Fungal- collection, isolation and DNA extraction
Wheat infected leaves were collected from different region of India. For the isolation of the pathogen, infected leaves were surface sterilized and necrotic lesions were cut into smaller fragments. These fragments were washed with 0.1% sodium hypo chlorite (NaOCl2) solution, followed by washing with water 2 times. To induce sporulation, these fragments were placed on PDA (potato dextrose agar) under a 12-h photoperiod at room temperature (RT). Several single spores from each of the PDA plates transferred to another PDA plates and allow to grow at 25°C. Meanwhile, these spores are observed in microscope and fungus was identified based on conidia and its morphology [32].
Thirty nine isolates of B. sorokiniana were established from infected wheat leaf samples collected from different regions of India. These cultures were grown in potato dextrose broth (PDB) and incubated at 250C with periodical shaking. After 25 days the mycelial mats (0.2 g) from each isolates was harvested aseptically and snap frozen in liquid nitrogen. Frozen mycelia were subjected to DNA extraction using CTAB method [33]. Then, the quantity and quality were assessed using a Qubit® 2.0 Fluorometer (Thermo Fisher Scientific, Wilmington, USA) and agarose gel electrophoresis respectively. Genomic DNA of BS112 (ITS NCBI accession- KU201275) was sent to Genotypic Technology (P) Ltd. for genome sequencing using hybrid genome assembly through Ilumina, Nano pore and Ion-torrent platforms.
Genome sequencing and hybrid assembly
The genome of B. sorokiniana was sequenced by using Illumina Hiseq, Oxford Nanopore sequencing and Ion-Torrent platform technologies. The fungal hybrid assembly is the main aim of the project. The Illumina reads were pre-processed using Trim-galore [34], and Nano pore fast5 data were base called using Albacore [35]. Hybrid genome assembly was created using these three types of sequenced reads. Kmer analysis will not require in hybrid assembly because the internal long read algorithm was based on overlap layout consensus (OLC). For hybrid assembly MaSuRCA tool [36] is used and output of the hybrid assembly of genome is 35.64Mb. Later using pyScaf, the contigs were processed [37]. The paired end library data was generated using Illumina HiSeq platform.
Gene prediction, annotation and pathway analysis
Genes was predicted in the genome of B. sorokiniana using AUGUSTUS annotation tool [38]. A total of 10,460 genes were projected with an average gene length of 435-545 bp on the basis of B. sorokiniana ND90Pr as reference genome. Maximum gene length of 8,506 and minimum gene length of 35 was identified.
Functional annotation of genes were performed using BLASTx tool [39]. The predicted proteins were similarity searched against fungal protein database using ncbi-blast-2.2.29+ blastp program with an e-value of 1e-5 for gene ontology and annotation. Around 98% of predicted genes were annotated against the protein database. The proteins were annotated against all Viridi plantae kingdom protein sequences (from Uniprot Protein Database). Further analysis, those proteins with more than 30% identity as cut off were taken. The gene annotation was done by fungal hybrid assembly in biological, chemical and molecular functions. The pathway analysis of the predicted genes was performed through KEGG database [40].
Phylogenetic analysis of B. sorokiniana genomes
Based on whole-genome alignment, Progressive Mauve version 20150213 build 0 with default parameters was used to execute phylogenetic analysis [41]. Five species of Bipolaris namely B. sorokiniana/ Cochliobolus sativus, Bipolaris maydis/ Cochliobolus heterostrophus, B. oryzae/ Cochliobolus miyabeanus , B. zeicola/ Cochliobolus carbonum and B. victoriae/ Cochliobolus victoriae; two isolates of B. sorokiniana namely B. sorokiniana/ Cochliobolus sativus (ND90Pr), B. sorokiniana/ Cochliobolus sativus query sample (BS112) and one isolate of Pyrenophora tritici-repentis (outgroup) were taken for the multiple genome alignment. Through neighbor joining tree, comparative analysis was performed on all six genomes. The guide tree was an output of multiple sequence alignment in Mauve. The phylogenetic trees were constructed using the guide tree in phylogeny.
Comparative genome annotation of orthologous gene families
The orthologous gene families among the Bipolaris species GCA_000527765.1, GCA_000523455.1, GCA_000523435.1 were identified using OrthoVenn. Comparison among these species revealed 8674 gene families in common.
SNP (Single Nucleotide Polymorphism) and SSR (Simple Sequence Repeat) analysis
SNP prediction was processed using snpEff tool with Illumina Hiseq data [42]. Alignment was done using minimap2 [43] and variant detection was done using Sam-tools [44]. Through MicroSatellite identification tool (MISA) tool with default parameters simple sequence repeats were identified [45].
Protein family classification
Protein domain analysis was widely done using Pfam database [46]. HMMER 3.0 was used to infer Pfam domains by removing overlapping clans. From derived protein sequences, in total 12082 proteins domain were found to be associated.
Secretome analysis
In the current study, secretome prediction of B. sorokiniana genome was analyzed using SignalP v4.1 in combination with TargetP v1.1 for all possible secreted proteins. These secreted proteins then examined for transmembrane (TM) spanning regions using TMHMM (TMHMM v2.0; http://www.cbs.dtu.dk/cgi-bin/nph-sw_request? tmhmm). The proteins located in the predicted N-terminal signal peptide is retained as 0 or 1 transmembrane region. Big-PI (http://mendel.imp.ac.at/ gpi/cgi-bin/gpi_pred_fungi.cgi) is used to predict GPI- anchor proteins. Localization of the remaining proteins was predicted using ProtComp by LocDB and PotLocDB databases (ProtComp v8.0; http://www.softberry.com). After secretion, location of proteins was estimated using WoLFPSORT, analysis done by “run WolfPsort summary fungi” in the WoLFPSORT V0.2 package (70% specificity and sensitivity) [47]. Blast2GO [48] (http://www.blast2go.com/b2glaunch) was used to explore whether any additional gene annotation existed from protein set within the predicted refined secretome. From refined secretome, genes were identified which was further classified into six carbohydrate-active enzymes (CAZy) classes; polysaccharide lyases (PL), glycoside hydrolases (GH), carbohydrate esterases (CE), carbohydrate binding modules (CBM), auxiliary activities (AA) and glcosyl transferases (GT) using CAZy database (http://www.cazy.org/).
Primer designing and amplification of ToxA gene
ToxA gene was extracted from a genomic region of Pyrenophora tritici-repentis isolate PTR-01, complete coding sequence (Accession number- MH017419). The sequence specific primers were designed using Integrated DNA Technologies (IDT) primer designing tool. Amplification of ToxA gene from genomic DNA was ensured using primer pair ToxA BS F 5’TCATGCGTTCTATCCTCGTA3’ and ToxA BS R 5’CTAATTTTCTAGCTGCATTCTCCA3’. The PCR condition include initial denaturation at 95°C for 5 min; followed by 39 cycles of amplification, each cycle with the following plan: denaturation at 94°C for 30s, annealing at 52°C for 30s, and extension at 72°C for 1 min; followed by final extension at 72°C for 10 min. By gel electrophoresis (1.2%), PCR products were visualized. Amplified product was gel purified, sequenced and analyzed against NCBI database. The amplicon sequencing was outsourced by Eurofins Genomics India Pvt. Ltd. (Bengaluru, India). The sequences obtained were aligned using BioEdit Sequence Alignment Editor. Phylogenetic analysis was done using Molecular Evolutionary Genetics Analysis (MEGA-X), amongst plant pathogen viz. B. sorokiniana, Pyrenophora tritici repentis, Parastagonospora nodorum, phaeosphaeria avenaria species was inferred using the Neighbor-Joining method. In this study, the sequences of ToxA used were deposited in NCBI GenBank.
Tsn1 allelic status in Indian wheat genotype and its pathogenicity assay
ToxA, a necrotropic effector was mapped to wheat chromosome arm 5BL, reveals the inverse gene to gene relationship with a sensitivity gene called as Tsn1. B. sorokiniana isolate carrying ToxA gene causes severe necrotic lesions on wheat genotypes harboring Tsn1 sensitivity gene. Thirteen wheat genotypes were taken from different regions of India which includes WH 542, WL 711, Agra Local, Suzoe, HD 29, PBW 343, HD 3086, Chiriya 7, HD 30, Milan, HD 2329, Ning 8139, HD 2967. These genotypes are further classified based on presence or absence of Tsn1. To test ToxA-Tsn1 relationship, the collected wheat genotypes was grown in a moist chamber maintaining the temperature of approx. 25°C; at two leaf stage BS112 (positive for ToxA gene) was inoculated on leaves. Genomic DNA was isolated from above mentioned wheat genotypes using CTAB method. PCR amplification was carried out using dominant marker Xfcp623 (F 5’CTATTCGTAATCGTGCCTTCCG3’ and R 5’CCTTCTCTCTCACCGCTATCTCATC3’) procured from intron five of Tsn1 gene at annealing temperature of 57°C. PCR results, amplicon presence infer Tsn1 (presence) and its absence infer tsn1 (absence).
Pathogenicity assay were tested on 3 week old plant of thirteen different wheat genotypes as mentioned above. The inocula was prepared from BS112, cultured in sorghum grain under aseptic conditions and after 25 days, the inoculum was crushed in water and filter through muslin cloth having a spore density of 1 × 106 spores/mL, for uniform spraying Tween 20 was added to spore suspension and the inoculum was prepared. Plants were kept in poly house in glass chamber were the temperature was maintained at 25°C, followed by >80% of relative humidity. Spore suspension of BS112 was sprayed on the flag leaf of all genotypes in four plant each. Photographs were taken at 4 days of post-inoculation and disease severity (%) was calculated as per the scale; 0=free of spots; 1= up to 5% leaf area covered with necrotic spots; 2= 6-20% of the leaf area covered; 3= 21-40 % of the leaf area covered; 4= 41-60 % of the leaf area covered; 5= spots inclusion more than 60 % of the leaf area tangled.
Average Disease Index (ADI) was calculated using the formula: ADI = ((sum of rating of each leave) / (total leaf*5)/100). ADI was converted into disease responses viz. 0 = No infection; 0-10= resistant response (R); 10.1-20 = moderately resistance (MR); 20.1-30 = moderately susceptible (MS); 30.1- 50= susceptible(S); and more than 50= highly susceptible (HS) [49, 50].
Expression analysis of ToxA under in vitro and in planta conditions
For in planta gene expression analysis using qPCR, BS112 (most aggressive isolate) was inoculated to highly resistant cultivar (Chiriya 7) and susceptible cultivar (Agra local) of wheat. The pots were kept in moist chamber maintaining the temperature of approx. 25°C. After inoculation of BS112 (as described earlier), leaf samples with disease symptoms (photographs were taken) were collected at 1st, 2nd, 3rd, 4th and 5th day, kept in aluminum foil and immediately frozen in liquid nitrogen. In vitro expression analysis was also done using qPCR of ToxA gene in B. sorokiniana isolate BS112 grown in potato dextrose broth (PDB); harvested at same time points as mentioned above.
Total RNA was isolated from leaf samples inoculated with BS112 and fungal mycelia (BS112) using Trizol (Invitrogen) reagent method as per the manufacturer’ guidelines. RNA quantification was done using nanodrop. First strand cDNA was synthesized using Revertaid cDNA synthesis kit (Thermo fisher scientific, Wilmington, USA) as per the manufacturer’ guidelines and was stored at -20°C for further use.
Quantitative gene expression was performed using primer pair ToxA_RP_FTGCGTTCTATCCTCGTACTTC and ToxA_RP_RGTGATTGACATGCAGCTTCC (designed using Integrated DNA Technologies (IDT) primer designing tool) to amplify the ToxA gene. A housekeeping EFN-1 alpha gene (EFN-1FCTTCTCGCCTACACCCTTG and EFN-1RCCTTCTCCCAACCCTTGTAC) was also used. The designed primers were synthesized (Eurofins Genomics India Pvt. Ltd., Bengaluru, Karnataka, India).
The quantitative PCR was performed on 48- well plates mini opticon real time PCR system (Biorad, Hercules, California, USA) with the following conditions: an initial activation step at 95 °C for 7 min; followed by 35 cycles of denaturation at 95 °C for 15 s, annealing at 53 °C for 30 s, and extension at 72 °C for 30 s; melt curve analysis of the PCR product was carried out at 72 °C for 1 min and ramped from 75 to 95 °C with a rise by 1 °C every 5 s. qPCR was done using SYBR Green PCR master mix (Fermentas) which includes 10 µl of SYBR Green PCR master mix , 10nM of the appropriate primer (both EFN-1 alpha and ToxA) and 100ng of template cDNA with a total of 20 µl reaction. Each experiment was carried out in triplicates with two technical replicates, relative gene expressions were calculated in terms of fold changes using the ΔΔCt method [51].
