2.1. Materials
Murine macrophage cell line J774A.1 cells were obtained from the University of Science and Technology of China. C2-Cer, LPS, Adenosine 5′-triphosphate (ATP) disodium salthydrate, verapamil, and imipramine were acquired from Sigma-Aldrich (St Louis, MO, USA). Anti-NLRP3, anti-TXNIP antibodies were acquired from Abcam (San Francisco, USA). The secondary antibody was obtained from ZSGB-BIO (Beijing, China). Anti-caspase-1, anti-β-actin antibodies, and Lysis buffer were obtained from CST (Beverly, MA, USA).
2.2. Cell culture and treatment
The J774A.1 cells were randomly grouped into 1) normal control group; LPS/ATP group; imipramine intervention + LPS/ATP group (J774A.1 cells were incubated with LPS (1 μg/mL) for 4 h, treated with imipramine (10 μmol/L) for 3 h, and finally added ATP (5 mM) for 30 min) and imipramine control group (imipramine group); 2) normal control group; LPS/ATP group; verapamil intervention + LPS/ATP group (J774A.1 cells were incubated with LPS (1 μg/mL) for 4 h, treated with verapamil (10 μmol/L) for 3 h, and finally added ATP (5 mM) for 30 min) and verapamil control group (verapamil group) and 3) normal control group; Cer group (30 μmol/L C2-Cer); verapamil intervention + Cer group (J774A.1 cell were pretreated with verapamil (10 μmol/L for 3 h) and co-incubated with C2-Cer (30 μmol/L for 5 h)) and the TXNIP siRNA + Cer group (cells were transfected with TXNIP siRNA and incubated with C2-Cer (30 μmol/L for 5 h)).
2.3. Transfection
Control siRNA and TXNIP siRNA were synthesized from GenePharma (Shanghai, China). Cell transfection was using Lipofectamine® 3000 RNAi Max reagent, as per manufacturer's instructions (Invitrogen, Karlsruhe, Germany). The cells were collected for western blotting and RT-PCR analysis at 48 h post-transfection.
2.4. Cell viability assays
The J774A.1 cells were treated with imipramine (0, 25, 50, 75, 100 μmol/L), C2-Cer (0, 15, 30, 45, 60 μmol/L) and verapamil (0, 25, 50, 75, 100 μmol/L) for 24 h. It was followed by incubation of J774A.1 cells with MTT (Beyotime, Jiangsu, China) for 4 h. Furthermore, dimethylsulfoxide (DMSO) (Beyotime, Jiangsu, China) was added per well, and the absorbance was recorded by the microplate reader (BioTek, Winooski, VT, USA) at 490 nm.
2.5. Western blotting
An equal amount of protein (10~20 μg) was taken from each sample, loaded into the individual lane, and subjected to vertical SDS-PAGE electrophoresis (concentrated gel voltage 50 V, 1 h, and separated gel voltage 100V, 1.5 h). The cellular proteins were electrophoretically transferred at 200 mA for 3.5 h onto a PVDF membrane (Millipore Corporation, Billerica, USA) by parallel electrophoresis. It was incubated with primary antibodies and corresponding secondary antibody. Protein bands were scanned using the chemiluminescence imaging system (GE Healthcare, Bucks, UK).
2.6. Real-time PCR
After the treatments mentioned above, the total RNA was extracted from cells using Promega reagent (Promega, Beijing, China), as per manufacturer's instructions. Promega-A3500 kit was used for reverse transcription of RNA. The Promega-A6001 kit was used to detect cDNA expression. Based on the GAPDH expression, the 2-ΔΔCt method used for the calculation of relative expression level of target genes.
Primers used in real time-PCR.
Forward Primer Reverse Primer
|
TXNIP
|
GATACCCCAGAAGCTCCTCC
|
ACCTCA GTGTAAGTGGGTGG
|
NLRP3
|
AGCCTTCCAGGATCCTCTTC CTTGGGCAGCAGTTTCTTTC
|
Caspase-1
|
TGGCAGGAATTCTGGAGCTT
|
CTTGAGGGTCCCAGTCAGTC
|
IL-1β
|
CTG CTT CCA AAC CTT TGA CC AGC TTC TCC ACA GCC ACA AT
|
IL-18
|
AAGACTCTTGCGTCAACTTCAAGGA AGTCGGCCAAAGTTGTCTGATTC
|
GAPDH
|
TGATGGGTGTGAACCACGAG AGTGATGGCATGGACTGTGG
|
2.7. ELISA assay
After distinct treatments of J774A.1 cells, as mentioned earlier, the supernatant of J774A.1 cells was collected for cytokine analysis. ELISA kits were used to measure IL-1β and IL-18 concentrations, as per the manufacturer's instruction (MultiSciences Biotechnology, Hangzhou, China). Each well's absorbance was measured on a microplate reader (wavelength 450 nm) (BioTek, Winooski, VT, USA) and repeated 3 times. Each well's absorption values were averaged, and cytokine contents in the supernatants were calculated using standard curves.
2.8. Cer content detection by immunofluorescence
After distinct treatments of J774A.1 cells, as mentioned earlier, the cells were subsequently fixed and permeabilized. Cells were incubated at 4°C for 12 h with anti-Cer antibodies (1:500, ENZO, Switzerland), subsequently with secondary antibodies in the dark at room temperature for 1 h. After washing, cells were DAPI stained in the dark for 10 min. Nikon Eclipse 90i Fluorescence Microscope system (Nikon, Japan) was used to visualize the cells and record the images.
2.9. ASM activity measurement
Briefly, after the treatments mentioned above, the cells were lysed using a 1X mammalian lysis buffer. Then, as per the manufacturer's instruction, these samples were treated with ASM assay reagents (ASM assay kit, Abcam, San Francisco, USA). After incubating for one hour at room temperature, each sample's fluorescence was detected using a microplate reader (BioTek, Winooski, VT, USA) at Ex/Em = 540/590nm. The fluorescence in the blank wells was only used as a negative control.
2.10. Statistical analysis
All experimental data are presented as the mean ± SD, and statistical analysis was conducted using SPSS version 23.0. Statistical differences between the groups were determined using a one-way analysis of variance (ANOVA). P< 0.05 indicates statistical significance.