial.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

Differential Effects of WRAP53 Transcript Variants on the Biological Behaviours of Human Non-Small Cell Lung Cancer Cells

Status:

Version 1

Abstract

Figures

Background

Methods

Cell culture

RNA extraction and quantitative real-time polymerase chain reaction

Immunoblotting

Colony formation assay

Cell viability assay

Apoptosis assay

Cell cycle analysis

Wound healing assay

Cell invasion assays

Statistical analysis

Results

Knockdown of WRAP53-1α, but not WRAP53-1β, induced p53 expression

WRAP53-1α and WRAP53-1β had opposite effects on NSCLC cell growth and proliferation

WRAP53-1α and WRAP53-1β deficiency induced apoptosis in NSCLC cells

WRAP53-1α and WRAP53-1β had opposite effects on cell cycle progression in NSCLC cells

WRAP53-1α and WRAP53-1β had opposite effects on migration and invasion in NSCLC cells

Discussion

Conclusions

Abbreviations

Declarations

References

Tables

Supplementary Files

Status:

Version 1