Cell culture
Two human ESCC cell lines, KYSE150 and TE-1, were obtained from the Chinese Academy of Sciences (Shanghai, China), and Eca109 cells were from Wuhan University(Wuhan, China).The three cell lines were cultured in RPMI-1640 (Invitrogen, Life Technologies, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA, USA) and 1% penicillin-streptomycin (Gibco;Thermo Fisher Scientifc, Inc.). All the ESCC cell lines were cultured in a 5% CO2 humidified incubator at 37 °C.
Tissue microarray
Tissue microarrays of clinical samples consisted of ESCC and paired normal adjacent tissues(NAT) .One tissue microarray included 34 paired cases of ESCC and matched NAT (catalog number: # HEsoS180Su08; Outdo Biotech, Shanghai, China), and another 50 additional independent, subjected to esophagectomy, obtained from the First Affiliated Hospital of Xinjiang Medical University. Tumor tissues and clinical data were collected after obtaining the relevant informed consent from each patient involved. The study involving human tissue samples were approved by Medical Ethics Committee of the First Affiliated Hospital of Xinjiang Medical University.
Immunohistochemistry (IHC)
Tissue microarrays were de-waxed and hydrated, boiled in 0.01 M citrate buffer, and treated with 3% hydrogen peroxide after natural cooling. The primary polyclonal rabbit anti CALM1(1:400; Proteintech, Wuhan, China) and EGFR (1:600; Proteintech) was incubated overnight in 4 °C by adding drop of glass slide, followed by treatment with biotinylated antirabbit secondary antibody (CST) for 60 min at 37 °C. The sections were evaluated by two pathologists under optical microscopy and cell localization of protein and immunostaining levels was assessed in each section. The intensity of staining was divided into four grades (0, none; 1,weak; 2, moderate; and 3, strong) and percentage of positive cells (0, < 10%; 1, 10%-25%; 2, 25%-50%; and 3, > 50%). According to the total score (staining intensity plus positive cell score), ESCC patients were divided into two groups, specifically "low expression "(total score ,0–3) and" high expression "(total score ,4–6), which were used to analyze the prognostic significance of EGFR and CALM1 in ESCC.
CRISPR-Cas9 knock-out construction and lentiviral transfection
The LentiCRISPR P2A-GFP-CALM1 CRISPR/Cas9 construct was outsourced to Shanghai Gene Pharma Co Ltd (Shanghai, China). Lentiviruses carrying green fluorescent protein (GFP) is along with scrambled Lv-sgRNA-control (sgCtrl) and CALM1 sgRNA (Lv-sgCALM1-1, Lv-sgCALM1-2, and Lv-sgCALM1-3). A suitable amount of lentivirus was added to the culture medium of ESCC for transduction, according to the multiplicity of infection (MOI), and the cells were incubated further for 8 h. After 72 hours, all fluorescent cells were sorted via flow cytometry and transfection efficiency was evaluated via Western blots and Quantitative real-time polymerase chain reaction (qRT-PCR). The sgRNA target sequences were as follows: sgCALM1-1(GACGGACAAGTCAACTATGAA), sgCALM1-2 (CGTGAGGCATTCCGAGTCTTT), sgCALM1-3(AGAAGCTGAATTGCAGGATAT), and sgRNA control (TTCTCCGAACGTGTCACGT).
Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was extracted with TRIzol reagent and then the RNA was reversely transcribed into cDNA using a Pria Revert Aid First Strand cDNA Synthesis Kit. Following the manufacturer’s protocols, Real-time PCR was performed using a SYBR Green Premix PCR Master Mix. Relative mRNA expression of CALM1 and EGFR was calculated using the 2−ΔΔCt method after being normalized to GAPDH. PCR was performed with the following primer sets: CALM1 forward, 5'GGTCAGAACCCAACAGAA3' and reverse, 5'AGACTCGGAATGCCTCA3'; and EGFR forward, 5'AGGCACGAGTAACAAGCTCAC3' and reverse, 5'ATGAGGACATAACCAGCCACC3'. GAPDH forward, 5'TGACTTCAACAGCGACACCCA3' and reverse, 5'CACCCTGTTGCTGTAGCCAAA3'.
Western blots
Cells were lysed with RIPA lysis buffer after CALM1-guide RNA transfection for 72 h, and protein concentration was detected with bicinchoninic acid protein assay (Thermo Fisher Scientific)., 0.1 mg total protein were subjected to 10% SDS-PAGE separation under denaturing conditions and then transblotted to PVDF membranes (Millipore, Billerica, MA,USA). Target proteins were detected by using specific antibody against CALM1 (1:800; Proteintech Group, Wuhan, China). GAPDH (1:500; Santa Cruz Biotechnology Inc,USA) was chosen as an internal control and the CALM1 and GAPDH dilutions were incubated at 4 °C with gentle shaking overnight. The blots were visualized with Pierce™ ECL Western Blotting Substrate (Thermo Fisher Scientific, CA, USA), according to the manufacturer's protocol.
MTT assay
Cells were placed into the 96-well plates at the density of 4 × 103/mL in RPMI-1640. At the designated time points, the cells were coated with 100 µL sterile MTT (Sigma-Aldrich) in an incubator with 5% CO2 for 4 h at 37 °C. Afatinib was added with the desired drug treatment concentrations ranging from 0 to 20 µM and incubated for 72 h. The reaction waster was performed by removing the culture medium and then adding 100 µL of dimethyl sulfoxide (Sigma-Aldrich) for 0.5 h to dissolve the formaldehyde. Finally, absorbance values were measured at 490 nm. The IC50 (half-maximum inhibitory concentration) was used as the measure of relative cytotoxicity.
Apoptosis assay and cell cycle
After transfection with sgCtrl and sgCAML1-1 with or without EGFR inhibitor for 72 h, ESCC were collected after washing twice with PBS. For cell cycle, cells were fixed in 70% ice-cold ethanol overnight, then washed twice with PBS and stained with 10 µg/mL RNase A in the dark for 15 min at room temperature. The analysis was performed by a flowcytometer (BD FACS Calibur; BD Biosciences, Brea, CA, USA). For analysis of apoptotic cells, it was analyzed by flow cytometry using an FITC Annexin V Apoptosis Detection Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions after harvesting cells.
Transwell assay
50 µL Matrigel (BD, Bedford, MA) pre-coated on Transwell system (Corning, New York) with 8 µL pores. Cells at a density of 1 × 105 cells per well were placed into the upper chambers in 600 µL serum-free RPMI 1640. After incubating at 37 °C with 5% CO2 for 24 h, cells invading the lower surface of the filter membrane were scraped off with swabs; the number of invaded cells was counted using Image J software (NIH, Bethesda, MA, USA).
Wound healing assay
The migratory variation of ESCC cells was determined by Wound healing assay. The extent of cell motility was quantified by measuring the distance area between migrating cell boundaries. At 0 and 24 h, Photographs were captured by using amicroscope at × 40 magnifications. At least, four wound areas were photographed on each plate and counted under an Olympus inverted fluorescence phase-contrast microscope (Tokyo, Japan)
Colony formation assay
KYSE150 and Eca109 cells transfected with sgCtrl, sgCALM1-1 were plated in 6well plates (1000 cells/well) and incubated at 37 °C for 14 days to allow colony formation. In the drug treatment group, the medium was changed with fresh medium containing Afatinib or vehicle (DMSO) every 2 days. The cell medium was subsequently removed. Cells were washed using PBS and fixed with 4% paraformaldehyde for 10 min at room temperature. The cells were stained with crystal violet kit (Beyotime Institute of Biotechnology, Shanghai, China) for 15 min at room temperature. The colonies were washed, photographed by camera and counted using ImageJ software.
Tumorigenesis in nude mice and in vivo imaging
Nude mice (4 weeks old) were purchased from Shanghai Lingchang Biological Technology Co., Ltd. All animals (22 ± 1.5 g) were handled according to the Guide for the Care and Use of Laboratory Animals and were housed at a controlled temperature (22–28˚C) and humidity (50%) under a 12-h light/dark cycle. All mice were randomly divided into three groups: sgCtrl group, sgCAML1-1 group, sgCAML1-1 plus EGFR inhibitor group. Then, the stably cells (4 × 106 for each side) were suspended in PBS and implanted subcutaneously into male BALB/c nude mice. Animals in the sgCAML1-1plus EGFR inhibitor group treated with 20 mg/kg paclitaxel every 3 days once when tumor size reached about 100 mm3 intraperitoneally (i.p.). After 7 days, the tumor weight was measured every 3 days for 4 weeks. After 27 days of monitoring, in vivo imaging of animals before they are sacrificed and the tumors were dissected and weighted.
Statistical analysis
Data were expressed as the mean ± standard deviation (SD), using SPSS for Windows version 19.0 (SPSS, Inc., Chicago, IL, USA). Student t test or one-way analysis of variance (ANOVA) was used to evaluate the differences among groups, and chi-square and Fisher's exact tests were applied to analyze correlation between CALM1/EGFR expression and clinicopathological characteristics. The Kaplan-Meier survival curve and log rank test were used to plot the survival curves and estimate survival rates. A two-tailed P < 0.05 was taken as significant in all tests.