Materials
Naringenin, AngII, 3-[4,5-dimethyl-thiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT), Antibiotic-antimycotic solution (10,000 units/ml of penicillin, 10,000µg/ml of streptomycin), and Tris were purchased from Sigma-Aldrich (St. Louis, MO, USA). Trizol Reagent was purchase from Invitrogen (USA). All-In-One RT Mastermix and EvaGreen qPCR MaterMix were purchased from ABM (Canada). Antibodies against ANP, β-MHC, TGF-β1, Smad2/3, phospho-Smad2/3 (p-Smad3), and GAPDH were purchased from Abcam CO (Cambrige, UK).
Animal
Male 8-week-old male Sprague Dawley (SD) rats (150–180 g body weight) were purchased from Beijing Vital River Laboratory Animal Technology Company (Beijing, China). All experiments involving rats were approved by the Institutional Animal Care Research Advisory Committee of the National Institute of Biological Science (NIBS) and Animal Care Committee of Zhengzhou University. All rats were kept under a 12-hr light/dark cycle with free access to water and food.
Experimental Design And Treatment Protocol
A rat model of AngII infusion induced cardiac remodeling was established as described previously [11]. In brief, SD rats were quickly anesthetized with an intraperitoneal injection of sodium pentobarbital (50 mg/kg), then the prefilled osmotic minipumps (Alzet, Model 2002) were implanted into the subcutaneous tissue to deliver AngII (Sigma-Aldrich, A9525) at 400 ng/kg/min for 4 weeks. Rats were randomly assigned to one of the following groups: the sham group (n = 10) received subcutaneous injections of phosphate buffer (PBS) for 4 weeks; the AngII group (n = 10) received subcutaneous injections of AngII (400 ng/kg/min) via osmotic minipumps; the AngII + Nrg group (n = 10) received naringenin by gavage (100mg/kg/day) plus the daily injections of Ang as above.
Echocardiographic Study
Transthoracic echocardiography was used to measure left ventricular (LV) function variables one day before killing. Briefly, rats were placed in a supine position after the induction of general anesthesia. Rats were underwent transthoracic two dimensional guided M-mode echocardiography with a 12L MHz transducer (Sibiscape Co. Ltd.). From the cardiac short axis, the LV anterior wall end-diastolic thickness (LVAWd), the systolic LV anterior wall thickness (LVAWs),the LV internal dimension at end-diastole (LVIDd), the LV internal dimension at end-systole (LVIDs), the LV posterior wall end-diastolic thickness (LVPWd), the LV posterior wall end-systolic thickness (LVPWs) were measured. Echocardiographic measurements were averaged from at least three separate cardiac cycles.
Heart Histological Analysis
The left ventricle were fixed in 10% formalin and embedded in paraffin, and subsequently were sectioned at 4µm and stained with Masson to evaluate the cardiac collagen deposition. To evaluate the size of cardiomyocytes, tissue sections were stained with 1.0 mg/ml Alexa Fluor 488® conjugate of wheat germ agglutinin (WGA) solution (MolecularProbes, Eugene, OR, USA). Ten fields in each region of the heart were selected randomly from four nonconsecutive serial sections, and collagen content was quantified by measuring the total blue area per square millimeter using the ImageJ.
Neonatal Rat Ventricular Cardiomyocytes Isolation, Culture And Treatment
Neonatal rat ventricular cardiomyocytes and CFs were obtained from the hearts of 1–2 days old SD rats as described previously [12]. In brief, the ventricles of neonatal rats were harvested after killed by decapitation, and then were cut into ~ 1mm3 pieces in a dish with cold PBS. 0.125% and 0.05% collagenase type I were used to dissociate cardiomyocytes and fibroblasts. Cells were cultured in DMEM with 15% FBS, 100 U/mL penicillin and 100 µg/mL streptomycin in a humidified atmosphere of 5% CO2 and 95% air at about 37℃. Naringenin were dissolved in dimethyl sulfoxide (DMSO) and diluted with DMEM. Cells were incubated with Nrg (0.1, 1, 10µM) with or without AngII 10uM for 24 h in a 6 well plate. Cell surface area analysis was performed using confocal microscopy as described previously [13].
Methylthiazolyl Tetrazolium Assay For Cell Viability
Cells were cultured at a density of 4–5 x 104 cells per well in 96-well plates for 24 h. The cells were treated with different concentrations of Nrg for 24 h. And then cell viability was determined by the MTT reduction assay. Cells were incubated with MTT solution (5 mg/mL) for 4 h at 37°C. The dark blue formazan crystals that formed in intact cells were solubilized with 150 µL of DMSO, and the absorbance at 490 nm was measured with a microplate reader (Bio-Rad, Hercules, CA, USA).
Western Blotting
The heart tissues or cells were lysed by RIPA lysis buffer and the protein concentration was detected by using a BCA protein assay kit. Protein (30µg) were separated using 10% SDS-PAGE and then were transferred onto a polyvinylidene difluoride membrane (PVDF). Next, PVDF membranes were blocked with 5% fat-free milk and incubated with primary antibodies overnight at 4℃. Subsequently, the membranes were washed and incubated with secondary antibodies at room temperature. The optical density of the bands was visualized by an ECL system (Pierce). GAPDH was used as an endogenous control. Data was normalized to GAPDH levels.
Rna Isolation And Quantitative Real-time Pcr
Total RNA was extracted from the frozen tissues or cultured cells using Trizol reagent (Invitrogen, USA). First strand cDNA was synthesized using an RT kit (Invitrogen, USA). qPCR analysis were performed in a MiniOpticon Real-Time PCR Detection System (BioRad Laboratories, USA). Results were expressed as fold differences relative to GAPDH using the 2-ΔΔCT method. All the primers were synthesized by Sangon Biotech (Shanghai, China) and the sequence are listed in Table 1.
Table 1
Primers used for reverse transcription and real-time PCR
Primer Names
|
|
Sequences
|
ANP
|
Sense
Anti-Sense
|
CCTTCTCCATCACCAA
TGTTATCTTCGGTACCG
|
β-MHC
|
Sense
Anti-Sense
|
GCCGAGTCCCAGGTCAACAA
GTAATTCGAGGGCAGGAACCC
|
α-SMA
|
Sense
Anti-Sense
|
GCAAACAGGAATACGACGAAGC
GCTTTGGGCAGGAATGATTTG
|
Co1 I
|
Sense
Anti-Sense
|
ACTCAGCCCTCTGTGCCT
CCTTCGCTTCCATACTCG
|
GAPDH
|
Sense
Anti-Sense
|
GACATCAAGAAGGTGGTGAAGC
TGTCATTGAGAGCAATGCCAGC
|
Statistical analysis
All data are presented as means ± SEM. SPSS 21.0 was used to perform statistical analysis of the data. Statistical differences were calculated with the 2-tailed Student t test when comparing 2 conditions, and ANOVA was used when comparing ༞2 conditions. A value of P < 0.05 was considered statistically significant.