DOI: https://doi.org/10.21203/rs.3.rs-658804/v1
Stem-end rot (SER) caused by Lasiodiplodia theobromae is an important disease of mango in China. Demethylation inhibitor (DMI) fungicide are widely used for diseases control in mango orchards. The baseline sensitivity to difenoconazole of 138 isolates collected in the field in 2019 from mango were established by the mycelial growth rate method. The cross-resistance to six site-specific fungicides with different modes of action were investigated using 20 isolates randomly selected. The possible reasons for L. theobromae resistance to difenoconazole were preliminarily determined through gene sequence alignment and quantitative real-time PCR analysis. The results showed that the EC50 values of 138 L. theobromae isolates to difenoconazole ranged from 0.01 to 13.72 µg/ml. The frequency of difenoconazole sensitivity formed a normal distribution curve when the outliers were excluded. Difenoconazole showed positive cross-resistance only with the DMI tebuconazole, but not with non-DMI carbendazim, pyraclostrobin, fludioxonil, bromothalonil, or iprodione. Some multifungicide-resistant isolates of L. theobromae were found. Two amino acid substitutions (E209k and G207A) were found in CYP51 protein, but they were not likely related to the resistance phenotype. There was no alteration in promoter region of the CYP51 gene. However, difenoconazole significantly increased the expression of the CYP51 gene in the resistant isolates when compared to the susceptible isolates. This study is important references to explore resistance mechanism. These results are vital to make effective mango diseases management strategies in order to avoid the development of further resistance.
Mangoes (Mangifera indica L.) known as the ‘king of tropical fruits’ is one of the main tropical and subtropical fruits, widely appreciated for their economic value and their high nutritional value1. China is the world's second-largest mango grower, being only inferior to India. The main mango-producing area in China is Hainan province, which the mango planting area has exceeded 56,900 hectares in 20192. The majority of mangoes are intended for fresh-market consumption. Thus, any surface flaws will impact fruit sales. In Hainan, Lasiodiplodia theobromae is the main pathogen causing stem-end rot (SER) of mango3. This fungus may establish itself in the field asymptomatically and stay in a quiescent state. The pathogen express after the fruit has been harvested, which will cause fruit rot and serious damage to the quality of fruit in storage and transportation of mango, and cause huge economic losses4–6. It can also infect various plants and cause diseases in the field and storage period, including the blueberry7, coconut8, papaya9, longan fruit10, and so on. Since no cultivars show resistance to L. theobromae, the control of SER disease has depended on chemical control. Fungicide benzimidazole methylcarbamate (MBCs) and sterol 14𝛼-demethylase inhibitors (DMIs) are extensively used to control mango disease 11,12.
The frequent use of chemical fungicides in fields increases fungicide-resistance of the pathogenic fungi. In Hainan Province of China, many DMIs fungicides were frequently used to control various diseases during mango cultivation, which caused great pressure on the selection of fungicides for L. theobromae, and made the pathogen face the risk of serious resistance to fungicides. In order to determine the difenoconazole-resistance of L. theobromae in Hainan and to explore the mechanisms of resistance, the aim of this study were to (I) determine the sensitivity of L. theobromae isolates to difenoconazole; (II) identify the patterns of cross-resistance between difenoconazole and other DMIs or fungicides that have different mechanisms of action than difenoconazole; (III) investigate the molecular mechanisms that may be responsible for difenoconazole resistance.
In 2019, 138 single-spore field isolates of L. theobromae were obtained from diseased mango fruits in Hainan Province, China, previously identified and preserved in our laboratory. At 28°C in the dark, the isolates were grown on a potato dextrose agar (PDA) medium.
A mycelial growth inhibition assay was used to investigate the baseline sensitivity to difenoconazole of 138 L. theobromae isolates13. To prepare stock solutions, difenoconazole (97.2%; Zhengye Chemical Industrial Co., Hainan, China) was dissolved in 100% acetone to obtain 5×103 µg/ml solutions. A mycelial plug (5 mm in diameter) from the edge of the 3-day-old culture of each isolate was inoculated in 90 mm diameter Petri plates containing difenoconazole PDA media. The final concentration of acetone solvent in the medium was 0.1%. The difenoconazole concentrations of 51.2, 12.8, 3.2, 0.8, 0.2 µg/ml, as well as a control medium with the same amount of acetone but no fungicide. Inoculated plates were cultured in the dark at 28°C. The diameter of each colony was measured, and the inhibition rate of mycelial development calculated after cultured for 36 h. There were three replicate plates per treatment. The entire experiment was repeated twice independently. The frequency distribution of 138 EC50 values of L. theobromae was plotted to represent the baseline sensitivity. The baseline sensitivity level of L. theobromae was used to develop classification criteria for difenoconazole sensitive phenotypes14,13. The resistance factor (RF) of each isolate to fungicide was computed using the baseline sensitivity: Sensitive isolates (S): RF < 5; Resistant isolates (R): RF > 515.
The cross-resistance of difenoconazole with other regularly used fungicides was investigated using 20 isolates. These comprised DMIs fungicides tebuconazole and five fungicides of other action modes, which were carbendazim (benzimidazole), iprodione (dicarboximides), bromothalonil (bromomethyl glutaronitrile), fludioxonil (phenylpyrrole) and pyraclostrobin (strobilurin). As previously stated, EC50 values were calculated using a mycelial growth inhibition experiment. The EC50 values of the fungicides tested were used to determine cross-resistance correlations. The experiment was conducted three times independently, using three replicate plates for each treatment.
Mycelia of L. theobromae were snap-frozen in liquid nitrogen and processed with tungsten beads in a LUKYM-II Mixer-Mill to extract total genomic DNA from 138 isolates (Guangzhou Luka sequencing instrument Co., LTD, Guangzhou, China). Total genomic DNA was extracted according to the manufacturer's instructions using the E.Z.N.A.® HP Plant DNA Mini kit (Omega Bio-Tek, Norcross, United States). Primer pairs, LtCYP51-F1/LtCYP51-R1, Per-1F/Per-1F (Table 1), were designed to amplify the LtCYP51 coding sequence and LtCYP51 promoter of resistant and sensitive isolates. Amplications were performed in a My Cycler thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA). A 40 µL reaction volume was used for PCR amplification, with 20 µL of 2 × Phanta Max Master Mix, 0.8 µL of template DNA, 1.6 µL of (10 mM) each primer, and 16 µL of ddH2O. The PCR settings for the coding sequence were 95°C for 3 min, followed by 35 cycles of 95°C for 30 s, 58°C for 50 s, and 72°C for 90 s, followed by a final 5-min extension at 72°C.
Primers |
Sequence (5’→3’) |
Description |
|||
---|---|---|---|---|---|
Per-1F |
GCCAACAGCCACGGATGAT |
Amplification of the promoter region of the Lt CYP51 gene |
|||
Per-1R |
GCCATAGGTGACGGTGCTG |
||||
Lt-CYP51F |
CCCTCCGTCTCCCTACACCT |
Amplification of the coding region of the Lt CYP51 gene |
|||
Lt-CYP51R |
TTCTCCCTCCTCTCCCAAA |
||||
RT-LtF |
GGATTGTGCTTCGTCTCGC |
Quantitative RT-PCR primers for analysis of Lt CYP51 expression |
|||
RT-LtR |
CGTCTCCTTGACCACCTGCT |
||||
RT-Act LtF |
GGAGATGAGGCACAGTCG |
Amplification of the actin gene |
|||
RT-Act LtR |
GCGGTGGTGGAGAAAGAGT |
For the promoter, other conditions are the same as the coding region, but the extension time is 15 s. With a Tolo PCR Clean-Up Kit (Tolo Biotech Co., LTD, Shanghai, China), PCR products were purified. The PCR fragment was ligated into p ESI-blunt vector (YEASEN Biotech Co.Ltd) and sequenced with vector primers M13F and M13R at Tianyihuiyuan Biotech Co., Ltd (Guangzhou, China).
The LtCYP51 DNA sequence was studied using the programs DNAMAN (version 6.0; LynnonBiosoft, U.S.A.) and InterPro Scan (http://www.ebi.ac.uk/interpro/search/sequence-search), and it was compared to fungal of other LtCYP51 genes. The amino acid sequences of the LtCYP51 genes from difenoconazole-resistant and sensitive isolates were compared using the computer program EMBOSS Transeq (https://www.ebi.ac.uk/emboss/transeq/), which translated the DNA sequences into amino acid sequences using standard code.
Quantitative expression of LtCYP51 Gene. Among the 30 isolates used for amino acid mutation analysis, two sensitive isolates (YC70 and JS10) and six resistant isolates (LD10, SY31, YZ90, DZ11, SY05 and YC80) were randomly selected to study the expression of LtCYP51 gene. The EC50 values of 8 isolates (Table 2). Five mycelial plugs were transferred into a flask containing 100 ml of potato dextrose broth (PDB) and incubated at 28°C for 24 h on a rotary shaker at 150 rpm. Three flasks were treated with difenoconazole to reach a final concentration of 150 µg/ml, with three replicates. Three flasks containing 100 ml of PDB were used as untreated controls. After being treated with difenoconazole for 12 h, the mycelia of each isolate were removed for RNA extraction16. Total RNA was extracted using the TIANGEN RNA simple Total RNA kit (Tiangen Biotech Co., Ltd, Beijing, China), and cDNA was synthesized using the HiScript III 1st Strand cDNA Synthesis Kit with g DNA Eraser (Vazyme Biotech Co., Ltd, Nanjing, China), following the manufacturer's instructions. Every reaction has three biological replicates and three technological replicates.
Isolates |
EC50 ± SD (µg/ml)a |
||||||
---|---|---|---|---|---|---|---|
Difb |
Car |
Pyr |
Flu |
Bro |
Ipr |
Teb |
|
YC80 |
7.59 ± 0.23 |
8016.29 ± 658.34 |
1913.83 ± 158.46 |
0.04 ± 0.01 |
11.68 ± 1.92 |
0.30 ± 0.06 |
0.97 ± 0.11 |
SY06 |
9.63 ± 0.66 |
3.37 ± 0.28 |
1.75 ± 0.25 |
0.08 ± 0.01 |
9.52 ± 1.27 |
0.53 ± 0.09 |
1.87 ± 0.13 |
LD13 |
1.99 ± 0.22 |
0.02 ± 0.01 |
344.93 ± 45.72 |
0.17 ± 0.02 |
14.89 ± 1.63 |
0.36 ± 0.05 |
0.33 ± 0.08 |
SY34 |
10.14 ± 0.91 |
1792.64 ± 176.28 |
213.41 ± 19.33 |
0.04 ± 0.01 |
10.02 ± 1.15 |
0.23 ± 0.06 |
1.11 ± 0.09 |
YC70 |
0.97 ± 0.52 |
0.09 ± 0.01 |
79 ± 5.38 |
0.03 ± 0.01 |
2.08 ± 0.46 |
0.23 ± 0.07 |
0.07 ± 0.01 |
SY05 |
6.52 ± 0.40 |
0.38 ± 0.02 |
260.01 ± 19.62 |
0.05 ± 0.01 |
7.83 ± 0.98 |
0.37 ± 0.08 |
0.68 ± 0.07 |
SY31 |
6.24 ± 0.33 |
1.08 ± 0.14 |
83.21 ± 8.45 |
0.26 ± 0.03 |
5.04 ± 0.56 |
0.25 ± 0.09 |
0.60 ± 0.08 |
DZ11 |
8.29 ± 0.36 |
2.68 ± 0.38 |
429.48 ± 47.83 |
0.04 ± 0.01 |
5.33 ± 0.40 |
0.40 ± 0.06 |
0.84 ± 0.09 |
AM82 |
1.03 ± 0.85 |
5447.84 ± 529.11 |
210.77 ± 20.45 |
0.11 ± 0.02 |
7.33 ± 0.72 |
0.54 ± 0.08 |
0.17 ± 0.02 |
YZ31 |
7.22 ± 0.63 |
8.39 ± 0.96 |
133.87 ± 11.23 |
0.06 ± 0.01 |
6.46 ± 0.75 |
0.42 ± 0.03 |
0.81 ± 0.09 |
CJ20 |
2.61 ± 0.57 |
0.0001 ± 0.00 |
25.9 ± 1.99 |
0.11 ± 0.02 |
8.90 ± 0.66 |
0.23 ± 0.05 |
0.47 ± 0.06 |
YZ01 |
5.39 ± 0.92 |
1.17 ± 0.16 |
8.09 ± 0.93 |
0.09 ± 0.01 |
7.36 ± 0.97 |
0.32 ± 0.04 |
0.42 ± 0.05 |
CJ01 |
0.73 ± 0.33 |
0.52 ± 0.04 |
54.02 ± 6.35 |
0.15 ± 0.02 |
10.54 ± 0.94 |
0.30 ± 0.04 |
0.40 ± 0.07 |
AM24 |
2.22 ± 0.30 |
1.15 ± 0.12 |
9.98 ± 1.21 |
0.10 ± 0.01 |
8.90 ± 0.81 |
0.25 ± 0.16 |
0.40 ± 0.06 |
SY26 |
8.53 ± 1.17 |
1.05 ± 0.10 |
6.07 ± 0.78 |
0.21 ± 0.03 |
6.07 ± 0.83 |
0.35 ± 0.19 |
0.98 ± 0.08 |
LD34 |
0.33 ± 0.29 |
0.68 ± 0.05 |
16.58 ± 1.75 |
0.08 ± 0.01 |
16.58 ± 1.74 |
0.42 ± 0.05 |
0.89 ± 0.09 |
LD10 |
6.64 ± 0.41 |
8537.14 ± 721.73 |
230.67 ± 20.65 |
0.12 ± 0.02 |
9.16 ± 0.95 |
0.25 ± 0.07 |
0.63 ± 0.09 |
SY02 |
11.56 ± 0.72 |
2.63 ± 0.45 |
58.36 ± 4.92 |
0.17 ± 0.05 |
8.05 ± 0.75 |
0.31 ± 0.09 |
1.59 ± 0.03 |
JS10 |
0.65 ± 0.22 |
1.32 ± 0.23 |
211.39 ± 19.43 |
0.05 ± 0.01 |
8.45 ± 0.92 |
0.31 ± 0.08 |
0.07 ± 0.01 |
YZ90 |
9.34 ± 0.20 |
5.59 ± 0.46 |
0.0008 ± 0.00 |
0.03 ± 0.01 |
5.59 ± 0.63 |
0.36 ± 0.09 |
0.98 ± 0.09 |
aValues in a column indicate EC50 means ± standard deviation (SD). bDif = difenoconazole, Car = carbendazim, Pyr = pyraclostrobin, Flu = fludioxonil, Bro = bromothalonil, Ipr = iprodione, Teb = tebuconazole. |
Real-time PCR was carried out in a total volume of 20 µL using the qTOWER3 G REAL-TIME PCR thermocycler (Analytik Jena AG, Jena, Germany). To amplify the genes, the 2 × ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd, Nanjing, China) was employed. The actin gene was amplified as a reference using the primer pair RT-Act LtF/RT-Act LtR to standardize the quantification of LtCYP51 expression17. Three repeats of the experiments were carried out.
The inhibition rates were converted to the probability values, and difenoconazole concentrations were log 10-transformed before using a line regression model. The effective concentration to inhibit mycelial growth by 50% (EC50) was calculated by the regression equation. The EC50 values were checked for homogeneity of variances using Levene’s test, then the EC50 values were calculated for each isolate by combining the data from both replications. The Shapiro-Wilk test was used to determine the normality of the frequency distribution of difenoconazole sensitivity, and the outliers were detected using the boxplot in SPSS 21.0. (IBM SPSS Statistics Version 21.0; IBM Corp., Armonk, NY, USA). The histograms were built utilising log 10-transformed EC50 values when the outliers were removed14,13. Spearman's rank correlation coefficient using log-transformed EC50 values was used to examine cross-resistance among seven fungicides18,19.To assess the differences in the relative expressions of gene, a one-way ANOVA with LSD test (p < 0.01). The difference of mean expression level was compared by Mann–Whitney U-test (p < 0.001). DNAMAN software was used to examine DNA sequences. (version 6.0; LynnonBiosoft, U.S.A.).
The EC50 values of difenoconazole to inhibit mycelial growth of 138 L. theobromae field isolates ranged from 0.01 to 13.72 µg/ml. After the outliers were excluded by boxplot, it showed a continuous unimodal log-normal distribution of sensitivity of 121 isolates to difenoconazole (W = 0.981, P = 0.087) (Fig. 1). The mean EC50 value of 121 isolates was 1.12 ± 1.09 µg/ml, adopted as the resistance threshold concentration. Twenty-one of the 138 isolates were categorised as resistant to difenoconazole based on baseline sensitivity. The EC50 values of resistant isolates ranging from 5.60 to 13.72 g/ml, and the resistance factors ranged from 5 to 12.25. The resistance frequencies of L. theobromae isolates against difenoconazole was 15.22%. The resistant isolates could grow in the medium containing 150 µg/ml of difenoconazole (Fig. 2).
The EC50 of 20 isolates to carbendazim, pyraclostrobin, fludioxonil, bromothalonil, iprodione and tebuconazole were ranged 0.0001–8537.14 µg/ml, 0.0008–1913.83 µg/ml, 0.04–0.26 µg/ml, 2.081–16.58 µg/ml, 0.23–0.54 µg/ml and 0.07–1.87 µg/ml, respectively (Table 2). The results showed that multifungicide-resistant isolates of L. theobromae were found. Among 20 isolates used in this study, resistant isolates were resistant to either two (9 isolates), three (1 isolates), or four fungicides (2 isolate) .
There was no correlation between sensitivity to difenoconazole and that to carbendazim (𝜌 = 0.493, P = 0.253; Fig. 3A), pyraclostrobin (𝜌 = -0.047, P = 0.519; Fig. 3B), fludioxonil (𝜌 = -0.078, P = 0. 878; Fig. 3C), bromothalonil (𝜌 = -0.173, P = 0.509; Fig. 3D), iprodione (𝜌 = 0.024, P = 0.929; Fig. 3E). Only a positive correlation was observed between sensitivity to difenoconazole and that to tebuconazole (𝜌 = 0.836, P = 0.001; Fig. 3F).
The nucleotide sequences of the 1797 bp fragment of the LtCYP51 gene from the isolates were found to be 99% identical to that of L. theobromae (Genbank accession number MK107983.1). The LtCYP51 gene fragment encodes 523 amino acids and has two introns of 49 bp each at nucleotide positions 247 and 494, respectively. The BLAST search amino acid sequence of the LtCYP51 protein also showed 100%, 94.5% and 93.1% identity with that of the CYP51 protein in L. theobromae from cacao (XP_035367211.1), Diplodiaseriata from grape (OMP84122.1) and Botryosphaeria dothidea from apple (KAF4310083.1), respectively.
The 30 isolates were analyzed for the sequence of LtCYP51 genes and their upstream regions. Based on the alignment, two mutant phenotypes were found. An E209k mutation (glutamic acid was replaced with lysine) on the LtCYP51 protein was found in the resistant isolate YC80 and the sensitive isolate YC70. Meanwhile, a G207A mutation (the amino acid glycine was replaced by alanine) was only found in the isolate YC70 (Fig. 4). In the other resistant isolates, no mutation was found.
Fragments about 500 bp upstream portion of the LtCYP51 gene were obtained using the primer pair Per-1F/Per-1R. The upstream regions were identical in all tested isolates. In any of the isolates tested, no mutations or insertions were identified in the promoter of the LtCYP51 gene.
To explore the mechanism of resistance, the expression levels of the LtCYP51 gene in resistant and sensitive isolates were tested. Our results showed that difenoconazole significantly induced LtCYP51 expression in the resistant isolates (p < 0.01) (Fig. 5A). The mean constitutive relative expressions of LtCYP51 without fungicide in the two sensitive and six resistant isolates were 1.05 and 1.7 times, respectively. Difenoconazole increased the relative expression of LtCYP51 by 1.87 to 2.06 times in sensitive isolates with an average of 1.97, but 6.71 to 12.41 times in resistant isolates with an average of 10.05 times. In the resistant isolates, the mean relative expression of LtCYP51 induced by difenoconazole was 5-fold higher than that of sensitive isolates, and there was a significant difference (p < 0.001) (Fig. 5B).
Mango diseases are widely controlled using site-specific systemic fungicides in almost all mango-growing regions in the world. The detection of fungicide resistance is a crucial step in monitoring and regulating the spread of resistance in the field20. Among systemic fungicides, MBC fungicides are inhibitors of tubulin biosynthesis and impede cell division and inhibited mycelial growth21. Unfortunately, MBCs resistant populations of L. theobromae have been confirmed from papaya, citrus and mango11,22−25. Further, DMIs fungicides were more favoured by orchardist due to their specific mode of action and broad anti-fungi spectrum. DMI fungicides are classified as a medium risk for resistance development by the Fungicide Resistance Action Committee26. However, DMIs resistance has been found in a variety of phytopathogenic fungi17,16,20. The resistance mechanisms of DMIs have been reported to be diverse, with the following being the primary mechanisms: (I) point mutations in the target gene 14𝛼-demethylase (CYP51)27–29; (II) CYP51 gene overexpression30–34, 16; (III) Overexpression of efflux proteins35,36. In this study, we established the baseline sensitivity of L. theobromae to difenoconazole using 121 isolates from five major mango producing regions in Hainan, China. The results showed that the EC50 values ranged from 0.01 to 13.72 µg/ml, with a mean EC50 value of 1.1 µg/ml, suggesting that it could be used as a criterion to judge difenoconazole resistance in further studies. Twenty-one difenoconazole-resistant isolates were found in this study; their EC50 values ranged from 5.61 to 13.72 µg/ml. Furthermore, the EC50 values of 79 isolates were above 1 µg/ml, which accounted for more than half of the isolates. It means that there were a large number of isolates with reduced sensitivity to difenoconazole. Meanwhile, resistant isolates showed positive cross-resistance to difenoconazole and tebuconazole. In addition, no cross-resistance was discovered in this investigation between DMIs and non-DMIs fungicides. This matches reports of Botrytis cinerea and Colletotrichum gloeosporioides resistance to DMIs16,37. The commonly used site-specific fungicides (such as carbendazim and azoxystrobin) gave bad control effect against L. theobromae due to the development of resistant isolates. With frequent applications of DMIs fungicides in fields, the development of DMIs fungicide resistance is a major challenge for diseases effective control of the fruit planting in China. It is suggested that the appropriate management strategies of fungicide resistance should be used, such as reducing the usage of DMIs fungicides combining and alternative fungicides with distinct modes of action that have not been found to cross-resistance for better management of SER. For the control of L. theobromae, mixtures of difenoconazole and other chemical fungicides, as well as the botanical fungicide Thymol, have been reported to be particularly effective38. These managements can reduce pathogen population selection pressure, slowing the development of DMI resistance.
The target site of action of DMIs is the enzyme CYP51. The point mutations of CYP51 gene changes the conformation of the target protein, resulting in the decrease of the binding ability of fungicides to the target protein. Moreover, many point mutations in CYP51 gene of various plant diseases have also been found39–41. Additionally, mutations and overexpression of CYP51 gene have been observed simultaneously in some DMIs-resistant isolates of plant pathogens17,42,20. An increase in DMI fungicide application dosages would not improve their efficacy in the case of mutation. In this study, two point mutations E209K and G207A, were found in LtCYP51 in a sensitive isolates YC70, and the point mutation E209K were found in a resistant isolates YC80 with the same as one found in YC70. We concluded that point mutation of L. theobromae maybe not the cause of low-level resistance to difenoconazole. Although most research studies claim that target site change caused resistance in the majority of DMIs resistance isolates, additional resistance mechanisms cannot be ruled out. Our study showed that overexpression of LtCYP51 of resistant isolates was observed in response to difenoconazole. This is consistent with what has been found in Mycosphaerella graminicola of wheat, Blumeriella jaapii of cherry and Neophysopella meliosmae-myrianthae of grapevine30,43,44. Overexpression of CYP51 caused by promoter insertions or retrotransposons has only been described in a few phytopathogenic fungi so far. For example, a 199-bp sequence duplication was discovered at the promoter of CYP51 of Penicillium digitatum45. However, underlying mechanisms of CYP51 overexpression are not known for in the field DMI-resistant subpopulations of Puccinia triticina39, Sclerotinia homoeocarpa46, Pyrenophora teres17, Colletotrichum gloeosporioides16, Botrytis cinerea37. We tried to clone and sequence analysis the promoter of LtCYP51 in this study. However, the promoter of LtCYP51 from difenoconazole-resistant L. theobromae isolates did not show any mutations or insertions. The molecular mechanism of LtCYP51 overexpression needs further investigation.
In brief, DMIs have diminished sensitivity in field populations due to their long-term and intensive use. In the mango fields of China, Hainan Province, L. theobromae has acquired a low to moderate difenoconazole resistance. Although there existed obvious positive cross resistance between difenoconazole and tebuconazole, no cross-resistance was found between difenoconazole and non-DMI fungicides. Control measures such as rotation and mixture treatments with different modes of action fungicides can reduce the emergence of resistant isolates in the field. Compared with the difenoconazole-sensitive isolates, there were no mutations in the CYP51 gene of resistant isolates at position 132, 137 or any others (markers for resistance in DMIs fungicides). However, induced expression of CYP51 of resistance isolates is involved in the resistance to difenoconazole. In the future, more research work should focus on exploring the mechanisms that induce CYP51 expression in L. theobromae. Improved knowledge of fungicide resistance evolution and of the molecular mechanisms by which this occurs will be necessary to implement suitable control strategies that will reduce the likelihood of fungicide resistance outbreaks. Our findings are critical for controlling the high-risk pathogen L. theobromae and would help to slow down or even prevent the emergence of DMIs fungicide resistance.
C.W. participated in research design, laboratory experiments, statistical analysis and writing of the paper. L.X. participated in research design, data interpretation, and writing of the paper. X.L. participated in laboratory experiments and revision the paper. J.W. and X.X. participated in laboratory experiments. Y.Z. participated in research design, data interpretation, and writing of the paper. Y.Y. participated in research design, data interpretation and writing of the paper, supervised the project. All authors reviewed the manuscript.
The study was supported by the National Natural Science Foundation of China (Grant No.: 31560521).
The authors declare no competing interests.
the use of plants parts in the present study complies with Regulations of the people's Republic of China on the protection of wild plants