Cell Culture
HMC-1 cells were cultured in IMDM with 100 U/ml of penicillin and streptomycin, and 10% fetal bovine serum (FBS) at 37 ̊C in 5% CO2. The cells were stimulated with 50 nM of phorbol 12- myristate 13-acetate (PMA) plus 1 μM of A23187 (calcium ionophore) and incubated at 37 ̊C for 8 h.
The HDMECs were cultured in DMEM medium supplemented with 10% PBS, 100 U/mL of penicillin, and 100 U/mL of streptomycin. In this study, HDMECs were seeded in plates at 1 x 105 cells/cm2. After a 48-hour incubation, HDMECs were treated with recombinant human YKL-40 (10-500 ng/ml) or histamine plus YKL-40 (10-500 ng/ml) for different times.
Real-time quantitative PCR
HMC-1 cells were seeded in a 6-wells plate and then stimulated with 50 nM of PMA plus 1 μM of A23187 and incubated at 37 ̊C for 8 h. PBS were as controls. The mRNA levels of YKL-40 were determined by real-time quantitative PCR. Total RNA was extracted by Trizol reagent and the cDNA was synthesized from the total RNA by using RT reagent Kit with gDNA Eraser (Takara, Dalian, China). The following primers were used: YKL-40 (5-′AATTCGGCCTTCATTTCCTT -3′, and 5’-GATAGCCTCCAACACCCAGA-3’), GAPDH (5’-CGGAGTCAACGGATTTGGTC-3’ and 5’-CGGTGCCATGGAATTTGCCA-3’). The mRNA levels of YKL-40 were expressed as relative mRNA levels compared with control and determined by the 2-ΔΔCt method.
Measurement of vascular permeability
As described methods(15) , HDMECs were cultured on the upper chamber of transwell (Transwell membrane, 0.4 μM pore size; Corning Costar). After 48 h, the integrity and homogeneity of the endothelial monolayer were examined by microscope. The confluent monolayers were incubated with histamine (100 μmol/L), YKL-40 (500 ng/ml), histamine (100 μmol/L) plus YKL-40 (10-500 ng/ml) for 2 h. Antihistamine (loratadine or ranitidine, 10 μmol/L) were pretreated for 20 minutes. After treatment, FITC- dextran (1mg/ml) was added into the upper chambers, and fluorescence in the lower chamber was measured one hour later with fluorescence reader.
Assay for soluble VE-cadherin levels
Levels of soluble VE-cadherin in cultured supernatants of HDMECs were detected with Human VE-Cadherin ELISA Kit (Boster Biological Technology, Wuhan, China. Catalog #EK1317) according to the manufacturer’s instruction.
Immunofluorescence
The expression of VE-cadherin in HDMECs was detected by immunofluorescence. HDMECs, grown on glass coverslips, were treated with histamine (100 μmol/L), YKL-40 (500 ng/ml), histamine (100 μmol/L) plus YKL-40 (10-500 ng/ml) for 2 h. Antihistamine (loratadine or ranitidine, 10 μmol/L) were pretreated for 20 minutes. cells were fixed by 4% paraformaldehyde for 1h, and then incubated with VE-cadherin antibody at 4 ̊C overnight (1:50 dilution; Cell Signaling Technology). 4’-6-diamidino-2-phenylindole (DAPI) was used to counterstain the nuclei for 5 minutes. Fluorescence images were captured by laser scanning confocal microscopy (Olympus, Tokyo, Japan).
Western Blot Analysis
The expression of VE-cadherin, akt and mitogen-activated protein kinases (MAPKs) in HDMECs was measured by western blot. HDMECs were treated with histamine (100 μmol/L), YKL-40 (500 ng/ml), histamine (100 μmol/L) plus YKL-40 (10-500 ng/ml) for 15 min. Antihistamine (loratadine or ranitidine, 10 μmol/L) were pretreated for 20 minutes. After treatment, total protein was extracted. Protein samples of 40 mg were electrophoresed on 12% or 6% Tris-glycine gels, subjected to sodium dodecylsulfate polyacrylamide gel electrophoresis, and transferred to polyvinylidene fluoride membranes. Subsequently, membranes were incubated with primary antibody at 4 ̊C overnight and with the appropriate HRP-conjugated secondary antibody for 1 hour. The expression of VE-cadherin, akt and MAPKs (ERK, JNK and p38) was determined with enhanced chemiluminescence reagents. The results were normalized to the expression of β-actin.
Statistical analysis
The data showed in Table 1 and Figure1 were expressed as median ± interquartile range with Mann-Whitney test and Wilcoxon sign-rank test. Other datas were expressed as mean ± SD. One-way analysis of variance was used to compare statistical differences between groups. P < 0.05 was set as the statistically significant.