Molecular Characterization of E. Histolytica Strains Based on the Serine Rich Entamoeba Histolytica Protein (Srehp) And Chitinase Genes.

Abstract

BACKGROUND: Even though E. histolytica is recognized as an effective pathogen, what determines the outcome of this infection is still not well understood. The present study was carried out to determine the genetic characteristics of E. histolytica isolates from two different regions in South Africa.

METHOD: Diarrheal and non-diarrheal stool samples were collected from patients of all ages from Giyani and Pretoria. Different PCR protocols were used to identify E. histolytica and amplify the serine rich E. histolytica protein (SREHP) and chitinase genes. The profiles obtained were compared among the different samples.

RESULTS: Out of 111 stool samples collected, 51 were positive by either PCR or microscopy and 14 samples were positive by both methods. The serine- rich E. histolytica protein was amplified in 26 samples. Out of the 26 samples (19) different SREHP profiles were obtained. SREHP #2 was obtained in 5 different samples, 4 from Pretoria and 1 from Giyani (2 diarrheal and 3 non-diarrheal). The chitinase gene was amplified from 51 samples and 22 different chitinase profiles were obtained. Of all the profiles, profile #4 was found in 6 different isolates, 5 from Giyani and 1 from Pretoria (3 symptomatic and 3 asymptomatic). However, profile # 18 was only found in formed stools from Giyani.

CONCLUSIONS. The results obtained in this study have further confirmed the genetic heterogeneity of E. histolytica for the SREHP and chitinase genes which might have a significant influence in the outcome of amebic infection, depending on the genetic profile of the infecting strain.

Background

Entamoeba histolytica is an anaerobic parasite known as the most common pathogenic parasite in the genus entamoeba, and is the major cause of morbidity and mortality in both humans and animals [1]. It is estimated that 50 million people get invasive amebiasis every year due to E. histolytica [2, 3]. The organism may colonize the host’s bowel system for years without inducing clinical symptoms of the disease, in most cases, only 10% of the infected individuals develop symptomatic diseases and the remaining 90% do not show symptoms [4–6]. In symptomatic patients, the trophozoites may spread to extra- intestinal organs such as lungs, brain and liver, which results in liver abscess [7]. It remains puzzling why only a subset of infected individuals develops invasive diseases. Therefore, the factors that govern the transition from colonization to invasion remain to be answered.

Some studies suggests that this may be due to the differences in the pathogenic capability of the infecting strains [8], or due to the differences in the host immune response against the infection [9]. One of the possible explanations for this is that genetic subgroups exist within E. histolytica that give rise to infection with different outcomes [6]. However, the role of genetic diversity within E. histolytica to human disease is not clear. Another study has shown that the structural specificity of the genome might play an important role in the genetic variability of E. histolytica and possibly its strain related virulence [10]. Understanding the nature of amoebic virulence is important, several studies have shown that the genetic factors do influence the virulence of the infection. Among the many loci used to investigate the epidemiology of E. histolytica, Chitinase and SREHP are among the important markers used in molecular epidemiological studies [11].

Different types of genes associated with the outcome of amebic infection have been detected, Among the many loci used to investigate the outcome of E. histolytica infection, SREHP and chitinase are one of the important markers used in these studies [11]. These proteins have been shown to be potentially useful for determination of intra-species variation among E. histolytica and in investigating the molecular epidemiology of amebiasis. The genetic loci can be targeted to help in the study of the E. histolytica strains and their relationship with the parasite virulence and the disease outcome [12]. A study in Limpopo province, had indicated that certain SREHP profiles might be responsible for the presentation of intestinal amoebic symptoms [13]. Therefore, linking parasite diversity and gene will help in the understanding of parasite virulence and pathogenesis. To date, only few studies have been conducted on the impact of the parasite genotypes on the outcome of amebic infection, especially in the Limpopo and Gauteng provinces of South Africa. Therefore, the present study sought to detect if the genes associated with the outcome of infection, may help to understand the variability in disease presentation.

Materials And Methods

Ethical considerations.

This study was approved by the research and ethics committee of the University of Venda and the Department of Health and Welfare in Polokwane, Limpopo province of South Africa. The study was also approved by the ethical committee of the hospital where the stool samples were collected. The objectives and concepts of the study were clearly explained to the potential participants and signed consent forms were obtained before a participant was enrolled in the study. Confidentiality of the participants was kept by giving each sample a code and their information was kept confidential.

Study sites.

The study was conducted in Giyani and Pretoria in South Africa. Giyani is located at the Northern part of Limpopo. This area is rural with people of different religious, educational and socio-economic backgrounds, living in neighborhoods with distinctly different level of sanitation. Pretoria is a city in the northern part of Gauteng Province, South Africa. It is one of the country's three capital cities. It covers an area of 1,644 km² of the total surface area of Gauteng province. The samples were collected from patients attending different private clinics in Pretoria.

Sample collection

A total of one hundred and eleven (111) stool samples (Both diarrheal and non-diarrheal) were collected from the two areas. Eighty-four (84) stool samples were from Giyani and twenty-seven (27) samples were from Pretoria. The samples were put in a sterile wide screw cap container and kept in cooler box with ice packs (4⁰C) and transported to the Parasitology laboratory at the University of Venda for further analysis. Upon arrival at the laboratory, all the samples were observed under a light microscope for the presence of E. histolytica cysts or trophozoites, the samples were then aliquoted and stored at -80⁰C for further analysis.

Data collection.

At the time of sample collection, demographic as well as some clinical data were collected using a questionnaire. Information collected included origin, age, and sex. Information on the type of sample was also collected (loose, bloody, watery, or mucous).

Detection of E. histolytica cysts and trophozoites in fecal specimens by microscop y

All fecal samples were screened for Entamoeba cysts by microscopy. A portion of each unpreserved stool specimen was placed on a glass slide and iodine was added to the stool smears and covered with a coverslip and examined under a light microscopy at 40x magnification. The identification of E. histolytica was based on morphologic characteristics of the cysts and trophozoites. Fecal samples containing amebic cells were stored at -20ºC until DNA extraction was performed.

Extraction of total genomic DNA from stool samples.

Total genomic DNA of E. histolytica was purified from the stool specimens. The fecal samples were subjected to QIAaMP DNA stool mini kit (QIAGEN, Hilden, Germany). The extraction procedure was performed following the manufacturer’s instructions. The DNA was kept frozen at -20ºc until needed for amplification analysis [14].

Identification of Entamoeba species by PCR.

The detection of E. histolytica was performed using genus- specific primers (E1 and E2) and E. histolytica (EH1 and EH2) primers (15) (Table 1). In the initial PCR, the amplification was carried out in a total of 25µl reaction volume containing 12.5 µl of dreamtaq, 0.25µl of BSA, 0.6µl of each primer and 6.05µl deionized water. An amount of 5µl stool DNA was mixed with 20µl of master mix to a final volume of 25 µl. The cycling conditions were as follows: initial denaturation at 96ºC for 2 minutes, followed by 35 cycles of PCR performed with denaturation at 92ºC for 60 seconds, annealing at 56ºC for 60 seconds and extension at 72ºC for 90 minutes and final extension 72ºC for 7 minutes. In the second round, the PCR product was used as a template with the same cycling conditions, except the annealing temperature which was changed to 60ºC (15). The PCR products were separated by electrophoresis in 1.5% agarose gel at 100 V for 45 min in Tris-acetate buffer and visualized by UV-transilluminator.

Genotyping of the Serine rich E. histolytica protein gene by PCR.

All the samples positive by PCR were used to amplify the serine rich protein of E. histolytica. The amplification was performed in 25 µl reaction mixture containing 12.5µl of dreamtaq, 0.6µl of each primer (SREHP1 and SREHP2) (Table 1), 0.25µl of BSA, 6.05 µl of nuclease free water and 5µl of genomic DNA. The cycling conditions were as follows: initial denaturation at 94⁰C for 5 minutes followed by 35 thermal cycles of 94⁰C for 1 minute, 48⁰C for 1 minute, and 72⁰C for 1 minute, followed by a final extension at 72⁰C for 5 minutes.

Genotyping of E. histolytica based on the chitinase gene.

The samples that were positive by PCR were selected for the amplification of the chitinase gene. PCR was performed in 25 µl reaction mixture containing 12.5µl of dreamtaq, 0.6µl of each primer (CEH1 and CEH2) (Table 1), 0.25µl of BSA, 6.05 µl of nuclease free water and 5µl of genomic DNA. The cycling conditions were as follows: initial denaturation at 94⁰C for 5 minutes followed by 35 thermal cycles of 94⁰C for 1 minute, 48⁰C for 1 minute, and 72⁰C for 1 minute, followed by a final extension at 72⁰C for 5 minutes.

Table 1

PCR primers used in this study.
GENE	PRIMER NAME	PRIMER SEQUENCE (5’-3’)
Entamoeba genus	E1	TAAGATGCACGAGAGAGCGAAA
Entamoeba genus	E2	GTACAAAGGGCAGGGACGTA-
E. histolytica	EH1	AAGCATTGTTTCTAGATCTGAG
E. histolytica	EH2	AAGAGGTCTAACCGAAATTAG
Serine-rich E. histolytica protein	SREHP1	GCTAGTCCTGAAAAGCTTGAAGAAGCTG
Serine-rich E. histolytica protein	SREHP2	GGACTTGATGCAGCATCAAG GT
Chitinase	CEH1	GGAACACCAGGTAAATGTATA
Chitinase	CEH2	GGTATCATTTGGTCATCATTCC-

Statistical analysis.

The results were entered into an excel spread sheet and edited appropriately (Microsoft office package) and analyzed using Statistical Package for the Social Sciences (SPSS for WINDOWS version 18.0). Assuming that, the data followed a normal distribution, comparison of proportions and statistical significance was tested using the Chi-square test. The genotype associations between the positive and negative groups were analyzed by using chi-square (χ²) analysis. A p-value of < 0.05 was considered statistically significant.

Results

Demographic data of the study population.

A total of one hundred and eleven (111) stool samples were tested in this study, of which 84 (75.7%) were from Giyani and 27 (24.3%) were from Pretoria. Of all the samples collected 50 (45.0%) were males and 61 (55.0%) were females. Most of the patients were aged between 0 to 25 (19.8%), followed by 6 (5.4%) patients aged 26 to 45, only 2 patients were aged 46 to 65 (1.8%) and the age of about 81 (73.0%) was unknown. A total 28 (25.2%) were formed, 69 (62.2%) loose and 14 (12.6%) were watery stools. (Table 2).

Table 2

Demographic data of the study population.
Characteristics		Frequency	Percent (%)
Origin	Giyani	84	75.7
Origin	Pretoria	27	24.3
Gender	Male	50	45.0
Gender	Female	61	55.0
Age group	0 to 25 years	22	19.8
	26 to 45 years	6	5.4
	46 to 65 years	2	1.8
	Missing system	81	73.0
Stool type	Formed	28	25.2
Stool type	Loose	69	62.2
Watery	14	12.6
Microscopy	Positive	52	46.8
	Negative	59	53.1
Total		111	100.0

Detection of Entamoeba histolytica by microscopy and PCR.

Out of 111 stool samples tested, 46 (41.4%) were negative by both microscopy and PCR, 51(45.9%) positive by either method (microscopy or PCR) and 14 (12.6%) samples were positive by both methods (microscopy and PCR). Figure 1 shows the samples positive for Entamoeba amplified by EH1 and EH2 primers with the product size of 450bp.

Genetic diversity of Entamoeba histolytica based on the SREHP profiles.

Out of the 111 stool samples tested, the SREHP1 and SREHP2 primers specifically amplified the serine- rich E. histolytica protein gene in 19 samples. The product size of 550 and 700bp were obtained with other additional amplicons of 150, 200, 250,300, 400, 600 and 1000bp (Figure 2, A and B).

Genetic diversity of E. histolytica in stool samples from Giyani and Pretoria.

Out of the 65 samples positive for E. histolytica by either PCR or microscopy, the SREHP successfully amplified 26 samples. The SREHP PCR reaction gave different banding patterns (Tables 3 and 4). Table 4 Clearly shows the distribution of the SREHP genetic profiles in the study population. The band sizes varied between 210bp and 1600bp, the bands-300, 500, 400 and 600 were seen in most of the samples. This amplification revealed 19 SREHP profiles out of the 26 samples positive for the SREHP. Twenty-two (22) isolates were from Giyani and 4 from Pretoria. Profile #2 was observed in 3 different isolates, interestingly, these isolates were from the same area (Giyani), these patients may possibly have been infected with the same strain, however, according to the observations of this study, this profile is not related to diarrhea, since it was found in patients with formed stools. Another profile (#18) was found mostly in isolates from Pretoria and in one isolate from Giyani, two of the isolates were symptomatic and the other 4 were asymptomatic. Therefore, this profile, is more distributed in Pretoria than Giyani and it was related to diarrhea since it was found in samples with diarrhea.

Table 3

Samples that generated the Serine Rich *E. histolytica* genetic profiles
sample code	origin	gender	stool type	SREHP banding pattern	SREHP profiles1
MS40	Giyani	male	formed	210	1
MS 29	Giyani	female	formed	300	2
MS 32	Giyani	male	loose	300	2
MS1	Giyani	female	formed	300	2
MS44	Giyani	female	loose	500	14
MS2	Giyani	female	loose	600	3
MS33	Giyani	female	loose	700	4
NS 07251	Pretoria	male	watery	400 ^f	5
MS34	Giyani	female	soft	210^f, 300^f, 400, 500	6
MS43	Giyani	male	formed	210, 350, 500^f 600 ^f 700	7
MS42	Giyani	female	formed	300 ^f 500 ^f 800	8
MS3	Giyani	female	loose	300^f, 1200	9
MS 21	Giyani	female	loose	300, 700 ^f	10
MS8	Giyani	female	formed	350 ^f 500 ^f	11
MS38	Giyani	female	loose	350 ^f 600	12
MS45	Giyani	male	formed	400 ^f	5
NS 07994	Pretoria	male	watery	400 ^f	5
NS08850	Pretoria	male	loose	400 ^f	5
NS08605	Pretoria	female	loose	400 ^f	5
MS4	Giyani	male	loose	400, 600 ^f 1000	13
MS41	Giyani	female	loose	500 ^f 1600 ^f	14
MS23	Giyani	male	loose	500^f 800	15
MS7	Giyani	male	loose	600 ^f 1200	16
MS 46	Giyani	male	loose	600 ^f 500	17
MS36	Giyani	female	loose	600, 1600	18
MS28	Giyani	female	formed	700 ^f	19
Note: Major bands obtained after the amplification the SREHP gene. ^fFaint

Table 4

Distribution of the SREHP genetic profiles in the study population
	Sample origin		Total	Sex groups		stool group
SREHP profiles1	Giyani	Pretoria		Male	Female	Formed	Lose	Watery
1.0	1	0	1	1	0	1	0	0
2.0	4	0	4	1	3	2	2	0
3.0	1	0	1	0	1	0	1	0
4.0	1	0	1	0	1	0	1	0
5.0	1	4	5	4	1	1	2	2
6.0	1	0	1	0	1	0	1	0
7.0	1	0	1	1	0	1	0	0
8.0	1	0	1	0	1	1	0	0
9.0	1	0	1	0	1	0	1	0
10.0	1	0	1	0	1	0	1	0
11.0	1	0	1	0	1	1	0	0
12.0	1	0	1	0	1	0	1	0
13.0	1	0	1	1	0	0	1	0
14.0	1	0	1	0	1	0	1	0
15.0	1	0	1	1	0	0	1	0
16.0	1	0	1	1	0	0	1	0
17.0	1	0	1	1	0	0	1	0
18.0	1	0	1	0	1	0	1	0
19.0	1	0	1	0	1	1	0	0
	22	4	26	11	15	8	16	2
Total	84.6%	15.4%	100.0%	42.3%	57.7%	30.8%	61.5%	7.7%

Molecular characterization of E. histolytica based on the chitinase gene.

Out of the stool samples tested, the CEH1 and CEH2 (Chitinase) primers specifically amplified the chitinase and band sizes varying between 100 and 1,200bp (Fig. 3A and B) were obtained with other additional amplicons of 200, 300, 400, 600 and 1000bp.

Out of the 65 samples positive for E. histolytica by both PCR and microscopy, the chitinase successfully amplified 59 samples out of the 65 samples tested. The chitinase PCR reaction gave different banding patterns as represented in Table 5 and 6 below. Table 7 Clearly shows the distribution of the chitinase genetic profiles in the study population. This amplification revealed 22 SREHP profiles out of the 59 samples positive for the chitinase. Forty-seven (47) isolates were from Giyani and 12 from Pretoria. Profile #4 was observed in 6 different isolates, 5 of these isolates were from the same area (Giyani), and 1 from Pretoria. The profile is distributed in both the areas, but more diverse in Giyani.

Table 5

Summary of the samples that produced the chitinase gene profiles.
Sample code	Origin	gender	stool type	Chitinase banding pattern	chitinase profile No
GY 48	Giyani	female	loose	200	1
NS 1080	Pretoria	female	formed	300	2
MS40	Giyani	male	formed	350	3
HS 123	Giyani	male	loose	500	4
HS 121	Giyani	female	watery	500	4
NS 09598	Pretoria	Female	loose	500	4
GY 193	Giyani	female	watery	500	4
GY 41	Giyani	male	loose	500	4
HS 48	Giyani	male	loose	500	4
GY 04	Giyani	female	loose	800	5
NS08033	Pretoria	Female	loose	100^f, 300, 400	6
NS 05219	Pretoria	male	loose	150^f, 500	4
MS28	Giyani	female	formed	150, 200 ^f, 600	7
NS 1039	Pretoria	female	loose	200 ^f	1
HS 39	Giyani	female	formed	200 ^f, 250 ^f	1
GY 45	Giyani	male	loose	200 ^f, 250 ^f	1
HS 29	Giyani	female	loose	200 f 250 ^f	1
HS 21	Giyani	male	formed	200 ^f ,250 ^f, 900 ^f	1
NS 03183	Pretoria	female	loose	200 f 400 ^f	1
MS30	Giyani	female	loose	200, 250 ^f, 500, 600	8
NS 0170	Pretoria	male	loose	200, 300	9
MS 29	Giyani	female	formed	200, 300^f, 500, 600	8
MS7	Giyani	male	loose	200, 300 ^f, 400	10
MS34	Giyani	female	soft	200, 300, 400	10
MS36	Giyani	female	loose	200, 300, 400	10
NS 05951	Pretoria	female	watery	200, 350	11
MS4	Giyani	male	loose	200, 350 f, 600 ^f	11
MS2	Giyani	female	loose	200, 350, 400 ^f	11
MS5	Giyani	female	loose	200, 350, 500	11
MS38	Giyani	female	loose	200, 500 ^f	1
HS 38	Giyani	female	watery	250 ^f, 700 ^f	12
HS 39	Giyani	female	watery	250, 300 ^f	12
HS 37	Giyani	male	formed	250, 300 ^f	12
MS37	Giyani	male	formed	250, 300, 400, 500 ^f	10
Note: Major bands obtained after the amplification of chitinase gene. ^fFaint.

Table 6

Summary of the samples that produced the chitinase gene profiles.
sample code	origin	gender	stool type	Chitinase banding pattern	chitinase profile No
NS 0597	Pretoria	male	watery	300 ^f	13
GY 42	Giyani	female	loose	300 ^f	13
GY 20	Giyani	female	loose	300 ^f	13
HS 44	Giyani	male	loose	300 ^f	13
MS33	Giyani	female	loose	300 ^f, 350, 600 ^f	14
NS07994	Pretoria	male	watery	300 ^f, 400 ^f	13
NS 1085	Pretoria	male	loose	300 ^f, 400 ^f	13
GY 25	Giyani	female	soft	300 ^f, 400 ^f	13
MS 32	Giyani	male	loose	300 ^f, 500	15
HS 40	Giyani	male	formed	300 ^f, 600 ^f	16
MS42	Giyani	female	formed	300, 600	16
MS39	Giyani	female	loose	300, 600	16
MS 21	Giyani	female	loose	350, 600	17
MS43	Giyani	male	formed	400 ^f	18
MS45	Giyani	male	formed	400 ^f	18
GY 44	Giyani	female	formed	400 ^f, 900 ^f	18
GY 01	Giyani	male	formed	400 ^f, 900 ^f, 1200	18
MS6	Giyani	female	formed	400, 700 ^f	18
MS8	Giyani	female	formed	500, 400 ^f	19
MS1	Giyani	female	formed	500, 600, 300, 350	20
MS44	Giyani	female	loose	600 ^f 700, 1000	21
GY 02	Giyani	female	loose	700 ^f, 800 ^f, 900	22
NS 03124	Pretoria	female	loose	800 ^f	5
GY 03	Giyani	male	formed	800 ^f, 900	22
HS 42	Giyani	female	loose	900 ^f, 1000 ^f	22
Note: Major bands obtained after the amplification of the chitinase gene. ^fFaint.

Table 7

Distribution of the chitinase gene profiles in the study population
	Sample origin		Total	Sex groups		stool group
chitinase profile No	Giyani	Pretoria		Male	Female	Formed	Lose	Watery
1	6	2	8	2	6	2	6	0
10	4	0	4	2	2	1	3	0
11	3	1	4	1	3	0	3	1
12	3	0	3	1	2	1	0	2
13	4	3	7	4	3	0	5	2
14	1	0	1	0	1	0	1	0
15	1	0	1	1	0	0	1	0
16	3	0	3	1	2	2	1	0
17	1	0	1	0	1	0	1	0
18	5	0	5	3	2	5	0	0
19	1	0	1	0	1	1	0	0
2	0	1	1	0	1	1	0	0
20	1	0	1	0	1	1	0	0
21	1	0	1	0	1	0	1	0
22	3	0	3	1	2	1	2	0
3	1	0	1	1	0	1	0	0
4	5	2	7	4	3	0	5	2
5	1	1	2	0	2	0	2	0
6	0	1	1	0	1	0	1	0
7	1	0	1	0	1	1	0	0
8	2	0	2	0	2	1	1	0
9	0	1	1	1	0	0	1	0
	84	27	111	50	61	28	69	14
	75.7%	24.3%	100 %	45 %	55 %	25.2%	62.2%	12.6%

Discussion

The main objective of the present study was to determine the molecular epidemiology of E. histolytica in Giyani and Pretoria and to elucidate the impact of parasite genetics on amebic infection. As a screening method, microscopy was used to examine all the samples for the presence of Entamoeba cyst [16, 17], and of the 111 samples screened, 65 samples were positive. The main aim of the screening was to check the presence of the entamoeba cyst in the samples. In fact, people in our study communities are often infected with different types of parasitic organisms not only entamoeba. Similar microscopy findings have been reported [14].

However, the limitation about microscopy is that it is not reliable and cannot be used to differentiate species. Therefore polymerase chain reaction is mostly used as the gold method to further confirm the microscopy results as well as to differentiate between species [16, 17]. Entamoeba species are undistinguishable by microscopy, for example, the morphology of Entamoeba histolytica and dispar is the same and microscopy cannot differentiate these two organisms, hence the present study used the PCR based method to specifically detect E. histolytica and to avoid possible false positive results. The PCR results of this study showed that E. histolytica is prevalent in the study population.

All the samples that were positive by both methods (Microscopy and PCR), were used to study the genetic diversity of Entamoeba histolytica based on the SREHP and chitinase genes. The SREHP gene successfully amplified 19 isolates out of 65 E. histolytica positive samples. Some of the isolates successfully amplified for the 700bp SREHP gene, while the other isolates amplified additional amplicons of approximately 300, 400,500, 600, 800 and 1200bp. The result obtained in this study are not very far from the ones obtained in United Arab [18] and in the Thai/Myanmar border region [14]. However, our study showed a high number SREHP profiles compared to these studies. These profiles were also different from those obtained previously [13, 19, 20]. The obtained profiles were compared with the stool type, and it was found that three asymptomatic patients from Giyani were infected with the same profile (#2), suggesting that this profile might be associated with the asymptomatic carriage of the parasite and may not be the cause of diarrheal infections in the study population since it was only obtained in asymptomatic patients. Another profile (#5) was detected in both the locations (Giyani and Pretoria) from symptomatic and asymptomatic patients, one symptomatic and asymptomatic (Giyani), two asymptomatic and one symptomatic (Pretoria). The results analysis shows that this profile was more prevalent in Pretoria than in Giyani, with high distribution in males than females. These finding corroborated previous findings in a study carried out in Japan, which concluded that all isolates from different mental institutions were derived from a single source of E. histolytica [21]. Similar results were obtained in United Arab, where the same profile was shown in four isolates [18].

Clustering of profiles from the same region (Giyani) was also obtained in the present study and no clustering was obtained from Pretoria isolates. The patients from Pretoria were mostly infected with one profile, which is profile no 2. The results obtained in the present study indicate that there is a possibility of the existence of the same strain infecting individuals from the same region. Due to the small sample size used in this study (65) the profile number were low compared to the profile numbers obtained by previous studies [13, 19]. The results of this study suggest that the SREHP might have a role in the outcome of amebic infection depending on the infecting profile. It is also possible to use the profiles for tracing the sources of contamination in a community.

The chitinase gene was also used to study the genetic diversity and molecular epidemiology of E. histolytica in the study population. In general, little is known about the extent of intestinal parasitic infections in Limpopo and Gauteng province, especially in Giyani and Pretoria, and no reports have been published on the genetic diversity of E. histolytica based on the chitinase gene in Limpopo and Gauteng. Therefore, we are reporting for the first time the diversity of this parasite based on the chitinase gene in these two areas.

The chitinase gene successfully amplified 22 isolates from 65 positive isolates included in the study. The target bands of 500 and 1200bp were obtained in a few isolates, with some additional amplicons of approximately 200, 300, 400, 500, 600, 800, 900 and 1000bp. The obtained bands in this study are similar with the bands obtained by other studies [14]. The high number of the chitinase profiles observed in this study is an indicative that E. histolytica is prevalent in the study population. High diversity of the chitinase profiles were obtained mostly in Giyani than Pretoria.

Interestingly, the results of this study showed that five asymptomatic patients (formed stools) from Giyani were infected with the same profile (#18), of these five patients 3 were males and 2 were females. This profile was not associated with diarrhea since it was obtained only in asymptomatic patients, further confirming that the presentation of amebic infection depends on the profile of the infecting organisms. Another interesting finding of this study is the occurrence of the same profile in different isolates of different gender from different geographic areas. Six different isolates, one asymptomatic isolate from Pretoria, two symptomatic (watery stool) and three asymptomatic (formed) isolates from Giyani.

The result of this study reinforces that the polymorphic loci (chitinase) could serve as a tool to determine the diversity of E. histolytica and to finger printing individual isolates [22]. The findings of the same profiles affecting individuals in the same area was also reported in United Arab Emirates [18]. Clustering of profiles was observed in both study sites, indicating that some patients were infected with more than one profile. Concerning the geographical distribution, the most occurring profiles, 18 and 4, were more distributed in Giyani compared to Pretoria.

In conclusion, the prevalence of E. histolytica in this study is of public health significance and if appropriate care is not taken, it could result in epidemic situation. The finding that this parasite affects young and old people opens a new dimension to understand the source of infection in the African setting. It is therefore recommended that the populations living in the study areas be educated properly on hygiene more especially on personal hygiene. The results obtained in this study have further confirmed the genetic heterogeneity of E. histolytica for the SREHP and chitinase genes which might have a significant influence in the outcome of amebic infection, depending on the genetic profile of the infecting strain. Therefore, more studies are needed to understand in depth the role of these profiles in the outcome of amebic infection.

Abbreviations

DNA

Deoxyribonucleic acid

Percentage

°C

Degrees Celsius

µl

Micro liter

Base pairs

BSA

Bovine serum albumin

Kilobase

PCR

Polymerase Chain Reaction

SREHP

Serine –rich E.histolytica protein.

Declarations

ACKNOWLEDGEMENTS

We thank the University of Venda, the Department of Health and Welfare, and participating hospitals and clinics, for giving us the permission to collect samples, and the patients, for their cooperation throughout the study. The National Research Foundation of South Africa and the University of Venda Research and Publication committee for funding the study.

Funding

This work was supported by the National Research Foundation of South Africa (award 95292 to R. N.) and the University of Venda Research and Publication.

Availability of data and materials

All data is presented in this article is available upon request from the corresponding author (Ngobeni R)

Author’s contributions

Renay Ngobeni contributed to study design, performed the experiments, results analysis, and manuscript writing. Amidou Samie contributed to study design, data analysis, manuscript reviewing. Furthermore, both the authors have read and approved the final manuscript.

Ethics approval

Consent for publication

Not applicable

Competing interest

The authors declare that they have no competing interests.

References

Elsheikha HM, Regan CS, Clark CG. Novel Entamoeba Findings in Nonhuman Primates. Trends in Parasitology. 2018. doi:10.1016/j.pt.2017.12.008.
Ximénez C, Cerritos R, Rojas L, Dolabella S, Morán P, Shibayama M, et al. Human amebiasis: Breaking the paradigm? Int J Environ Res Public Health. 2010. doi:10.3390/ijerph7031105.
Petri WA, Singh U. Diagnosis and Management of Amebiasis. Clin Infect Dis. 1999;29:1117–25.
Gilchrist CA, Ali IKM, Kabir M, Alam F, Scherbakova S, Ferlanti E, et al. A multilocus sequence typing system (MLST) reveals a high level of diversity and a genetic component to Entamoeba histolytica virulence. BMC Microbiol. 2012;12(1):1.
Kantor M, Abrantes A, Estevez A, Schiller A, Torrent J, Gascon J, et al. Entamoeba Histolytica: Updates in Clinical Manifestation, Pathogenesis, and Vaccine Development. Can J Gastroenterol Hepatol. 2018. doi:10.1155/2018/4601420.
Singh A, Banerjee T, Kumar R, Shukla SK. Prevalence of cases of amebic liver abscess in a tertiary care centre in India: A study on risk factors, associated microflora and strain variation of Entamoeba histolytica. PLoS One. 2019. doi:10.1371/journal.pone.0214880.
Wuerz T, Kane JB, Boggild AK, Krajden S, Keystone JS, Fuksa M, et al. A review of amoebic liver abscess for clinicians in a nonendemic setting. Can J Gastroenterol. 2012. doi:10.1155/2012/852835.
Burch DJ, Li E, Reed S, Jackson TFHG, Stanley SL. Isolation of a strain-specific Entamoeba histolytica cDNA clone. J Clin Microbiol. 1991;29(4):696–701.
Ngobeni R, Samie A, Moonah S, Watanabe K, Petri WA, Gilchrist C. Entamoeba Species in South Africa: Correlations with the Host Microbiome, Parasite Burdens, and First Description of Entamoeba bangladeshi Outside of Asia. J Infect Dis. 2017. doi:10.1093/infdis/jix535.
Loftus B, Anderson I, Davies R, Alsmark UCM, Samuelson J, Amedeo P, et al. The genome of the protist parasite Entamoeba histolytica. Nature. 2005;433(7028):865–8.
Mahmood SAF, Bakr HM. Genetic variability of E. histolytica strains based on the polymorphism of the SREHP gene using nested PCR-RFLP in Erbil, North Iraq. Cell Mol Biol. 2020. doi:10.14715/cmb/2019.66.1.14.
Paul J, Srivastava S, Bhattacharya S. Molecular methods for diagnosis of Entamoeba histolytica in a clinical setting: An overview. Exp Parasitol. 2007. doi:10.1016/j.exppara.2006.11.005.
Samie A, Obi CL, Bessong PO, Houpt E, Stroup S, Njayou M, et al. Entamoeba histolytica: Genetic diversity of African strains based on the polymorphism of the serine-rich protein gene. Exp Parasitol. 2008. doi:10.1016/j.exppara.2007.09.008.
Intarapuk A, Kalambaheti T, Thammapalerd N, Mahannop P, Kaewsatien P, Bhumiratana A, et al. Identification of Entamoeba histolytica and Entamoeba dispar by PCR assay of fecal specimens obtained from Thai/Myanmar border region. Southeast Asian J Trop Med Public Health. 2009;40(3):425–34.
Khairnar K, Parija SC. A novel nested multiplex polymerase chain reaction (PCR) assay for differential detection of Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples. BMC Microbiol. 2007. doi:10.1186/1471-2180-7-47.
Van Den Broucke S, Verschueren J, Van Esbroeck M, Bottieau E, Van den Ende J. Clinical and microscopic predictors of Entamoeba histolytica intestinal infection in travelers and migrants diagnosed with Entamoeba histolytica/dispar infection. PLoS Negl Trop Dis. 2018. doi:10.1371/journal.pntd.0006892.
Saidin S, Othman N, Noordin R. Update on laboratory diagnosis of amoebiasis. Eur J Clin Microbiol Infect Dis. 2019;38:15–38.
ElBakri A, Samie A, Ezzedine S, Odeh RA. Genetic variability of the Serine-Rich Entamoeba histolytica protein gene in clinical isolates from the United Arab Emirates. Trop Biomed. 2014;31(2):370–7.
Haghighi A, Kobayashi S, Takeuchi T, Thammapalerd N, Nozaki T. Geographic diversity among genotypes of Entamoeba histolytica field isolates. J Clin Microbiol. 2003. doi:10.1128/JCM.41.8.3748-3756.2003.
Ramos F, Moran P, Gonzalez E, Garcia G, Ramiro M, Gomez A, et al. High prevalence rate of Entamoeba histolytica asymptomatic infection in a rural Mexican community. Am J Trop Med Hyg. 2005;73(1):87–91.
Fu YF, Nagakura K, Cheng XJ, Tachibana H. Comparison of serine-rich protein genes of Entamoeba histolytica isolates obtained from institutions for the mentally retarded in Kanagawa and Shizuoka Prefectures, Japan. Parasitol Res. 2010. doi:10.1007/s00436-010-1954-3.
Zaki M, Clark CG. Isolation and characterization of polymorphic DNA from Entamoeba histolytica. J Clin Microbiol. 2001. doi:10.1128/JCM.39.3.897-905.2001.