CK2α/CSNK2A1 Induces Resistance to Doxorubicin Through SIRT6 Mediated Activation of the DNA Damage Repair Pathway

doi:10.21203/rs.3.rs-624074/v1

Download PDF

Research

CK2α/CSNK2A1 Induces Resistance to Doxorubicin Through SIRT6 Mediated Activation of the DNA Damage Repair Pathway

https://doi.org/10.21203/rs.3.rs-624074/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 13 Jul, 2021

Read the published version in Cells →

Version 1

posted

You are reading this latest preprint version

Background

CK2α/CSNK2A1 is involved in cancer progression by phosphorylating various signaling molecules. Considering the role of CSNK2A1 in cancer progression and phosphorylation of SIRT6 and the role of SIRT6 in chemoresistance through the DNA damage repair pathway, CSNK2A1 and SIRT6 might be involved in resistance to the conventional anti-cancer therapies.

Methods

We evaluated the expression of CSNK2A1 in the 37 osteosarcoma patients and investigated the effects of CSNK2A1 and phosphorylation of SIRT6 on Ser338 on the resistance to the anti-cancer effects of doxorubicin.

Results

Higher expression of CSNK2A1 predicted shorter overall survival and relapse-free survival in both general osteosarcoma patients and sub-population of patients who received postoperative chemotherapies. U2OS and KHOS/NP osteosarcoma cells with induced overexpression of CSNK2A1 were resistant to cytotoxic effects of doxorubicin, and knock-down of CSNK2A1 potentiated the cytotoxic effects of doxorubicin. CSNK2A1 overexpression-mediated resistance to doxorubicin was associated with SIRT6 phosphorylation and induction of the DNA damage repair pathway molecules ATM and Chk2. CSNK2A1 and SIRT6 mediated resistance to doxorubicin in vivo was attenuated via mutation of SIRT6 at the Ser338 phosphorylation site. Emodin, a CSNK2A1 inhibitor, potentiated the cytotoxic effects of doxorubicin in osteosarcoma cells in vitro.

Conclusions

This study demonstrates that the expression of CSNK2A1 might be used as a prognostic indicator of osteosarcoma. In addition, it suggests that CSNK2A1 induces resistance to doxorubicin through phosphorylation of SIRT6-mediated activation of the DNA damage repair pathway. Therefore, blocking the CSNK2A1-SIRT6-DNA damage repair pathway might be a new therapeutic stratagem for the poor prognostic subgroup of osteosarcomas with high expression of CSNK2A1.

Cancer Biology

Osteosarcoma

CSNK2A1

SIRT6

doxorubicin

DNA damage

Protein kinase CK2 (designated CSNK2) is a highly conserved serine/threonine kinase with diverse roles in the cell and is involved in the regulation of more than 300 molecules [1]. Especially, CSNK2 is involved in tumor biology through regulation of cellular proliferation, cell cycle progression, apoptosis, metabolism, and invasiveness [1–3]. CSNK2 α1 (CSNK2A1, CK2α) expression is also elevated in cancer tissue of the gastrointestinal tract [4, 5], head and neck [6], kidney [7, 8], and prostate [9]. Furthermore, higher expression of CSNK2A1 is associated with shorter survival of patients with breast cancer [10], clear cell renal cell carcinoma [8], and gastric cancer [5]. CSNK2A1 is involved in cancer progression by regulating various cancer-promoting signaling pathways such as MYC, PI3K-Akt, NFκB, and Wnt/β-catenin pathways [3, 10–14]. These biological roles of CSNK2A1 in cancer are closely related to its kinase activity on the targets involved in tumorigenesis [5, 10]. CSNK2A1 serves cancer progression by inducing phosphorylation of various molecules, including SIRT1, SIRT6, and CCAR2 [5, 10, 15]. Among these, a study on the phosphorylation of SIRT6 has focused on its important roles in cancer progression [10].

SIRT6 is a member of the sirtuin family and has diverse roles in normal physiology and cancer biology, including aging, cell metabolism, proliferation, invasiveness of cells, and DNA damage repair [10, 16–18]. Among these, the role of SIRT6 in DNA damage repair has suggested a role for SIRT6 as a tumor suppressor [18]. However, controversially, poor prognosis of cancer patients having a higher expression of SIRT6 has been reported in various human cancers such as breast cancer [10], gastric cancer [19], lung cancer [20], osteosarcoma [21], and ovarian cancer [22]. Especially, the role of SIRT6 in DNA damage repair enables cancer cells to be refractory genotoxic anti-cancer therapeutics [21]. In osteosarcoma cells, inhibition of SIRT6 sensitized cells to the cytotoxic effect of doxorubicin [21]. Therefore, therapies targeting SIRT6 or the downstream DNA damage repair pathway have been suggested for cancers highly expressing SIRT6. However, when considering the controversial reports on the effects of SIRT6 in cancer cells [10, 21, 23, 24], elevated expression of SIRT6 it might not be sufficient to predict SIRT6 activity in human cancers. The effects of SIRT6 on cancer biology are regulated by its phosphorylation status, especially on Ser338 [10]. In breast cancer cells, CSNK2A1 phosphorylates SIRT6 on Ser338, and this process stimulates cell proliferation through the regulation of β-catenin and NFκB [10]. Therefore, the relationship between CSNK2A1 and SIRT6 phosphorylation on Ser338 might be important in cancer therapy with regards to overcoming resistance to anti-cancer therapeutics.

Osteosarcoma is the most common primary cancer of the bone [25]. However, despite advancements in the understanding of the molecular mechanisms of cancer and the development of specific anti-cancer targeted therapies, therapeutic modalities applicable to osteosarcoma are limited [26]. Therefore, trials to find specific therapeutic applications focused on osteosarcoma are needed. Recently, therapeutic applications targeting the DNA damage repair pathway by using a PARP inhibitor [27, 28] and by inhibiting SIRT6 [21] have been reported in osteosarcoma. In addition, the efficacy of inhibition of CSNK2 has been evaluated in various human cancers [29, 30]. Therefore, based on the roles and molecular relationships between CSNK2A1-SIRT6-DNA damage repair pathways in human cancers [10, 17, 21], this molecular relationship might be a potential therapeutic target for osteosarcoma. However, reports on the role of CSNK2A1-SIRT6 pathway in human sarcoma including osteosarcoma are limited. Therefore, this study aimed to investigate the roles and mechanisms of CSNK2A1-SIRT6-DNA damage repair pathways in the treatment of osteosarcomas, especially those resistant to anti-cancer therapy.

Osteosarcoma specimens and immunohistochemical evaluation of CSNK2A1

Thirty-seven osteosarcomas of the bone treated between 1999 and 2011 at Jeonbuk National University Hospital were included in this study. The cases included in this study were evaluated for clinicopathological factors by reviewing medical records and histologic slides. A review of the case was based on the latest WHO classification [25] and the latest AJCC cancer staging system [31]. The clinicopathological factors evaluated in this study are listed in Table 1. The expression of CSNK2A1 in human osteosarcoma tissue samples was assessed via immunohistochemical staining of tissue microarray (TMA) sections. TMA blocks contained two 3 mm tissue cores per case. TMA sections were microwaved using an antigen retrieval procedure with pH 6.0 antigen retrieval solution (DAKO, Glostrup, Denmark). Tissue sections were incubated with anti-CSNK2A1 (1:100, Cell Signaling Technology, Beverly, MA) antibody and developed with the DAKO Envision system (DAKO, Carpinteria, CA). Immunohistochemical staining scores were obtained by adding the intensity score (no expression; score 0, weak expression; score 1, moderate expression; score 2, strong expression; score 3) and the area score (no staining cells; score 0, 1%; score 1, 2 ~ 10%; score 2, 11 ~ 33%; score 3, 34 ~ 66%; score 4, and 67 ~ 100%; score 5) [21, 32–34]. Thereafter, the scores obtained from each TMA section from two TMA cores in each case were added and used in the analysis. The final scores ranged from zero to sixteen. This study was performed after obtaining IRB approval (Jeonbuk National University Hospital; approval number, CUH 2020-10-011).

Table 1

The clinicopathological characteristics of 37 osteosarcomas and their association with the immunohistochemical expression of CSNK2A1
Characteristics		No.	CSNK2A1
			Positive	P
Age, years	< 30	24	11 (46%)	0.068
	≥ 30	13	10 (77%)
Sex	Male	25	17 (68%)	0.046
	Female	12	4 (33%)
Tumor size	≤ 8 cm	19	8 (42%)	0.065
	> 8 cm	18	13 (72%)
Stage	I & II	26	11 (42%)	0.006
	III & IV	11	10 (91%)
T category	1	17	6 (35%)	0.028
	2	16	11 (69%)
	3 and 4	4	4 (100%)
N category	N0	34	19 (56%)	0.718
	N1	3	2 (67%)
M category	M0	29	14 (48%)	0.047
	M1	8	7 (88%)
Latent distant metastasis	Absence	28	13 (46%)	0.025
	Presence	9	8 (89%)

Osteosarcoma cells, chemicals, and transfection

This study used two human osteosarcoma cell lines. U2OS cells were purchased from the Korean Cell Line Bank (KCLB, Seoul, Korea), and KHOS/NP cells were kindly provided by Chang-Bae Kong (Department of Orthopedic Surgery, Korea Institute of Radiological and Medical Science). U2OS and KHOS/NP cells were grown in Dulbecco’s modified Eagle’s medium (Gibco BRL, Gaithersburg, MD) under humidified conditions of 5% CO₂ and 37°C. The culture media was supplemented with 10% Fetal Bovine Serum (Gibco BRL, Gaithersburg, MD) and 1% penicillin/streptomycin (Gibco BRL, Gaithersburg, MD). Cells were routinely assessed for mycoplasma contamination with the Mycotest kit (Invitrogen, Carlsbad, CA). This study used doxorubicin (D1515, Sigma, St. Louis, MO), emodin, a CSNK2A1 inhibitor (Sigma, St. Louis, MO). The vector for CSNK2A1-specific shRNA was purchased from GenePharma Co. (GenePharma, Shanghai, China). The CSNK2A1 duplex has the forward and reverse sequences 5’-CACCGGGTGAAACACTTCAGAAGCATTCAAGAGATGCTTCTGAAGTGTTTCACCCTTTTTTG-3’ and 5’-GATCCAAAAAAGGGTGAAACACTTCAGAAGCATCTCTTGAATGCTTCTGAAGTGTTTCACCC − 3’, respectively. The plasmid for HA-tagged wild-type (WT) CSNK2A1 (pRc/CMV_CSNK2A1-HA) was kindly provided by Laszlo Gyenis (Department of Biochemistry, University of Western Ontario, Canada). The plasmids for WT-SIRT6 (pFLAG2_SIRT6) and mutant construct for the Ser338 phosphorylation site of SIRT6 (pFLAG2_SIRT6_S338A) were synthesized by Cosmo Genetech Co. Ltd. (Seoul, Korea). A pFLAG-CMV-2 vector was used as a control plasmid. Lipofectamine 2000 (Invitrogen, Carlsbad, CA) was used for the transfection of cells.

Cell proliferation assay and colony-forming assay

The proliferation activity of cells was evaluated by using the Cell Counting Kit-8 assay (CCK8, Dojindo, Kumamoto, Japan) and a colony-forming assay. The CCK8 assay was performed by seeding 3x10³ U2OS and 3x10³ KHOS/NP cells in 96-well plates for 24, 48, and 72 h. Two hours after adding CCK8, the absorbance was measured at 560 nm in a microtiter plate reader (Bio-Rad, Richmond, CA). The colony-forming assay was performed by seeding 1x10³ U2OS and 1x10³ KHOS/NP cells in 12-well or 6-well culture plates. After the indicated times, the plates with colonies were fixed in methanol and stained with 0.1% crystal violet (Sigma, St. Louis, MO), then counted using Clono-Counter software available as supplementary electronic material of a published manuscript [35].

Western blot analysis

To obtain total protein, we washed cells with phosphate-buffered saline twice and lysed them with ice-cold PRO-PREP Protein Extraction Solution (iNtRON Biotechnology Inc., Korea) supplemented with 1x phosphatase inhibitor cocktails 2, 3 (Sigma, St. Louis, MO). The normalized protein was mixed with 4x SDS-PAGE loading buffer and electrophoresed. The electrophoresed proteins were electrotransferred to a polyvinylidene difluoride membrane and blocked. The membranes were incubated with the following primary antibodies: CSNK2A1 (Cell Signaling Technology, Beverly, MA), SIRT6 (Cell Signaling Technology, Beverly, MA), phosphorylated SIRT6 (Ser338) (pSIRT6, Cell Signaling Technology, Beverly, MA), cleaved PARP1 (Cell Signaling Technology, Beverly, MA), cleaved caspase 3 (Cell Signaling Technology, Beverly, MA), BCL2 (Cell Signaling Technology, Beverly, MA), BAX (Cell Signaling Technology, Beverly, MA), phosphorylated ATM (Ser1981) (pATM, Santa Cruz Biotechnology, Santa Cruz, CA), phosphorylated Chk2 (pChk2, Cell Signaling Technology, Beverly, MA), phosphorylated H2AX (γH2AX, Cell Signaling Technology, Beverly, MA), and GAPDH (Cell Signaling Technology, Beverly, MA). The membranes were incubated with secondary antibodies and developed with an ECL detection system (Amersham Biosciences, Buckinghamshire, UK). The developed membranes were imaged by using a luminescent image analyzer (LAS-3000, Fuji Film, Tokyo, Japan).

Flow cytometry analysis for apoptosis

Apoptosis of cells was measured using an apoptosis detection kit (Invitrogen, Carlsbad, CA) via flow cytometry analysis based on staining for FITC-conjugated annexin V and propidium iodide. The cells were suspended in 100 µL binding buffer at a concentration of 1x10⁶ cell/mL. The suspended cells were incubated with 5 µL of annexin V-FITC and 5 µL of propidium iodide for 15 min at 37°C in the dark. Thereafter, the samples were analyzed with a BD FACSCalibur system (Becton-Dickinson, San Jose, CA).

Orthotopic xenograft model

Five-week-old male FoxnN.Cg/c nude mice (Orient Bio, Seongnam, Korea) were housed under pathogen-free conditions and received specific care based research ethics outlined in a plan that approved by the institutional animal care and use committee of Jeonbuk National University (approval number: JBNU 2021-032). The mice acclimatized for one week were grouped randomly into five groups, with each group contained four mice. KHOS/NP cells were transfected with empty vectors, a plasmid for WT-CSNK2A1, plasmids for WT-CSNK2A1 and WT-SIRT6 (WT-CSNK2A1/WT-SIRT6), or a plasmid for SIRT6-S338A mutant. Thereafter, to establish the xenograft osteosarcoma model, 2x10⁶ KHOS/NP cells were injected into the bone marrow of the proximal tibia under anesthesia. Two weeks after tumor cell injection, the mice receiving doxorubicin according to the classification of the experimental groups were injected with doxorubicin [4 mg/kg in dimethyl sulfoxide (DMSO)] intraperitoneally once a week. Body weights and tumor sizes were measured every five days. The tumor sizes were estimated as length x width x height x 0.52 formula. According to the humane end-point, the mice were euthanized six weeks after doxorubicin treatment. Mice were sacrificed after anesthetizing with sodium pentobarbital. The tumors, lung, liver, and kidney were resected and evaluated histologically with hematoxylin and eosin staining. Animal experiments were approved by the institutional animal care and use committee of Jeonbuk National University (approval number: JBNU 2021-032).

Statistical analysis

Immunohistochemical staining scores for CSNK2A1 were estimated by receiver operating characteristic curve analysis at the critical predictive point for the death of osteosarcoma patients [36]. The point with the highest area under the curve was determined as a cut-off point. The overall survival (OS) and relapse-free survival (RFS) were conducted to estimate the prognosis of osteosarcoma patients. The events of death for osteosarcoma patients occurred in OS analysis, and the duration of death was estimated from the time of operation to the time of last contact. In addition, the events of relapse or death of osteosarcoma patients occurred in RFS analysis, and the duration of death was calculated from the time of operation to the time of last contact. The prognostic survival analysis was calculated with univariate and multivariate Cox proportional hazards regression analysis, while the Kaplan-Meier survival analysis generated the survival curves. The Pearson’s Chi-square test and Student’s t-test were used to calculate the relationship between the clinicopathological variables. All experiments were performed in triplicate, and representative data presented. Statistical analysis was performed using the SPSS software (IBM, version 20.0, Armonk, NY), and a P value less than 0.05 was considered significant.

The expression of CSNK2A1 is associated with poor prognosis of osteosarcoma patients

To evaluate the clinicopathological significance of CSNK2A1 expression in human osteosarcomas, we performed immunohistochemical staining for CSNK2A1. Representative images of the immunohistochemical expression pattern of CSNK2A1 are presented in Fig. 1a. The positivity of the immunohistochemical expression of CSNK2A1 was determined with receiver operating characteristic curve analysis (Fig. 1b). The cut-off point was determined at the point with the highest area under the curve to predict the death of osteosarcoma patients (Fig. 1b). The cut-off point was twelve, and the cases with immunohistochemical staining scores equal or greater than twelve were considered positive for CSNK2A1 immunostaining (Fig. 1b). With this cut-off point, CSNK2A1-positivity was significantly associated with sex (P = 0.046), higher tumor stage (P = 0.006), higher T category (P = 0.028), higher M category (P = 0.047), and latent distant metastasis (P = 0.025) (Table 1).

In univariate survival analysis, age (OS; P = 0.039, RFS; P = 0.018), tumor size (OS; P = 0.015, RFS; P = 0.019), tumor stage (OS; P = 0.015, RFS; P = 0.005), T category (OS; overall P = 0.059, RFS; overall P = 0.020), M category (OS; P = 0.007, RFS; P = 0.018), and CSNK2A1 expression (OS; P = 0.002, RFS; P < 0.001) were significantly associated with OS or RFS (Table 2). CSNK2A1-positivity predicted a 10.081-fold (95% confidence interval [95% CI]; 2.307–44.054) greater risk of death and a 12.179-fold (95% CI; 2.777–53.407) greater risk of relapse or death of osteosarcoma patients (Table 2). The Kaplan-Meier survival curves for OS and RFS of CSNK2A1 expression are presented in Fig. 1c.

Table 2

Univariate analysis with Cox proportional hazards regression analysis for the survival of 37 osteosarcoma patients
Characteristics	No.	OS		RFS
		HR (95% CI)	P	HR (95% CI)	P
Age, years, ≥ 30 (vs. <30)	13/37	2.599 (1.050–6.433)	0.039	2.902 (1.201–7.014)	0.018
Sex, male (vs. female)	25/37	0.825 (0.294–2.312)	0.714	0.657 (0.235–1.836)	0.423
Tumor size, ≥ 8 cm (vs. < 8cm)	18/37	3.359 (1.263–8.933)	0.015	3.076 (1.207–7.838)	0.019
Stage, III & IV (vs. I & II)	11/37	3.161 (1.255–7.961)	0.015	3.647 (1.472–9.034)	0.005
T category, 1	17/37	1	0.059	1	0.020
2	16/37	3.335 (1.150–9.668)	0.027	3.455 (1.188–10.043)	0.023
3 and 4	4/37	3.946 (0.938–16.606)	0.061	5.895 (1.559–22.287)	0.009
N category, N1 (vs. N0)	3/37	4.841 (0.957–24.486)	0.057	2.800 (0.599–13.095)	0.191
M category, M1 (vs. M0)	8/37	3.973 (1.464–10.784)	0.007	3.349 (1.229–9.125)	0.018
CSNK2A1, positive (vs. negative)	21/37	10.081 (2.307–44.054)	0.002	12.179 (2.777–53.407)	< 0.001
OS, overall survival; RFS, relapse-free survival; HR, hazard ratio; 95% CI, 95% confidence interval.

Multivariate analysis for OS and RFS was performed with the inclusion of age, tumor size, stage, T category, N category, M category, and CSNK2A1 expression. In multivariate analysis, CSNK2A1 expression was an independent indicator of OS and RFS (Table 3). CSNK2A1-positivity predicted a 10.147-fold (95% CI; 2.320-44.385, P = 0.002) greater risk of death and a 12.179-fold (95% CI; 2.777–53.407, P < 0.001) greater risk of relapse or death of osteosarcoma patients (Table 2).

Table 3

Multivariate Cox proportional hazards regression analysis for the survival of 37 osteosarcoma patients.
Characteristics	OS		RFS
	HR (95% CI)	P	HR (95% CI)	P
N category, N1 (vs. N0)	5.099 (0.945–27.506)	0.058
CSNK2A1, positive (vs. negative)	10.147 (2.320-44.385)	0.002	12.179 (2.777–53.407)	< 0.001
OS, overall survival; RFS, relapse-free survival; HR, hazard ratio; 95% CI, 95% confidence interval. The variables included in multivariate analysis were age, tumor size, stage, T category, N category, M category, and CSNK2A1 expression.

In the univariate analysis of 26 osteosarcoma patients who received adjuvant chemotherapy, CSNK2A1 expression was significantly associated with OS (P = 0.008) and RFS (P = 0.003) (Table 4). In the multivariate analysis performed with the inclusion of age, tumor size, stage, T category, N category, M category, and CSNK2A1 expression, N category was an independent indicator of OS (P = 0.035), and CSNK2A1 expression was an independent indicator of OS (P = 0.006) and RFS (P = 0.003) (Table 5). CSNK2A1 expression predicted a 9.619-fold (95% CI; 1.932–47.877) greater risk in OS analysis and a 10.374-fold (95% CI; 2.244–47.968) greater risk in RFS analysis in osteosarcoma patients who received adjuvant chemotherapy (Table 4).

Table 4

Univariate and multivariate Cox proportional hazards regression analysis of the survival of 26 osteosarcoma patients who received adjuvant chemotherapy
Characteristics		No.	OS		RFS
			HR (95% CI)	P	HR (95% CI)	P
Univariate analysis
	CSNK2A1, positive (vs. negative)	13/26	7.741 (1.693–35.408)	0.008	10.374 (2.224–47.968)	0.003
Multivariate analysis
	N category, N1 (vs. N0)		18.317 (1.223-274.238)	0.035
	CSNK2A1, positive (vs. negative)		9.619 (1.932–47.877)	0.006	10.374 (2.244–47.968)	0.003
OS, overall survival; RFS, relapse-free survival; HR, hazard ratio; 95% CI, 95% confidence interval. The variables included in multivariate analysis were age, tumor size, stage, T category, N category, M category, and CSNK2A1 expression.

The expression of CSNK2A1 is involved in the resistance to the anti-proliferative effect of doxorubicin

In human osteosarcomas, especially in the patients who received adjuvant chemotherapy, the expression of CSNK2A1 was significantly associated with shorter survival. Therefore, we evaluated the effect of CSNK2A1 in doxorubicin cytotoxicity on osteosarcoma cells. In U2OS and KHOS/NP osteosarcoma cells, overexpression of CSNK2A1 has not affected the proliferation of cells (Fig. 3a and 3b). However, under doxorubicin treatment, overexpression of WT-CSNK2A1 attenuated the anti-proliferative effect of doxorubicin (Fig. 3a and 3b). Under doxorubicin treatment, the cellular proliferation of CSNK2A1-overexpressing cells was significantly higher than the cells transfected with empty vector (Fig. 3a and 3b). In contrast, knock-down of CSNK2A1 sensitized U2OS and KHOS/NP osteosarcoma cells to doxorubicin in the CCK8 assay and colony-forming assay (Fig. 3c and 3d). The proliferation of osteosarcoma cells that had a knock-down of CSNK2A1 was significantly lower compared with cells transfected with empty vector under treatment with doxorubicin (Fig. 3c and 3d).

CSNK2A1 induces resistance to doxorubicin-mediated apoptosis of osteosarcoma cells

When the U2OS and KHOS/NP osteosarcoma cells were treated with doxorubicin, the expression of cleaved PARP1, cleaved caspase 3, and BAX increased, and the expression of BCL2 decreased (Fig. 4a). Under of doxorubicin treatment of U2OS and KHOS/NP osteosarcoma cells, the expression levels of cleaved PARP1, cleaved caspase 3, and BAX increased, and the expression of BCL2 decreased with knock-down of CSNK2A1 (Fig. 4a). Overexpression of CSNK2A1 decreased the expression levels of cleaved PARP1, cleaved caspase 3, and BAX and increased the expression of BCL2 under doxorubicin treatment (Fig. 4a). In flow-cytometry apoptotic analysis, apoptosis of U2OS and KHOS/NP cells significantly increased with knock-down of CSNK2A1 compared with controls under treatment with doxorubicin (Fig. 4b).

CSNK2A1-mediated resistance to doxorubicin is associated with SIRT6 phosphorylation-mediated activation of the DNA damage repair pathway

When U2OS and KHOS/NP osteosarcoma cells were treated with doxorubicin, the expression of pSIRT6, pATM, pChk2, and γH2AX were increased (Fig. 5a). In addition, under treatment with doxorubicin in U2OS and KHOS/NP cells, knock-down of CSNK2A1 decreased the expression of pSIRT6, pATM, and pChk2, and overexpression of CSNK2A1 increased expression of pSIRT6, pATM, and pChk2 (Fig. 5a). The expression of γH2AX increased with the knock-down of CSNK2A1 and decreased with overexpression of CSNK2A1 (Fig. 5a). Based on the role of CSNK2A1 on the phosphorylation of SIRT6 on Ser338 [10] and the role of SIRT6 on the induction of the DNA damage repair pathway [21], we evaluated the effect of a mutation of the Ser338 phosphorylation site of SIRT6 on CSNK2A1-mediated activation of the DNA damage repair pathway triggered by treatment with doxorubicin. Overexpression of WT-CSNK2A1 or WT-CSNK2A1/WT-SIRT6 increased expression of pSIRT6, pATM, and pChk2, and decreased expression of γH2AX with doxorubicin treatment in KHOS/NP cells (Fig. 5b). However, despite overexpression of CSNK2A1, transfection of SIRT6-S338A mutant decreased expression of pSIRT6, pATM, and pChk2 that were induced by doxorubicin and overexpression of CSNK2A1 (Fig. 5b). In CCK8 and colony-forming assays, cells overexpressing WT-CSNK2A1 or WT-CSNK2A1/WT-SIRT6 were resistant to doxorubicin, and the resistance to doxorubicin was attenuated with transfection of SIRT6-S338A mutant (Fig. 5c and 5d). The number of cells and colonies were significantly decreased in the cells transfected with SIRT6-S338A mutant compared with the cells overexpressing WT-CSNK2A1 or WT-CSNK2A1/WT-SIRT6 under treatment with doxorubicin (Fig. 5c and 5d).

In an orthotopic xenograft model, the growth of tumor in vivo was significantly inhibited with doxorubicin treatment (4mg/kg, once a week, intraperitoneal injection) (Fig. 6a and 6b). However, the anti-tumor effect of doxorubicin was attenuated via overexpression of WT-CSNK2A1 or WT-CSNK2A1/WT-SIRT6 (Fig. 6a and 6b). The growth of tumors in vivo was significantly higher with overexpression of WT-CSNK2A1 or WT-CSNK2A1/WT-SIRT6 compared with transfection of empty vector under treatment with doxorubicin (Fig. 6a and 6b). The resistance to doxorubicin induced by overexpression of WT-CSNK2A1 and WT-SIRT6 was attenuated by mutation of SIRT6 on Ser338. In vivo tumor growth of KHOS/NP cells was also significantly decreased with transfection of SIRT6-S338A mutant compared with overexpression of WT-CSNK2A1 or WT-CSNK2A1/WT-SIRT6 (Fig. 6a and b, and 6c). Furthermore, pulmonary metastasis was significantly decreased in the KHOS/NP cells transfected SIRT6-S338A mutant (number of metastatic nodule per mouse: mean ± standard deviation, 0 ± 0) compared with cells with induced overexpression of WT-CSNK2A1 (number of metastatic nodule per mouse: mean ± standard deviation, 3.0 ± 1.2) or cells induced to overexpress WT-CSNK2A1/WT-SIRT6 (number of metastatic nodule per mouse: mean ± standard deviation, 3.5 ± 2.4) (Fig. 6d). There were no metastasis on the liver or kidney in all experimental groups.

Inhibition of CSNK2A1 with emodin potentiates the cytotoxic effects of doxorubicin

Based on the role of CSNK2A1 in resistance to doxorubicin, we evaluated the effects of emodin, a CSNK2A1 inhibitor, on osteosarcoma cells. Treatment with emodin inhibited proliferation of U2OS and KHOS/NP cells in a dose- and time-dependent manner (Fig. 7a). As shown in Fig. 3, knock-down or overexpression of CSNK2A1 did not affect the proliferation of osteosarcoma cells without doxorubicin treatment. However, in contrast, emodin showed significant anti-proliferative effects with 24 hours of treatment at a 0.4 mM concentration (Fig. 7a). Moreover, similar to when cells underwent a knock-down of CSNK2A1, 0.5 mM emodin treatment potentiated the cytotoxic effects of doxorubicin (Fig. 7b and 7c). Co-treatment with emodin and doxorubicin significantly inhibited proliferation of U2OS and KHOS/NP cells compared with treatment with either doxorubicin or emodin alone (Fig. 7b and 7c).

In this study, we demonstrated that the expression of CSNK2A1 was significantly associated with higher tumor stage and latent distant metastasis of osteosarcoma. In addition, CSNK2A1-positivity predicted shorter OS and RFS of osteosarcoma patients. Furthermore, in the sub-population of osteosarcoma patients who received postoperative chemotherapy, CSNK2A1 expression was significantly associated with shorter survival of patients. Consistently, the expression of CSNK2A1 was elevated in cancers compared with non-cancerous tissues in colorectum [4], head and neck [6], kidney [7, 8], prostate [9], and stomach [5]. In addition, the prognostic significance of CSNK2A1 in human cancer patients has been reported in various types of cancers such as breast cancer [10], clear cell renal cell carcinoma [8, 37], colon cancer [4, 38], gastric cancer [5], and prostatic cancer [9]. In clear cell renal cell carcinoma, higher expression of CSNK2A1 mRNA was associated with higher tumor stage, higher nuclear grade, presence of distant metastasis, and shorter OS [8]. In breast and gastric carcinomas, immunohistochemical expression of CSNK2A1 was an independent indicator of shorter OS and RFS of cancer patients [5, 10]. Specifically, with regards to the subcellular localization of CSNK2A1, its high expression in the nucleoli of breast cancer cells predicted shorter survival of patients in univariate and multivariate analysis [39]. These findings suggest that CSNK2A1 is important in the progression of human cancers and might be employed as a prognostic indicator of human cancers.

The molecular mechanisms and roles of CSNK2A1 in tumorigenesis were extensively investigated, and it has been shown that CSNK2A1 is involved in tumorigenesis by its roles as a kinase to activate oncogenic molecules and to stimulate degradation of tumor suppressors [3, 12, 40, 41]. Consequently, CSNK2A1 promotes the proliferation and invasiveness of cancer cells by activating cell cycle progression and the epithelial-to-mesenchymal transition (EMT) [4, 5, 10, 13]. CSNK2A1 engages the MYC [11], Akt [13, 14], and NFκB [12] pathways to stimulate the proliferation of cancer cells. In myeloid neoplasm, depletion of CSNK2A1inhibited cell cycle progression by elevating P27 [42]. CSNK2A1 also plays an important role in cancer invasiveness by activating the EMT pathway in colorectal cancer [4] and breast cancer [10]. In breast cancer cells, CSNK2A1 is involved in the EMT by regulating the Wnt/β-catenin pathway [10]. In gastric cancer cells, CSNK2A1 is involved in cancer progression by stimulating proliferation and invasiveness through phosphorylation of DBC1/CCAR2 [5] and the PI3K-Akt-mTOR pathway [43]. In addition, CSNK2A1 stimulates the degradation of the tumor suppressors PTEN [44] and P53 [40]. Moreover, CSNK2A1 renders cancer cells resist to apoptotic stresses by activating BCL2 and suppressing PML, FOXO3, and PARP1 [3, 10, 41]. However, the effect of CSNK2A1 on the proliferation of osteosarcoma cells has been controversially reported. A previous report showed that knock-down or inhibition of CSNK2A1 inhibits the proliferation of osteosarcoma cells [45]; however, in this study, knock-down or overexpression of CSNK2A1 did not influence on proliferation of U2OS and KHOS/NP cells. Therefore, a careful approach is needed to evaluate the possibility of CSNK2A1 as a potential therapeutic target of osteosarcoma based on the effect of CSNK2A1 in the proliferation of osteosarcoma cells.

An interesting finding of this study is that CSNK2A1-mediated phosphorylation of SIRT6 is important in the treatment efficacy of doxorubicin in osteosarcoma cells. Specifically, phosphorylation of SIRT6 on Ser338 was critical in CSNK2A1-mediated resistance to doxorubicin in vitro and in vivo. Concerning these results, when considering the molecular mechanism of CSNK2A1 in cancer to be used as a therapeutic target, the molecular network related to CSNK2A1 is complex because CSNK2A1 also might be protective for molecules that might have tumor-suppressive roles [10, 18]. CSNK2A1 phosphorylates SIRT6 on Ser338 [10]. However, there are controversial reports on the role of SIRT6 in tumorigenesis. With respect to a tumor-suppressive role of SIRT6, loss of SIRT6 stimulated progression of hepatocellular carcinoma [46], and lower expression of SIRT6 was associated with poor prognosis of breast cancer patients [23]. Furthermore, the role of SIRT6 on the induction of the DNA damage repair pathway strongly supports its role in the prevention of cancer development [47, 48]. However, despite these reports, there are also reports that higher expression of SIRT6 is closely associated with shorter survival of cancer patients and SIRT6 involved in the stimulation of molecules closely associated with cancer progression [10, 20, 21, 27, 49]. In addition, controversially, there were opposing reports on the role of SIRT6 in the same cancer type. The effect of SIRT6 on the proliferation of MDA-MB-231 breast cancer cells was the opposite in two studies [10, 23]. In a study using osteosarcoma cells, overexpression of SIRT6 inhibited proliferation and invasiveness of SAOS2 and MG-63 osteosarcoma cells [24]; however, the study used U2OS and KHOS/NP osteosarcoma cells, SIRT6 did not affect the proliferation of osteosarcoma cells despite chemo-sensitization with knock-down of SIRT6 [21]. Therefore, we conducted a more precise evaluation of the role of CSNK2A1-SIRT6 in human cancer, especially in osteosarcoma, and we showed that the phosphorylation status of SIRT6 on Ser338 is important in CSNK2A1-mediated chemoresistance in osteosarcoma cells.

In our results, knock-down of CSNK2A1 or inhibition of CSNK2A1 with emodin sensitized osteosarcoma cells to doxorubicin. Similarly, inhibition of CSNK2A1 with CX-4945 suppressed the proliferation of osteosarcoma cells [45] and Caki-2 clear cell renal cell carcinoma cells [37]. In addition, emodin potentiated the anti-cancer effect of cisplatin by inhibiting P-glycoprotein expression in non-small cell lung cancer cells [30]. In line with our results, the chemo-resistant phenotype of cancer cells was associated with higher expression of CK2, and inhibition of CK2 inhibited proliferation of cancer cell lines with chemoresistance [50]. The mechanism by which CSNK2A1 renders a resistance phenotype to cancer cells has been suggested to be by suppressing apoptotic signaling of cancer cells [3, 10, 41]. Concerning this mechanism, our results indicate that CSNK2A1 induces the DNA damage repair pathway by activation of SIRT6 through phosphorylation of SIRT6 on Ser338. As we previously reported that CSNK2A1 phosphorylates SIRT6 on Ser338 among the four phosphorylation sites of SIRT6 [10], expression of CSNK2A1 was associated with phosphorylation of SIRT6 on Ser338 on U2OS and KHOS/NP osteosarcoma cells. In addition, based on the role of SIRT6 in DNA damage repair, higher expression of SIRT6 was important in resistance to doxorubicin through activation of the DNA damage repair pathway [21]. Similarly, inhibition of SIRT6 sensitized diffuse large B-cell lymphoma cells on doxorubicin or bendamustine by suppressing the DNA damage repair pathway [49]. Therefore, in conjunction with previous reports and this study, it is suggested that CSNK2A1-mediated phosphorylation of SIRT6 on Ser338 is important to rescue injured cancer cells by repairing DNA damage induced by anti-cancer therapeutics. Therefore, both blocking of CSNK2A1 and SIRT6 or direct suppression of the DNA damage repair pathway might be promising therapeutic strategies to overcome cancer resistance to conventional genotoxic anti-cancer therapeutics. The FDA approves the use of inhibitors of the DNA damage repair pathway, such as PARP inhibitors, in cancers of the ovary and prostate (OncoKB database, https://www.oncokb.org, accessed June 10, 2021). In osteosarcoma cells, the PARP inhibitor olaparib also potentiated the cytotoxic effect of doxorubicin [27]. Therefore, when considering CSNK2A1-mediated resistance to doxorubicin as it relates to the DNA damage repair response, the use of PARP inhibitors also might be a potential therapeutic application in the treatment of poor prognostic osteosarcoma highly expressing CSNK2A1. However, there is a limitation to the use of inhibitors of PARP and SIRT6 in sarcomas, including osteosarcoma. In this study, we have shown that CSNK2A1 inhibitor emodin synergistically potentiates the cytotoxic effect of doxorubicin in osteosarcoma cells. Several additional chemicals inhibiting CSNK2A1 are under evaluation in human cancers [3, 29, 45, 50]. Therefore, blocking CSNK2A1 might be helpful to archive therapeutic efficacy in osteosarcoma highly expressing CSNK2A1 and/or SIRT6.

In this study, we present that CSNK2A1 might be used as an important prognostic indicator of osteosarcoma patients, especially for patients who received postoperative chemotherapy. Furthermore, we have shown that CSNK2A1 induces resistance to doxorubicin through SIRT6 phosphorylation-mediated activation of the DNA damage repair pathway in vitro and in vivo. Therefore, our results suggest that blocking of CSNK2A1-SIRT6-DNA damage repair pathway might be a promising therapeutic strategy for osteosarcoma patients, especially for the poor prognostic subpopulation of patients who have tumors highly expressing CSNK2A1.

95% CI (95% confidence interval), DMSO (dimethyl sulfoxide), CSNK2 (protein kinase CK2), EMT (epithelial-to-mesenchymal transition), HR (hazard ratio), OS (overall survival), RFS (relapse-free survival), TMA (tissue microarray), WT (wild-type), WT-CSNK2A1/WT-SIRT6 (transfection of wild-type CSNK2A1 and wild-type SIRT6).

Acknowledgments

We thank CB Kong (Department of Orthopedic Surgery, Korea Institute of Radiological and Medical Science) for providing KHOS/NP cells; Laszlo Gyenis (Department of

Biochemistry, University of Western Ontario, Canada) for providing the plasmid for wild-type CSNK2A1; DB Leveson-Gower who provided medical writing services; MK Kim (Department of Pathology, Jeonbuk National University Hospital) for technical support on immunohistochemical staining.

Funding

This work was supported by the National Research Foundation of Korea (NRF) funded by the Korean government (MSIP) (grant numbers 2017R1A5A2015061 and 2017R1E1A1A01074533).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Authors’ contributions

UKH, AGA, YS, SHP, KMK, YJM, ARA, HSP, SJA, JRK and KYJ participated in the study design. UKH, AGA, YS, SHP, KMK, YJM, ARA, HSP, SJA, JRK and KYJ performed the experiment. UKH, AGA, YS, SHP, KMK, YJM, ARA, HSP, SJA, JRK and KYJ were involved in data collection and data interpretation. UKH, AGA, YS, SHP, KMK, YJM, ARA, HSP, SJA, JRK and KYJ participated in the statistical analyses. UKH, AGA, YS, SHP, KMK, YJM, ARA, HSP, SJA, JRK and KYJ wrote the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

This study obtained institutional review board approval from Jeonbuk National University Hospital (IRB number, CUH 2020-10-011) and was performed according to the Declaration of Helsinki. Based on the retrospective and anonymous character of the study, the approval contained a waiver for written informed consent. All animal experiments were performed with the approval of the institutional animal care and use committee of Jeonbuk National University (approval number: JBNU 2021-032).

Consent for publication

Not applicable

Competing interests

The authors declare that they have no competing interests.

Meggio F, Pinna LA. One-thousand-and-one substrates of protein kinase CK2? FASEB J. 2003;17(3):349–68.
Canton DA, Litchfield DW. The shape of things to come: an emerging role for protein kinase CK2 in the regulation of cell morphology and the cytoskeleton. Cell Signal. 2006;18(3):267–75.
Ruzzene M, Pinna LA. Addiction to protein kinase CK2: a common denominator of diverse cancer cells? Biochim Biophys Acta. 2010;1804(3):499–504.
Zou J, Luo H, Zeng Q, Dong Z, Wu D, Liu L. Protein kinase CK2alpha is overexpressed in colorectal cancer and modulates cell proliferation and invasion via regulating EMT-related genes. J Transl Med. 2011;9:97.
Bae JS, Park SH, Kim KM, Kwon KS, Kim CY, Lee HK, Park BH, Park HS, Lee H, Moon WS, et al. CK2alpha phosphorylates DBC1 and is involved in the progression of gastric carcinoma and predicts poor survival of gastric carcinoma patients. Int J Cancer. 2015;136(4):797–809.
Faust RA, Gapany M, Tristani P, Davis A, Adams GL, Ahmed K. Elevated protein kinase CK2 activity in chromatin of head and neck tumors: association with malignant transformation. Cancer Lett. 1996;101(1):31–5.
Stalter G, Siemer S, Becht E, Ziegler M, Remberger K, Issinger OG. Asymmetric expression of protein kinase CK2 subunits in human kidney tumors. Biochem Biophys Res Commun. 1994;202(1):141–7.
Rabjerg M, Bjerregaard H, Halekoh U, Jensen BL, Walter S, Marcussen N. Molecular characterization of clear cell renal cell carcinoma identifies CSNK2A1, SPP1 and DEFB1 as promising novel prognostic markers. APMIS. 2016;124(5):372–83.
Laramas M, Pasquier D, Filhol O, Ringeisen F, Descotes JL, Cochet C. Nuclear localization of protein kinase CK2 catalytic subunit (CK2alpha) is associated with poor prognostic factors in human prostate cancer. Eur J Cancer. 2007;43(5):928–34.
Bae JS, Park SH, Jamiyandorj U, Kim KM, Noh SJ, Kim JR, Park HJ, Kwon KS, Jung SH, Park HS, et al. CK2alpha/CSNK2A1 Phosphorylates SIRT6 and Is Involved in the Progression of Breast Carcinoma and Predicts Shorter Survival of Diagnosed Patients. Am J Pathol. 2016;186(12):3297–315.
Bousset K, Oelgeschlager MH, Henriksson M, Schreek S, Burkhardt H, Litchfield DW, Luscher-Firzlaff JM, Luscher B. Regulation of transcription factors c-Myc, Max, and c-Myb by casein kinase II. Cell Mol Biol Res. 1994;40(5–6):501–11.
Chantome A, Pance A, Gauthier N, Vandroux D, Chenu J, Solary E, Jeannin JF, Reveneau S. Casein kinase II-mediated phosphorylation of NF-kappaB p65 subunit enhances inducible nitric-oxide synthase gene transcription in vivo. J Biol Chem. 2004;279(23):23953–60.
Di Maira G, Salvi M, Arrigoni G, Marin O, Sarno S, Brustolon F, Pinna LA, Ruzzene M. Protein kinase CK2 phosphorylates and upregulates Akt/PKB. Cell Death Differ. 2005;12(6):668–77.
Wu A, Li M, Mai Z, Li S, Yang Z. [CK2alpha Regulates the Metastases and Migration of Lung Adenocarcinoma A549 Cell Line through PI3K/Akt/GSK-3beta Signal Pathway]. Zhongguo Fei Ai Za Zhi. 2017;20(4):233–8.
Zschoernig B, Mahlknecht U. Carboxy-terminal phosphorylation of SIRT1 by protein kinase CK2. Biochem Biophys Res Commun. 2009;381(3):372–7.
Lombard DB, Schwer B, Alt FW, Mostoslavsky R. SIRT6 in DNA repair, metabolism and ageing. J Intern Med. 2008;263(2):128–41.
Mao Z, Hine C, Tian X, Van Meter M, Au M, Vaidya A, Seluanov A, Gorbunova V. SIRT6 promotes DNA repair under stress by activating PARP1. Science. 2011;332(6036):1443–6.
de Ceu Teixeira M, Sanchez-Lopez E, Espina M, Garcia ML, Durazzo A, Lucarini M, Novellino E, Souto SB, Santini A, Souto EB. Sirtuins and SIRT6 in Carcinogenesis and in Diet. Int J Mol Sci. 2019;20(19).
Shen X, Li P, Xu Y, Chen X, Sun H, Zhao Y, Liu M, Zhang W. Association of sirtuins with clinicopathological parameters and overall survival in gastric cancer. Oncotarget. 2017;8(43):74359–70.
Bai L, Lin G, Sun L, Liu Y, Huang X, Cao C, Guo Y, Xie C. Upregulation of SIRT6 predicts poor prognosis and promotes metastasis of non-small cell lung cancer via the ERK1/2/MMP9 pathway. Oncotarget. 2016;7(26):40377–86.
Zhang Z, Ha SH, Moon YJ, Hussein UK, Song Y, Kim KM, Park SH, Park HS, Park BH, Ahn AR, et al. Inhibition of SIRT6 potentiates the anti-tumor effect of doxorubicin through suppression of the DNA damage repair pathway in osteosarcoma. J Exp Clin Cancer Res. 2020;39(1):247.
Bae JS, Noh SJ, Kim KM, Park SH, Hussein UK, Park HS, Park BH, Ha SH, Lee H, Chung MJ, et al. SIRT6 Is Involved in the Progression of Ovarian Carcinomas via beta-Catenin-Mediated Epithelial to Mesenchymal Transition. Front Oncol. 2018;8:538.
Thirumurthi U, Shen J, Xia W, LaBaff AM, Wei Y, Li CW, Chang WC, Chen CH, Lin HK, Yu D, et al. MDM2-mediated degradation of SIRT6 phosphorylated by AKT1 promotes tumorigenesis and trastuzumab resistance in breast cancer. Sci Signal. 2014;7(336):ra71.
Gao Y, Qu Y, Zhou Q, Ma Y. SIRT6 inhibits proliferation and invasion in osteosarcoma cells by targeting N-cadherin. Oncol Lett. 2019;17(1):1237–44.
Board WCoTE. Soft tissue and bone tumours. 5th ed. Lyon (France): International Agency for Research on Cancer; 2020.
Gill J, Ahluwalia MK, Geller D, Gorlick R. New targets and approaches in osteosarcoma. Pharmacol Ther. 2013;137(1):89–99.
Park HJ, Bae JS, Kim KM, Moon YJ, Park SH, Ha SH, Hussein UK, Zhang Z, Park HS, Park BH, et al. The PARP inhibitor olaparib potentiates the effect of the DNA damaging agent doxorubicin in osteosarcoma. J Exp Clin Cancer Res. 2018;37(1):107.
Engert F, Kovac M, Baumhoer D, Nathrath M, Fulda S. Osteosarcoma cells with genetic signatures of BRCAness are susceptible to the PARP inhibitor talazoparib alone or in combination with chemotherapeutics. Oncotarget. 2017;8(30):48794–806.
D'Amore C, Borgo C, Sarno S, Salvi M. Role of CK2 inhibitor CX-4945 in anti-cancer combination therapy - potential clinical relevance. Cell Oncol (Dordr). 2020;43(6):1003–16.
Peng S, Wang J, Lu C, Xu Z, Chai JJ, Ke Q, Deng XZ. Emodin enhances cisplatin sensitivity in non-small cell lung cancer through Pgp downregulation. Oncol Lett. 2021;21(3):230.
Amin MB, American Joint Committee on Cancer. American Cancer Society. AJCC cancer staging manual. 8th ed. Chicago: American Joint Committee on Cancer, Springer;; 2017.
Allred D, Harvey JM, Berardo M, Clark GM. Prognostic and predictive factors in breast cancer by immunohistochemical analysis. Mod Pathol. 1998;11(2):155–68.
Hussein UK, Ha SH, Ahmed AG, Kim KM, Park SH, Kim CY, Kwon KS, Zhang Z, Lee SA, Park HS, et al. FAM83H and SCRIB stabilize beta-catenin and stimulate progression of gastric carcinoma. Aging. 2020;12(12):11812–34.
Kim KM, Hussein UK, Park SH, Moon YJ, Zhang Z, Ahmed AG, Ahn AR, Park HS, Kim JR, Jang KY. Expression of IL4Ralpha and IL13Ralpha1 are associated with poor prognosis of soft-tissue sarcoma of the extremities, superficial trunk, and retroperitoneum. Diagn Pathol. 2021;16(1):2.
Niyazi M, Niyazi I, Belka C. Counting colonies of clonogenic assays by using densitometric software. Radiat Oncol. 2007;2:4.
DeLong ER, DeLong DM, Clarke-Pearson DL. Comparing the areas under two or more correlated receiver operating characteristic curves: a nonparametric approach. Biometrics. 1988;44(3):837–45.
Rabjerg M, Guerra B, Olivan-Viguera A, Mikkelsen ML, Kohler R, Issinger OG, Marcussen N. Nuclear localization of the CK2alpha-subunit correlates with poor prognosis in clear cell renal cell carcinoma. Oncotarget. 2017;8(1):1613–27.
Lin KY, Tai C, Hsu JC, Li CF, Fang CL, Lai HC, Hseu YC, Lin YF, Uen YH. Overexpression of nuclear protein kinase CK2 alpha catalytic subunit (CK2alpha) as a poor prognosticator in human colorectal cancer. PLoS One. 2011;6(2):e17193.
Homma MK, Kiko Y, Hashimoto Y, Nagatsuka M, Katagata N, Masui S, Homma Y, Nomizu T. Intracellular localization of CK2alpha as a prognostic factor in invasive breast carcinomas. Cancer Sci. 2021;112(2):619–28.
Kim JS, Eom JI, Cheong JW, Choi AJ, Lee JK, Yang WI, Min YH. Protein kinase CK2alpha as an unfavorable prognostic marker and novel therapeutic target in acute myeloid leukemia. Clin Cancer Res. 2007;13(3):1019–28.
Scaglioni PP, Yung TM, Cai LF, Erdjument-Bromage H, Kaufman AJ, Singh B, Teruya-Feldstein J, Tempst P, Pandolfi PP. A CK2-dependent mechanism for degradation of the PML tumor suppressor. Cell. 2006;126(2):269–83.
Guerra B, Dembic M, Siddiqui MA, Dominguez I, Ceppi P, Andresen BS. Down-Regulation of CK2alpha Leads toUp-Regulation of the Cyclin-Dependent Kinase Inhibitor p27(KIP1) in Conditions Unfavorable for the Growth of Myoblast Cells. Cell Physiol Biochem. 2020;54(6):1177–98.
Jiang C, Ma Z, Zhang G, Yang X, Du Q, Wang W. CSNK2A1 Promotes Gastric Cancer Invasion Through the PI3K-Akt-mTOR Signaling Pathway. Cancer Manag Res. 2019;11:10135–43.
Al-Khouri AM, Ma Y, Togo SH, Williams S, Mustelin T. Cooperative phosphorylation of the tumor suppressor phosphatase and tensin homologue (PTEN) by casein kinases and glycogen synthase kinase 3beta. J Biol Chem. 2005;280(42):35195–202.
Takahashi K, Setoguchi T, Tsuru A, Saitoh Y, Nagano S, Ishidou Y, Maeda S, Furukawa T, Komiya S. Inhibition of casein kinase 2 prevents growth of human osteosarcoma. Oncol Rep. 2017;37(2):1141–7.
Marquardt JU, Fischer K, Baus K, Kashyap A, Ma S, Krupp M, Linke M, Teufel A, Zechner U, Strand D, et al. Sirtuin-6-dependent genetic and epigenetic alterations are associated with poor clinical outcome in hepatocellular carcinoma patients. Hepatology. 2013;58(3):1054–64.
Cea M, Cagnetta A, Adamia S, Acharya C, Tai YT, Fulciniti M, Ohguchi H, Munshi A, Acharya P, Bhasin MK, et al. Evidence for a role of the histone deacetylase SIRT6 in DNA damage response of multiple myeloma cells. Blood. 2016;127(9):1138–50.
Onn L, Portillo M, Ilic S, Cleitman G, Stein D, Kaluski S, Shirat I, Slobodnik Z, Einav M, Erdel F, et al. SIRT6 is a DNA double-strand break sensor. Elife. 2020;9.
Yang J, Li Y, Zhang Y, Fang X, Chen N, Zhou X, Wang X. Sirt6 promotes tumorigenesis and drug resistance of diffuse large B-cell lymphoma by mediating PI3K/Akt signaling. J Exp Clin Cancer Res. 2020;39(1):142.
Di Maira G, Brustolon F, Tosoni K, Belli S, Kramer SD, Pinna LA, Ruzzene M. Comparative analysis of CK2 expression and function in tumor cell lines displaying sensitivity vs. resistance to chemical induced apoptosis. Mol Cell Biochem. 2008;316(1–2):155–61.

Download PDF

Journal Publication

published 13 Jul, 2021

Read the published version in Cells →

Version 1

posted

You are reading this latest preprint version

CK2α/CSNK2A1 Induces Resistance to Doxorubicin Through SIRT6 Mediated Activation of the DNA Damage Repair Pathway

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Methods

Osteosarcoma specimens and immunohistochemical evaluation of CSNK2A1

Osteosarcoma cells, chemicals, and transfection

Cell proliferation assay and colony-forming assay

Western blot analysis

Flow cytometry analysis for apoptosis

Orthotopic xenograft model

Statistical analysis

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Journal Publication

Version 1