Metabolic Engineering of the Methylotrophic Yeast Pichia Pastoris (Komagataella phaffii) for the Production of Β-alanine From Methanol

doi:10.21203/rs.3.rs-651971/v1

Download PDF

Research

Metabolic Engineering of the Methylotrophic Yeast Pichia Pastoris (Komagataella phaffii) for the Production of Β-alanine From Methanol

https://doi.org/10.21203/rs.3.rs-651971/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

β-Alanine (3-aminopropionic acid), is the only naturally occurring β-amino acid and an important precursor for the synthesis of a variety of nitrogen-containing chemicals. Fermentative production of β-alanine from renewable feedstocks such as glucose has attracted significant interest in recent years. Methanol has become an emerging and promising renewable feedstock for biomanufacturing as an alternative to glucose. In this work, we demonstrated the feasibility of β-alanine production from methanol using Pichia pastoris (Komagataella phaffii) as a methylotrophic cell factory. Aspartate decarboxylases (ADCs) from different sources were screened and expressed in P. pastoris, followed by the optimization of aspartate decarboxylation by increasing the ADC copy number and C4 precursor supply via the overexpression of aspartate dehydrogenase. The production potential of the best strain was further evaluated in a 1-liter fermenter, and a β-alanine titer of 5.6 g/L was obtained. To our best knowledge, this is the highest chemical production titer ever reached in P. pastoris using methanol as the substrate.

Biotechnology and Bioengineering

Pichia pastoris (Komagataella phaffii)

β-alanine (3-aminopropionic acid)

methanol

aspartate decarboxylation

aspartate dehydrogenase

β-Alanine (3-aminopropionic acid) is a naturally occurring β-amino acid that serves as a precursor for the biosynthesis of a variety of nitrogen-containing chemicals, such as D-pantothenic acid (vitamin B5) (Tigu et al. 2018), coenzyme A (CoA) (Tomita et al. 2014), carnosine (Harris et al. 2006; Sale et al. 2010), and poly-alanine (nylon-3) (Steunenberg et al. 2013). β-Alanine can be chemically synthesized via the ammonification of acrylonitrile (Carlson 1943), hydroxylation of β-aminopropionitrile in the presence of barium hydroxide (Ford 1945), or the reaction of acrylic acid with ammonium carbonate and CO₂(Ohara et al. 2011). However, these chemical synthesis routes are not sustainable due to the use of non-renewable substrates and harsh reaction conditions, and biological processes for β-alanine synthesis have gained increasing interest.

Biological production of β-alanine is achieved through biotransformation or fermentation. In the biotransformation route, β-alanine can be directly synthesized from L-aspartic acid via decarboxylation by L-aspartate-α-decarboxylase (ADC, EC: 4.1.1.11) (Li et al. 2018; Pei et al. 2017; Shen et al. 2014), or indirectly synthesized from fumaric acid as a cheaper substrate, via the consecutive action of aspartate ammonia-lyase (AspA, EC 4.3.1.1) and ADC (Qian et al. 2018; Wang et al. 2020). Although a very high β-alanine titer (up to 200 g/L) has been reached with whole-cell transformation, the process is not entirely sustainable due to the use of expensive precursors or petrochemicals (i.e., L-aspartic acid or fumaric acid) as substrates. Consequently, the fermentation route has been pursued to synthesize β-alanine from renewable feedstocks. The fermentative production of β-alanine from glucose has been described in several reports on the metabolic engineering of Escherichia coli, and promising β-alanine titers ranging from 32.3 to 43.12 g/L were obtained in these studies (Piao et al. 2019; Song et al. 2015; Zou et al. 2020).

Although glucose is the most widely used raw material for the production of biochemicals, the exploration of alternative feedstocks has remained a central task in the research on biomanufacturing (Liu et al. 2021). Methanol is considered one of the most promising feedstocks due to its unique advantages such as providing highly reduced carbon, not competing with food sources, and potentially sustainable production in the future (Zhu et al. 2020). Consequently, there is an emerging trend of utilizing methanol as an alternative feedstock for chemical production using natural or synthetic methylotrophs (Guo et al. 2021; Jin et al. 2021; Tuyishime et al. 2018; Whitaker et al. 2017; Zhu et al. 2016).

In this work, we aimed to achieve the production of β-alanine from methanol using Pichia pastoris (Komagataella phaffii) as the methylotrophic cell chassis (Fig. 1). ADCs from different sources were screened and expressed in P. pastoris, followed by the optimization of aspartate decarboxylation and C4 precursor supply, and the best strain reached a β-alanine titer of 5.6 g/L. To our best knowledge, this is the first report demonstrating the feasibility of using P. pastoris as the chassis for the production of amino acids from methanol.

Strains, media, and growth conditions

The primers, strains and plasmids used in this study are listed in Table 1 and Table 2. For E. coli strain construction, the cells were cultured aerobically at 37 °C in Luria broth (10 g/L tryptone, 5 g/L yeast extract, and 10 g/L NaCl). For the construction of P. pastoris strains, YPD (20 g/L peptone, 10 g/L yeast extract and 20 g/L glucose) or MD (20 g/L glucose, 13.4 g/L yeast nitrogen base, 0.4 mg/L biotin) medium was used, and the cells were cultured aerobically at 30 °C. Kanamycin (50 mg/L), G418 (200 mg/L), zeocin (50 mg/L) or hygromycin (50 mg/L) was added where appropriate.

Construction of recombinant plasmids

The P. pastoris HIS4 gene was amplified by PCR from pAO and ligated into the BamHI site of pPICZA to generate the expression vector pMPICZHis. The zeocin resistance marker of pMPICZHis was replaced with the kanamycin or hygromycin resistance gene using a Gibson assembly strategy to yield the expression vectors pMPICKmHis and pMPIC2H, respectively. The panD genes from B. paralicheniformis ATCC 9945a, B. subtilis, S. griseorubiginosus, and C. glutamicum, the aspDH genes from Ochrobactrum anthropi ATCC 4918 and Serratia proteamaculans, as well as the gene encoding cysteine sulfinic acid decarboxylase from T. castaneum were codon optimized, synthesized and subcloned into pMPICZHis between the BstBI and NotI sites. The genes encoding cytosolic and mitochondrial aspartate aminotransferases were PCR amplified from genomic DNA of P. pastoris GS115 and cloned into pMPICKHis between the BstBI and NotI sites. The ppc and pck genes from E. coli, as well as the pck gene from Actinobacillus succinogenes were PCR amplified and cloned into pMPICKmHis between the BstBI and NotI sites.

A previously described multi-copy plasmid construction method (Yu et al. 2020a) was applied for the construction of the 2-, or 3-gene co-expression plasmids. The pMPICZHis-gene plasmid was double-digested with SphI and BamHI to generate the expression cassette, which was then inserted between the SphI and BglII sites of pMPICZHis-gene to create pMPICZHis-2genes. Similarly, the gene cassette was reinserted between the SphI and BglII sites of pMPICZHis-2genes to create pMPICZHis-3genes.

Construction of recombinant strains

The KU70 gene of the wild-type P. pastoris strain GS115 was deleted using the Cre-LoxP method to improve the homologous recombination efficiency (Guo et al. 2021; Weninger et al. 2018). The expression vectors pMPICZHis-bliPanD, pMPICZHis-bsPanD, pMPICZHis-sgePanD, pMPICZHis-cguPanD, pMPICZHis-TcCSADC, pMPICZHis-ADC-Oan, pMPICZHis-ADC-Spe, pMPICZHis-2ADC, and pMPICZHis-2ADC-Spe were linearized with BspEI and used to transform the Δku70 strain by electroporation. Positive transformants were screened on MD plates and named BliADC, BsADC, SgeADC, CguADC, TcCSADC, ADC-Oan, ADC-Spe, 2ADC and 2ADC-Spe, respectively. The expression vectors pMPICKmHis-AAT1 and pMPICKmHis-AAT2 were linearized using BspEI and used to transform the BsADC strain to generate ADC-AAT1 and ADC-AAT2, respectively. The expression vectors pMPIC2H-PPC, pMPIC2H-AsPCK, and pMPIC2H-PCK were linearized with BspEI, StuI and SspI, respectively, and used to transform the strain 2ADC-Spe, yielding the recombinant strains PPC, AsPCK and PCK, respectively.

β-Alanine production in shake-ﬂask fermentations

The strains were precultured in YPD medium and transferred to 25 mL of BMMY medium (20 g/L peptone, 10 g/L yeast extract, 13.4 g/L YNB, 0.4 mg/L biotin, 8.7 g/L monobasic potassium phosphate, pH 6.0) in 250 mL bafﬂed shake ﬂasks and cultured at 30 °C and 220 rpm. Recombinant gene expression was induced by adding 200 μl of pure methanol to each ﬂask, followed by feeding with 200 µl of methanol at 12 h intervals.

β-Alanine production by fed-batch fermentation in a 1-liter fermenter

The strains were first grown in 50 mL YPD for 36 h and transferred into 1-liter stirred tank reactors (Infors, Switzerland) containing 0.8 L of BMGY (20 g/L peptone,10 g/L yeast extract, 13.4 g/L YNB, 0.4 mg/L biotin, 8.7 g/L monobasic potassium phosphate, 40 g/L glycerol, pH 6.0) supplemented with 4.0 mL PTM1 trace salts (6 g/L CuSO₄⋅5H₂O, 0.09 g/L KI, 3 g/L MnSO₄⋅H₂O, 0.02 g/L H₃BO₃, 0.2 g/L MoNa₂O₄⋅2H₂O, 0.5 g/L CoCl₂, 20 g/L ZnCl₂, 65 g/L FeSO₄⋅7H₂O, 0.2 g/L biotin, 5.0 mL/L H₂SO₄). The temperature was set to 30 °C, the pH was controlled at 6.0 by adding NH₃⋅H₂O (28%, v/v), the dissolved oxygen concentration was kept above 20% of the atmospheric value by varying the air flow rate between 0.5 and 2 L/min. The entire cultivation started with a batch phase lasting for 20−24 h. Heterologous gene expression was induced by the addition of 0.25% (v/v) methanol, and the methanol concentration was maintained at 3 g/L throughout the entire fermentation span using an automatic methanol control station (FC2002, East China University of Science and Technology, Shanghai, China).

Analytical methods

The cell growth was analyzed by measuring the optical density at 600 nm. β-Alanine production was measured by high-performance liquid chromatography (HPLC) with a variable wavelength detector (VWD) set to 334 nm and an Agilent ZRABOX SB-C18 column (4.6 mm × 250 mm, 5 μm) after centrifugation of the fermentation samples and o-phthalaldehyde (OPA) derivatization (Pei et al. 2017). The mobile phase consisted of 35 mM sodium acetate (pH 7.5) containing 30% methanol with a flow rate of 1 mL/min.

Overexpression of aspartate-α-decarboxylases (ADCs) from different sources for the production of β-alanine and tolerance of the P. pastoris chassis to β-alanine

Since aspartate is the direct precursor for β-alanine synthesis via decarboxylation by ADCs, and was reported to have one of the largest precursor pool sizes among all amino acids in P. pastoris (Carnicer et al. 2012), we hypothesized that overexpression of the ADC gene would lead to the accumulation of β-alanine. Four genes encoding aspartate-α-decarboxylase from B. paralicheniformis, B. subtilis, S. griseorubiginosus, C. glutamicum, as well as the gene encoding cysteine sulfinic acid decarboxylase from T. castaneum, which was reported to possess higher decarboxylation activity than ADCs, were evaluated in this work. The coding sequences were individually placed under the control of the strong AOX1 promoters and integrated into the genome of P. pastoris. In order to increase the efficiency of homologous recombination (HR), the KU70 mutant strain (Δku70) which has impaired nonhomologous end joining (NHEJ) was used as a parent strain (Guo et al. 2021; Weninger et al. 2018). The individual overexpression of ADCs from B. paralicheniformis, B. subtilis and C. glutamicum enabled the accumulation of β-alanine after 6 d of fermentation when feeding the strains with methanol (Fig. 2). The highest titer (658.9 mg/L) was reached by the recombinant strain expressing B. subtilis ADC (BsADC) (Fig. 2), and BsADC was used as the starting strain for further metabolic engineering. To investigate whether the tolerance to β-alanine was a limiting factor for β-alanine production, P. pastoris was cultivated in media supplemented with different concentrations of β-alanine. The results showed that yeast cell growth was substantially reduced only in the presence of 80 g/L of β-alanine (Fig. 3).

Overexpression of aspartate transferase (AAT) or aspartate dehydrogenase (AspDH) to increase aspartate supply for improved β-alanine synthesis

The conversion of oxaloacetate (OAA) into aspartate can be achieved by the transfer of an amino group from glutamate catalyzed by aspartate aminotransferase (AAT), or direct amination with ammonium as the amino group donor catalyzed by aspartate dehydrogenase (AspDH). P. pastoris possesses a mitochondrial AAT (encoded by AAT1) and a cytosolic AAT (AAT2), and both genes were cloned into the AOX1 vector and tested for their effects on β-alanine synthesis, respectively. In a previous paper, we reported that an AspDH from S. proteamaculans has high activity and stability (Li et al. 2017a). Thus, the SpeAspDH was also overexpressed in recombinant P. pastoris using the same strategy as AAT1 and AAT2. The shake-flask fermentation results showed that while neither AAT1 or AAT2 significantly improved β-alanine synthesis, the β-alanine titer was increased by 19.6% (to 787.9 mg/L) by overexpressing SpeAspDH (Fig. 4).

Further improvement of β-alanine production by increasing the ADC copy number

After optimization of the aspartate precursor supply, we investigated whether aspartate decarboxylation is a potential bottleneck for β-alanine production by increasing the copy number of the encoding gene. Vectors harboring two copies of the ADC expression cassette alone and together with the SpeAspDH expression cassette were introduced into the Δku70 strain, resulting in the recombinant strains 2ADC and 2ADC-Spe, respectively. The multi-copy strains 2ADC and 2ADC-Spe exhibited 53.9 and 52.6% increases of β-alanine production compared with their respective single-copy counterparts, ADC and ADC-Spe (Fig. 5). However, the cell growth of 2ADC and 2ADC-Spe was significantly slower than that of the wild-type strain, illustrating the negative effects of ADC overexpression on the physiology of yeast cells.

Effect of strengthening phosphoenolpyruvate (PEP) carboxylation on β-alanine production

A number of studies showed that CO₂ fixation-based carboxylation of C3 metabolites plays an important role in the synthesis of C4 precursors (Tan et al. 2013). Therefore, the effect of strengthening PEP carboxylation on C4 precursor supply and thereby β-alanine synthesis was further investigated. Since PEP can be converted into OAA by either PEP carboxylase (PPC) or PEP carboxykinase (PCK), the encoding ppc and pck genes from E. coli, as well as pck from A. succinogenes (Hu et al. 2018) were individually overexpressed in 2ADC-Spe to evaluate their impact on β-alanine production in shake-flask fermentations. However, only a marginal (6.7%) increase of the β-alanine titer was observed in the ppc overexpressed strain compared to the control (2ADC-Spe), while both PCKs from A. succinogenes and E. coli decreased the β-alanine titer (by 13.2 and 7.5%, respectively) (Fig. 6).

Fed-batch fermentation to improve β-alanine production

In order to obtain a higher β-alanine titer, fed-batch fermentation of the 2ADC-Spe strain was performed in a 1 L fermenter using a two-stage strategy. The fermentation was started with a glycerol phase (40 g/L glycerol) to facilitate biomass accumulation. When the glycerol was depleted and an OD₆₀₀ of approximately 80 was reached, the methanol phase was induced by maintaining the methanol concentration at 3 g/L using an on-line methanol analyzer. β-Alanine accumulation began in the methanol phase, and the highest β-alanine titer reached 5.6 g/L (Fig. 7). However, the yeast cells grew very slowly during the entire methanol phase and the biomass only reached an OD₆₀₀ of 123 after 106 h (Fig. 7), corresponding to an average specific growth rate of 0.0044 h^-1.

Pichia pastoris is one of the most widely used eukaryotic expression systems for heterologous proteins, and in recent years, its potential as a cell factory for the production of chemicals is also receiving increasing attention (Zhu et al. 2019). As a native methylotroph, P. pastoris has unique advantages over S. cerevisiae and E. coli when methanol is used as a feedstock. Nevertheless, it is still challenging to engineer P. pastoris for the production of chemicals, largely because as a Crabtree-negative yeast, P. pastoris tends to accumulate biomass rather than produce metabolites. Reports on metabolite production in fermentations of engineered P. pastoris mainly remain at the proof-of-concept stage, with titers usually lower than 1 g/L, especially when methanol is used as substrate (Gao et al. 2021). Several recent studies reported gram per liter metabolites production in shake flasks, with examples including isobutanol (Siripong et al. 2020; Siripong et al. 2018), malic acid (Guo et al. 2021), and D-lactic acid (Yamada et al. 2019). Unfortunately, the chemicals production potential of these recombinant P. pastoris strains was not fully evaluated by cultivation on the fermenter scale. In this study, we achieved a β-alanine titer of 1.7 g/L in shake flasks, and the production of the strain was further evaluated in a 1-liter fermenter using a two-stage strategy with a high initial biomass. Finally, 5.6 g/L of β-alanine titer was obtained, which is the highest chemical production titer ever reached in P. pastoris using methanol as the substrate.

Aspartate decarboxylation is the most important step of β-alanine synthesis. Although ADCs from different sources have been evaluated for β-alanine synthesis in E. coli (Feng et al. 2019; Liu et al. 2019; Pei et al. 2017; Song et al. 2015), the protein expression levels and enzyme activities of these ADCs may be different in eukaryotic hosts such as P. pastoris. Accordingly, we evaluated bacterial ADCs from different sources, including ones known to function well in E. coli such as the ADCs from C. glutamicum (Song et al. 2015) and B. subtilis (Pei et al. 2017), as well as the recently reported insect TcCSADC, which is reported to be a dimer that is resistant to turnover-dependent inactivation observed in ADCs from prokaryotes (Liu et al. 2019; Yu et al. 2020b). Only ADCs from Bacillus spp. exhibited high activity in the P. pastoris system, and the mere expression of B. subtilis ADC resulted in an initial success in β-alanine accumulation. Moreover, we showed that β-alanine production can be remarkably improved by doubling the ADC copy number, indicating that even with the strong AOX1 promoter, the decarboxylation of aspartate still remains the bottleneck for β-alanine synthesis. Increasing the copy number of the target gene is a widely used strategy in recombinant protein expression in P. pastoris (Yu et al. 2020a). Our work suggested that this strategy is still important in tuning metabolic pathways for chemical synthesis.

Increasing the aspartate supply is also crucial for achieving high β-alanine production. To this end, two strategies were applied. First, we aimed at increasing the conversion of OAA into aspartate by screening for appropriate enzymes for reductive amination. Although the overexpression of aspartate aminotransferase (AAT) was widely used to increase aspartate flux for the production of aspartate family amino acids (AFAAs) in industrial microbes such as C. glutamicum and E. coli (Li et al. 2017; Piao et al. 2019), the efficacy of AspDH overexpression for enhancing AFAAs production was rarely. The present study demonstrates that the overexpression of SpeAspDH can significantly increase β-alanine production, corroborating the potential of AspDHs for the production of AFAAs. The second strategy is to increase OAA supply by strengthening C3 carboxylation. PPC exhibits high affinity for bicarbonate and high catalytic velocity in the carboxylation of PEP, but the energy contained in PEP is lost in this reaction with the release of inorganic phosphate. Conversely, PCK can conserve the high energy of PEP, leading to net production of ATP for growth and cell maintenance, but it has low affinity for bicarbonate and relatively low catalytic velocity (Tan et al. 2013). In this study, the overexpression of EcPPC only led to a slight increase of the β-alanine titer, and pck overexpression even decreased β-alanine production, suggesting that OAA supply may not be the bottleneck for β-alanine synthesis at the current stage, and there might be other rate-limiting factors that should be resolved in future studies.

Another noteworthy phenomenon observed this work is that the growth of the cells was remarkably decreased, especially for strains harboring two copies of ADC. After shifting to the methanol phase in the fermenter, the yeast cells grew very slowly, with an average specific growth rate of 0.0044 h^-1, which was an order of magnitude lower than that of the wild-type strain under the same conditions (usually more than 0.04 h^-1). The impaired cell growth of the ADC-expressing strain is less likely caused by product inhibition, because the β-alanine titer far below its inhibitory concentration. Nevertheless, this phenomenon is not quite unexpected because as an important metabolic intermediate, aspartate takes part in many biological processes, such as the synthesis of AFAAs (Li et al. 2017b; Park and Lee 2010), protecting microbes against acid stress (Wu et al. 2013), shuttling of redox equivalents (Bakker et al. 2001), etc., and depletion of aspartate for β-alanine synthesis may cause severe perturbations of the normal physiology of yeast cells. The underlying mechanism is currently under investigation using omics approaches.

Recombinant P. pastoris strains were constructed for the production of β-alanine from methanol by screening and overexpressing ADCs from different sources. The β-alanine titer was further increased by increasing ADC copy number and overexpression of AspDH and PPC. The production potential of the best producing strain was evaluated on 1-liter fermenter and 5.6 g/L of β-alanine titer was obtained, which is highest chemical production titer ever reached in P. pastoris using methanol as the substrate. This work is the first attempt to produce amino acids from methanol using recombinant P. pastoris as the cell chassis.

ADC: aspartate-α-decarboxylases

AspA: aspartate ammonia-lyase

AAT: aspartate transferase

AspDH: aspartate dehydrogenase

HR: homologous recombination

NHEJ: nonhomologous end joining

OAA: oxaloacetate

PEP: phosphoenolpyruvate

PPC: PEP carboxylase

PCK: PEP carboxykinase

AFAAs: aspartate family amino acids

Acknowledgements

Not applicable.

Funding

This work was supported by the National Key R&D Program of China (2018YFA0901400) and the National Natural Science Foundation of China (No. 31970039)

Author information

Affiliations

CAS Key Laboratory of Microbial Physiological and Metabolic Engineering, State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, People’s Republic of China

Liangtian Miao, Yin Li & Taicheng Zhu

University of Chinese Academy of Sciences, Beijing 100049, People’s Republic of China

Liangtian Miao

Contributions

TCZ and YL conceived the study and revised the manuscript. LTM designed and carried out the experiments, and drafted the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Yin Li & Taicheng Zhu

Availability of data and materials

All data generated or analyzed during this study are included in this article.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

All authors approved the consent for publishing the manuscript to Bioresources and Bioprocessing.

Competing interests

The authors declare that they have no competing interests.

Bakker BM, Overkamp KM, van Maris AJ, Kötter P, Luttik MA, van Dijken JP, Pronk JT (2001) Stoichiometry and compartmentation of NADH metabolism in Saccharomyces cerevisiae. FEMS Microbiol Rev 25(1):15-37. https://doi.org/10.1111/j.1574-6976.2001.tb00570.x

Carlson GH (1943) Preparation of beta-alanine. US Patents 2,336,067, 7 Dec. 1943.

Carnicer M, Canelas AB, Ten Pierick A, Zeng Z, van Dam J, Albiol J, Ferrer P, Heijnen JJ, van Gulik W (2012) Development of quantitative metabolomics for Pichia pastoris. Metabolomics 8(2):284-298. https://doi.org/10.1007/s11306-011-0308-1

Feng Z, Zhang J, Chen G, Ge Y, Zhang X, Zhu H (2019) Extracellular Expression of L-aspartate-alpha-decarboxylase from Bacillus tequilensis and its application in the biosynthesis of beta-alanine. Appl Biochem Biotechnol 189(1):273-283. https://doi.org/10.1007/s12010-019-03013-1

Ford JH (1945) The alkaline hydrolysis of β-aminopropionitrile. Journal of the American Chemical Society 67(5):876-877. https://doi.org/10.1021/ja01221a503

Gao J, Jiang L, Lian J (2021) Development of synthetic biology tools to engineer Pichia pastoris as a chassis for the production of natural products. Synth Syst Biotechnol 6(2):110-119. https://doi.org/10.1016/j.synbio.2021.04.005

Guo F, Dai Z, Peng W, Zhang S, Zhou J, Ma J, Dong W, Xin F, Zhang W, Jiang M (2021) Metabolic engineering of Pichia pastoris for malic acid production from methanol. Biotechnol Bioeng 118(1):357-371. https://doi.org/10.1002/bit.27575

Harris RC, Tallon MJ, Dunnett M, Boobis L, Coakley J, Kim HJ, Fallowfield JL, Hill CA, Sale C, Wise JA (2006) The absorption of orally supplied beta-alanine and its effect on muscle carnosine synthesis in human vastus lateralis. Amino Acids 30(3):279-89. https://doi.org/10.1007/s00726-006-0299-9

Hu G, Zhou J, Chen X, Qian Y, Gao C, Guo L, Xu P, Chen W, Chen J, Li Y, Liu L (2018) Engineering synergetic CO₂-fixing pathways for malate production. Metab Eng 47:496-504. https://doi.org/10.1016/j.ymben.2018.05.007

Jin X, Zhang W, Wang Y, Sheng J, Xu R, Li J, Du G, Kang Z (2021) Biosynthesis of non-animal chondroitin sulfate from methanol using genetically engineered Pichia pastoris. Green Chemistry. https://doi.org/10.1039/d1gc00260k

Li H, Lu X, Chen K, Yang J, Zhang A, Wang X, Ouyang P (2018) β-alanine production using whole-cell biocatalysts in recombinant Escherichia coli. Molecular Catalysis 449:93-98. https://doi.org/10.1016/j.mcat.2018.02.008

Li H, Zhu T, Miao L, Zhang D, Li Y, Li Q, Li Y (2017a) Discovery of novel highly active and stable aspartate dehydrogenases. Sci Rep 7(1):7881. https://doi.org/10.1038/s41598-017-05522-7

Li Y, Wei H, Wang T, Xu Q, Zhang C, Fan X, Ma Q, Chen N, Xie X (2017b) Current status on metabolic engineering for the production of l-aspartate family amino acids and derivatives. Bioresour Technol 245(Pt B):1588-1602. https://doi.org/10.1016/j.biortech.2017.05.145

Liu Y, Cruz-Morales P, Zargar A, Belcher MS, Pang B, Englund E, Dan Q, Yin K, Keasling JD (2021) Biofuels for a sustainable future. Cell 184(6):1636-1647. https://doi.org/10.1016/j.cell.2021.01.052

Liu Z, Zheng W, Ye W, Wang C, Gao Y, Cui W, Zhou Z (2019) Characterization of cysteine sulfinic acid decarboxylase from Tribolium castaneum and its application in the production of beta-alanine. Appl Microbiol Biotechnol 103(23-24):9443-9453. https://doi.org/10.1007/s00253-019-10139-z

Ohara T, Sato T, Shimizu N, Prescher G, Schwind H, Weiberg O, Marten K, Greim H (2011) Acrylic Acid and Derivatives Ullmann's Encyclopedia of Industrial Chemistry.

Park JH, Lee SY (2010) Metabolic pathways and fermentative production of L-aspartate family amino acids. Biotechnol J 5(6):560-77. https://doi.org/10.1002/biot.201000032

Pei W, Zhang J, Deng S, Tigu F, Li Y, Li Q, Cai Z, Li Y (2017) Molecular engineering of L-aspartate-alpha-decarboxylase for improved activity and catalytic stability. Appl Microbiol Biotechnol 101(15):6015-6021. https://doi.org/10.1007/s00253-017-8337-y

Piao X, Wang L, Lin B, Chen H, Liu W, Tao Y (2019) Metabolic engineering of Escherichia coli for production of L-aspartate and its derivative beta-alanine with high stoichiometric yield. Metab Eng 54:244-254. https://doi.org/10.1016/j.ymben.2019.04.012

Qian Y, Liu J, Song W, Chen X, Luo Q, Liu L (2018) Production of β‐alanine from fumaric acid using a dual‐enzyme cascade. ChemCatChem 10(21):4984-4991. https://doi.org/10.1002/cctc.201801050

Sale C, Saunders B, Harris RC (2010) Effect of beta-alanine supplementation on muscle carnosine concentrations and exercise performance. Amino Acids 39(2):321-33. https://doi.org/10.1007/s00726-009-0443-4

Shen Y, Zhao L, Li Y, Zhang L, Shi G (2014) Synthesis of β-alanine from l-aspartate using l-aspartate-α-decarboxylase from Corynebacterium glutamicum. Biotechnology Letters 36(8):1681-1686. https://doi.org/10.1007/s10529-014-1527-0

Siripong W, Angela C, Tanapongpipat S, Runguphan W (2020) Metabolic engineering of Pichia pastoris for production of isopentanol (3-Methyl-1-butanol). Enzyme and Microbial Technology 138:109557. https://doi.org/10.1016/j.enzmictec.2020.109557

Siripong W, Wolf P, Kusumoputri TP, Downes JJ, Kocharin K, Tanapongpipat S, Runguphan W (2018) Metabolic engineering of Pichia pastoris for production of isobutanol and isobutyl acetate. Biotechnology for Biofuels 11(1). https://doi.org/10.1186/s13068-017-1003-x

Song CW, Lee J, Ko YS, Lee SY (2015) Metabolic engineering of Escherichia coli for the production of 3-aminopropionic acid. Metab Eng 30:121-129. https://doi.org/10.1016/j.ymben.2015.05.005

Steunenberg P, Könst PM, Scott EL, Franssen MCR, Zuilhof H, Sanders JPM (2013) Polymerisation of β-alanine through catalytic ester–amide exchange. European Polymer Journal 49(7):1773-1781. https://doi.org/10.1016/j.eurpolymj.2013.03.032

Tan Z, Zhu X, Chen J, Li Q, Zhang X (2013) Activating phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase in combination for improvement of succinate production. Appl Environ Microbiol 79(16):4838-44. https://doi.org/10.1128/AEM.00826-13

Tigu F, Zhang J, Liu G, Cai Z, Li Y (2018) A highly active pantothenate synthetase from Corynebacterium glutamicum enables the production of D-pantothenic acid with high productivity. Appl Microbiol Biotechnol 102(14):6039-6046. https://doi.org/10.1007/s00253-018-9017-2

Tomita H, Yokooji Y, Ishibashi T, Imanaka T, Atomi H (2014) An archaeal glutamate decarboxylase homolog functions as an aspartate decarboxylase and is involved in β-alanine and coenzyme A biosynthesis. J Bacteriol 196(6):1222-30. https://doi.org/10.1128/jb.01327-13

Tuyishime P, Wang Y, Fan L, Zhang Q, Li Q, Zheng P, Sun J, Ma Y (2018) Engineering Corynebacterium glutamicum for methanol-dependent growth and glutamate production. Metab Eng 49:220-231. https://doi.org/10.1016/j.ymben.2018.07.011

Wang L, Piao X, Cui S, Hu M, Tao Y (2020) Enhanced production of beta-alanine through co-expressing two different subtypes of L-aspartate-alpha-decarboxylase. J Ind Microbiol Biotechnol 47(6-7):465-474. https://doi.org/10.1007/s10295-020-02285-5

Weninger A, Fischer JE, Raschmanova H, Kniely C, Vogl T, Glieder A (2018) Expanding the CRISPR/Cas9 toolkit for Pichia pastoris with efficient donor integration and alternative resistance markers. J Cell Biochem 119(4):3183-3198. https://doi.org/10.1002/jcb.26474

Whitaker WB, Jones JA, Bennett RK, Gonzalez JE, Vernacchio VR, Collins SM, Palmer MA, Schmidt S, Antoniewicz MR, Koffas MA, Papoutsakis ET (2017) Engineering the biological conversion of methanol to specialty chemicals in Escherichia coli. Metab Eng 39:49-59. https://doi.org/10.1016/j.ymben.2016.10.015

Wu C, Zhang J, Du G, Chen J (2013) Aspartate protects Lactobacillus casei against acid stress. Appl Microbiol Biotechnol 97(9):4083-93. https://doi.org/10.1007/s00253-012-4647-2

Yamada R, Ogura K, Kimoto Y, Ogino H (2019) Toward the construction of a technology platform for chemicals production from methanol: d-lactic acid production from methanol by an engineered yeast Pichia pastoris. World Journal of Microbiology and Biotechnology 35(2). https://doi.org/10.1007/s11274-019-2610-4

Yu S, Miao L, Huang H, Li Y, Zhu T (2020a) High-level production of glucose oxidase in Pichia pastoris: Effects of Hac1p overexpression on cell physiology and enzyme expression. Enzyme Microb Technol 141:109671. https://doi.org/10.1016/j.enzmictec.2020.109671

Yu XJ, Huang CY, Xu XD, Chen H, Liang MJ, Xu ZX, Xu HX, Wang Z (2020b) Protein engineering of a pyridoxal-5'-phosphate-dependent l-aspartate-alpha-decarboxylase from Tribolium castaneum for beta-alanine production. Molecules 25(6). https://doi.org/10.3390/molecules25061280

Zhu T, Sun H, Wang M, Li Y (2019) Pichia pastoris as a versatile cell factory for the production of industrial enzymes and chemicals: Current status and future perspectives. Biotechnol J 14(6):e1800694. https://doi.org/10.1002/biot.201800694

Zhu T, Zhao T, Bankefa OE, Li Y (2020) Engineering unnatural methylotrophic cell factories for methanol-based biomanufacturing: Challenges and opportunities. Biotechnol Adv 39:107467. https://doi.org/10.1016/j.biotechadv.2019.107467

Zhu WL, Cui JY, Cui LY, Liang WF, Yang S, Zhang C, Xing XH (2016) Bioconversion of methanol to value-added mevalonate by engineered Methylobacterium extorquens AM1 containing an optimized mevalonate pathway. Appl Microbiol Biotechnol 100(5):2171-82. https://doi.org/10.1007/s00253-015-7078-z

Zou X, Guo L, Huang L, Li M, Zhang S, Yang A, Zhang Y, Zhu L, Zhang H, Zhang J, Feng Z (2020) Pathway construction and metabolic engineering for fermentative production of beta-alanine in Escherichia coli. Appl Microbiol Biotechnol 104(6):2545-2559. https://doi.org/10.1007/s00253-020-10359-8

Table 1. Primers used in this study

Primers name	Sequences (5’→3’）
5'AOX1	GACTGGTTCCAATTGACAAGC
3'AOX1	GCAAATGGCATTCTGACATCC
His4-BamHI-F	GCATGGATCCATGACATTTCCCTTGCTAC
His4-BamHI-R	GCATGGATCCGTTAAATAAGTCCCAGTTTCTC
pMPICZA-3881-F	GGTTTAGTTCCTCACCTTG
pMPICZA-4256-R	TCCCCCTTTTCCTTTGTC
Kan-pMPICZA-F	ACAAGGTGAGGAACTAAACCATGAGCCATATTCAACGG
Kan-pMPICZA-R	TCGACAAAGGAAAAGGGGGATTAGAAAAACTCATCGAGC
Hyg-pMPICZA-F	ACAAGGTGAGGAACTAAACCATGAAAAAGCCTGAACTCAC
Hyg-pMPICZA-R	TCGACAAAGGAAAAGGGGGACTATTCCTTTGCCCTCGG
pTEF1-F	GCAATCTAATCTAAGGGGCGGTGT
CYC1TT-R	TTCGAGCGTCCCAAAACCTTCTCAAGC
ADCBs-XhoI-F	GCATCTCGAGATGGATGTATCGAACAATGATGAGC
ADCBs-NotI-R	GCATGCGGCCGCCTACAAAATTGTACGGGCTG
Oan-XhoI-F	GCATCTCGAGATGTCCGTATCTGAAACC
Oan-NotI-R	GCATGCGGCCGCTCAGATAACGGTAGTTGCTACGC
Spe-XhoI-F	GCATCTCGAGATGAAAAAAATCATGATGATCGG
Spe-NotI-R	GCATGCGGCCGCTTATGCGATAAAGCCACCGTC
AAT1-BstBI(gb)-F	ATCAAAAAACAACTAATTATTCGAAATGTCGTTTTCAACGCAGAA
AAT1-NotI(gb)-R	AGTTTTTGTTCTAGAAAGCTGGCGGCCGCCTATACACGCACAACCTGAT
AAT2-BstBI(gb)-F	ATCAAAAAACAACTAATTATTCGAAATGTCGTTTTCAACGCAGAA
AAT2-NotI(gb)-R	AGTTTTTGTTCTAGAAAGCTGGCGGCCGCCTATACACGCACAACCTGAT
AsPCK-BstBI(gb)-F	ATCAAAAAACAACTAATTATTCGAAATGACTGACTTAAACAAACTCG
AsPCK-NotI(gb)-R	AGTTTTTGTTCTAGAAAGCTGGCGGCCGCTTATGCTTTTGGACCGGCGCCAAC
PPC-BstBI(gb)-F	ATCAAAAAACAACTAATTATTCGAAATGAACGAACAATATTCCGC
PPC-NotI(gb)-R	AGTTTTTGTTCTAGAAAGCTGGCGGCCGCTTAGCCGGTATTACGCATAC
PCK-BstBI(gb)-F	ATCAAAAAACAACTAATTATTCGAAATGCGCGTTAACAATGGTTTG
PCK-NotI(gb)-R	AGTTTTTGTTCTAGAAAGCTGGCGGCCGCTTACAGTTTCGGACCAGCCGC

Table 2. Plasmids and strains constructed in this study

Names	Relative characteristics	References
Plasmids
pPICZA	Vector for extracellular expression recombinant protein carrying Zeo^R	Invitrogen
pAO	His4+	Invitrogen
pMPICZHis	Extracellular expression vector carrying His4, Zeo^R	This work
pMPICKmHis	Replace antibiotic resistance marker (zeocin) of pMPICZHis with kanamycin	This work
pMPIC2H	Replace antibiotic resistance marker (zeocin) of pMPICZHis with hygromycin	This work
pMPICZHis-bliPanD	Codon optimized panD gene from Bacillus paralicheniformis ATCC 9945a cloned into pMPICZHis at BstBI and NotI site	This work
pMPICZHis-bsPanD	Codon optimized panD gene from Bacillus subtilis cloned into pMPICZHis at BstBI and NotI site	This work
pMPICZHis-sgePanD	Codon optimized panD gene from Streptomyces griseorubiginosus cloned into pMPICZHis at BstBI and NotI site	This work
pMPICZHis-cguPanD	Codon optimized panD gene from Corynebacterium glutamicum cloned into pMPICZHis at BstBI and NotI site	This work
pMPICZHis-TcCSADC	Cysteine sulfinic acid decarboxylase from Tribolium castaneum (TcCSADC) cloned into into pMPICZHis at BstBI and NotI site	This work
pMPICZHis-Oan	aspDH gene from Ochrobactrum anthropi ATCC 4918 cloned into pMPICZHis at BstBI and NotI site	This work
pMPICZHis-Spe	aspDH gene from Serratia proteamaculanscloned into pMPICZHis at BstBI and NotI site	This work
pMPICZHis-ADC-Oan	panD expression cassette (pMPICZHis-ADC digest by SphI and BamHI) cloned into pMPICZHis-Oan at SphI and BglII site	This work
pMPICZHis-ADC-Spe	panD expression cassette (pMPICZHis-ADC digest by SphI and BamHI) cloned into pMPICZHis-Spe at SphI and BglII site	This work
pMPICKmHis-AAT1	Cytosolic aspartate aminotransferase from P. pastoris GS115 cloned into pMPICZHis at BstBI and NotI site	This work
pMPICKmHis-AAT2	Mitochondrial aspartate aminotransferase from P. pastoris GS115 cloned into pMPICZHis at BstBI and NotI site	This work
pMPICZHis-2ADC	Two copies of panD gene expression cassette cloned into pMPICZHis	This work
pMPICZHis-2ADC-Spe	Two copies of panD gene expression cassette and one copy of SpeaspDH gene expression cassette cloned into pMPICZHis	This work
pMPIC2H-PPC	ppc gene from Escherichia coli cloned into integration vector pMPIC2H at BstBI and NotI site	This work
pMPIC2H-AsPCK	pck gene from Actinobacillus succinogenes cloned into integration vector pMPICHyHisLoxA at BstBI and NotI site	This work
pMPIC2H-PCK	pck gene from Escherichia coli cloned into integration vector pMPIC2H at BstBI and NotI site	This work
Strains
E. coli DH5α	Commercial transformation host for cloning	Invitrogen
P. pastoris GS115	Commercial transformation host for cloning; his4- , Mut+	Invitrogen
Δku70	GS115, Δku70; his4+	This work
BliADC	Δku70 harboring pMPICZHis-bliPanD	This work
BsADC	Δku70 harboring pMPICZHis-bsPanD	This work
SgeADC	Δku70 harboring pMPICZHis-sgePanD	This work
CguADC	Δku70 harboring pMPICZHis-cguPanD	This work
TcCSADC	Δku70 harboring pMPICZHis-TcCSADC	This work
ADC-Oan	Δku70 harboring pMPICZHis-ADC-Oan	This work
ADC-Spe	Δku70 harboring pMPICZHis-ADC-Spe	This work
ADC-AAT1	Δku70 harboring pMPICZHis-bsPanD and pMPICKmHis-AAT1	This work
ADC-AAT2	Δku70 harboring pMPICZHis-bsPanD and pMPICKmHis-AAT2	This work
2ADC	Δku70 harboring pMPICZHis-2ADC	This work
2ADC-Spe	Δku70 harboring pMPICZHis-2ADC-Spe	This work
PPC	Δku70 harboring pMPICZHis-2ADC-Spe and pMPIC2H-PPC	This work
AsPCk	Δku70 harboring pMPICZHis-2ADC-Spe and pMPIC2H-AsPCK	This work
PCK	Δku70 harboring pMPICZHis-2ADC-Spe and pMPIC2H-PCK	This work

GraphicalAbstract.png

Download PDF

Editorial decision: Major revision
22 Jul, 2021
Review #4 received at journal
20 Jul, 2021
Review #3 received at journal
14 Jul, 2021
Review #1 received at journal
08 Jul, 2021
Review #2 received at journal
30 Jun, 2021
Reviewer #4 agreed at journal
29 Jun, 2021
Reviewer #3 agreed at journal
28 Jun, 2021
Reviewer #2 agreed at journal
24 Jun, 2021
Submission checks completed at journal
24 Jun, 2021
Editor assigned by journal
23 Jun, 2021
Reviewers invited by journal
23 Jun, 2021
Reviews received at journal
23 Jun, 2021
Reviewer #1 agreed at journal
23 Jun, 2021
Editor invited by journal
23 Jun, 2021
First submitted to journal
22 Jun, 2021

You are reading this latest preprint version

Metabolic Engineering of the Methylotrophic Yeast Pichia Pastoris (Komagataella phaffii) for the Production of Β-alanine From Methanol

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Tables

Supplementary Files

Status:

Version 1