Plant material and growth conditions
Arabidopsis seeds were sterilized (10 min in 0.03% bleach, 0.05 % Triton X-100), washed three times in water and briefly incubated in 70% EtOH before sowing on germination medium (0.5xMurashige and Skoog (MS) salts (CAROLINE 19-5700, USA), 1% (w/v) Bactoagar pH 5.6) or storing dry on filter paper (4°C) until sown. Seeds were stratified 2 to 4 days at 4°C before transfer to growth incubators (Percival) with long day conditions (16 hours light [120 µE m-2 s-1] at 21°C and 8 hours dark at 16°C). 2 weeks after germination, seedlings were transferred to soil and grown under long day conditions (16 h light/ 8 h dark; 22°C /18°C, respectively).
The nls3xmVenus construct (Joop Vermeer, University of Zurich) was subcloned in a Gateway LR reaction into the pRPS5a-pop6-LhGR2 vector (9). The construct was introduced into Agrobacterium tumefaciens (GV3101) and transformed to Arabidopsis Col-0 plants. Primary transformants were selected based on BASTA resistance, and scored as positive based on GUS reporter assays and nls3xmVenus signals 16h following a 10µM Dex-treatment.
The H1.1-RFP (pRPS5a > > H1.1-RFP) construct was made by assembling a synthetic H1.1-tagRFP-T coding sequence (H1.1: AT1G06760, tagRFP-T: GenBank: ACD03281 (28), synthesis: GeneART, Invitrogen) into the pRPS5a-pop6-LhGR vector (9). The constructs were transformed via Agrobacterium tumefaciens (GV3101) to Col-0 plants. Positive T1s were identified based on BASTA resistance selection, GUS reporter assay and RFP signals 16h after 10 µM Dex-treatment.
The pRPS5a>>∆Kinesin-YFP construct was made by amplifying a 957 bp fragment encompassing the coiled-coil domains of At3g20150 (recently termed Kinesin-12F (29) from Arabidopsis Col-0 cDNA using primers 5’-TTTGGCGCGCCCACCATGGGAGCAAGTAATGGAGA-3’ and 5’-AAAGGCGCGCCTTGCTCCCTACATACCTTCTTCCTC-3’. Following AscI digestion of the PCR product, the fragment was inserted into pENTRY-YFP (30). This was then recombined with pOpIN2 (9) through an LR reaction to generate the vector pRPS5a>>∆Kinesin-YFP (alternative name: pOpIN2/RPS5a > Dex > KIN12F-coiled-coil).
For pSPL > > amiMET1 and pSPL > > amiFIE the putative promoter regions plus the 5’UTR and the 3’UTR of the SPL locus (AT4G27330) were amplified as described (31, 32). The fragments were cloned into pBIN-LR-LhGR2 using Gateway-compatible sites as described (9) to generate the pSPL::LhGR vector and an AscI pSPL::LhGR fragment was cloned into pOPIn2 (9) to generate pSPL::LhGR/pOPIn2. The amiRNAs against FIE (AT3G20740) and MET1 (AT5G49160) were amplified using genomic DNA Col_0 as template as described (33). The amiRNA target sequences were TCGTCCAATTCCCTGTATTA and TAGCCAACAGAGTATTACTGC for FIE and MET1, respectively. The amiRNA were cloned into a PUC Entry clone and subcloned by LR reaction (Invitrogen) into the pSPL::LhGR/pOPIn2 vector.
Preparation of Dex- stock and induction solution
The stock solution of 10 mM Dex in either pure DMSO or 100% EtOH is stored at – 20°C and can be kept for up to one year. The final induction solution consists of 10 µM Dex (SIGMA-ALDRICH, D4902) (prepared from the stock solution by diluting with water) and 0.01% Silwet L-77 (Lehle Seeds, USA, Cat. VIS-01). Importantly, the induction solution should be prepared freshly and stored at 4°C for a maximum of three days.
β -Glucuronidase reporter assay
Carpels are gently opened under the dissecting scope, immerged in GUS staining solution (Triton X-100 10%, EDTA 10 mM, Ferrocyanide 2 mM, Ferricyanide 2 mM, Na2HP04 100 mM, NaH2P04 100 mM, β-Glucuronidase 2 mM.) and vacuum infiltrated for 5min. The samples are then incubated for 2 hrs at 37°C, briefly rinsed with 50 mM phosphate buffer (pH 6.8) (0.2 M NaH2PO4, 2 M Na2HPO3) and mounted freshly in 80 % glycerol for microscopy imaging (DIC settings, Leica DMR, Leica microsystems GmbH, Germany).
Fluorescence imaging and image processing
Carpels were collected from treated flowers and placed on a clean microscope slide. Ovule primordia were gently exposed using dissecting needs in the mounting solution consisting in 0.5xMS or renaissance staining solution (4% paraformaldehyde; 1:2000 renaissance; 10% glycerol; 0.05% DMSO in 1x PBS (modified from (34)). Images were collected using a confocal laser scanning microscope using a 63XGLY APO NA1.4 objective (SP5R, Leica microsystems, Germany). Images were processed (partial or full projections, 3D rendering and orthogonal sections, as indicated in the figure legend) using Imaris (Bitplane, Switzerland).
RT-PCR analysis
Quantitative real-time RT-PCR experiments were performed using cDNA obtained from inflorescences. Total RNA was extracted using the Qiagen RNA extraction Kit. Ambion TURBO DNA-free DNase kit was used to eliminate genomic DNA contamination according to the manufacturer's instructions (http://www.ambion.com/). The ImProm-IITM reverse transcription system (Promega) was used to retro-transcribe the treated RNA. Transcripts were detected using a Sybr Green Assay (iQ SYBR Green Supermix; Bio-Rad) using UBIQUITIN10 (AT4G05320) as a reference gene. Assays were done in triplicate using a Bio-Rad iCycler iQ Optical System (software v.3.0a). Forward and reverse primers for FIE: TCTGAACACCTGCCTCACAG and TGTGACTGAGAACCGCTGTC, respectively; for MET1: GTGTGGCGTTAATGGGAAC and TCTCCATGACCCACAAGACTC, respectively. Primer specificity tests and qPCR experiments were performed as described (35) with the following cycling conditions: 3min at 95°C followed by 45 cycles of 10 s at 95°C, 1 s at 55°C, 30 s at 72°C, and 15 s at the optimal acquisition temperature. FIE and MET1 transcript levels were normalized with UBQ10 levels.
Scoring of ovules stages
For experiments shown in Fig. 4A, floral buds treated by Dex, Mock or water as described above were fixed in Acetic Acid:EtOH 3:1, stored overnight at 4°C, transferred in 70% EtOH, mounted in clearing solution (chloral hydrate: water: glycerol 8:2:1 v:v:w) and imaged under wide-field light microscopy with Nomarski optical settings (DMR, Leica microsystems, Germany). Ovule stages were scored according to the nomenclature for ovule primordia (20, 36) and ovules (37)
Fertility analysis
Single inflorescences were induced twice (at 0 and 16hrs) with 10 µM Dex, 0.01% Silvwet or Mock solutions including the equivalent share of EtOH or DMSO as indicated on the graph. After two weeks the first 10 siliques of the induced inflorescences were collected for seed set analysis.