Patients and bone tissues
All experiments were conducted according to the Declaration of Helsinki. Every experiment was approved by the Research Ethics Committee of the Affiliated Hospital of Chongqing Medical University. Each donor signed an informed consensus with the approval of the Research Ethics Committee of the Affiliated Hospital of Chongqing Medical University. Finally, 11 SANFH (stage III and IV) patients and 11 femoral neck fracture (FNF) patients who underwent a hip arthroplasty in the First Affiliated Hospital of Chongqing Medical University were recruited. The SANFH patients and FNF patients were diagnosed by X-ray and computerized tomography (CT) and further confirmed by histological analysis. All of these femoral head samples were collected after resected from the femur and were immediately divided into two halves using a bone knife. A part of the femoral head was rapidly stored in the liquid nitrogen for the next experiments, while the other part of each sample was fixed in 4% paraformaldehyde for the histological study.
RNA extraction
The bone tissues were crunched using a rongeur and ground into powders with liquid nitrogen. Following that, the miRNAs of bone tissues were extracted using a Biospin miRNA Extraction kit (BioFlux, China). Finally, Biodrop Ulite (UK) was used to detect the miRNA concentration.
Real-time PCR
The cDNA of the miRNA was synthesized using miRNA First Strand cDNA Synthesis (Sangon Biotech). A 20 μL system was used for the real-time quantitative PCR reaction, and 4 secondary pores were set. The cDNA gene amplification conditions of miRNA reverse transcription were pre-denaturation 95℃ for 10min, denaturation 95℃ for 10s, annealing 58℃ for 20s, extension 72 ℃ for 10s, and 40 cycles. The relative expression of miRNA was standardized by U6 and analyzed using the 2ΔΔCT method. The primers were shown in Table 1.
Table1 Primer sequence
|
gene name
|
Primer sequence
|
miR-199a-3p
|
F GGAACCCGTAGATCCGAACTTGTG
|
|
R B661601 (Sangon Biotech)
|
U6
|
F B661602 (Sangon Biotech)
|
|
R B661601 (Sangon Biotech)
|
Cells culture and transfection
The rat bone marrow-derived mesenchymal stem cells (rBMSCs) and were purchased in Otwo Biotech (Guangdong, China). The human embryonic kidney (HEK)-293T cells and MC3T3-E1 cells were purchased from the National Collection of Authenticated Cell Cultures (Shanghai, China). The rBMSCs, HEK-293T cells, and MC3T3-E1 cells were respectively cultured in H/DMEM medium ( HyClone, UK) supplied with 10% fetal bovine serum (Gibco, UK), 100 U/mL penicillin, and 100 μg/mL streptomycin (NCM, China) at 37℃ and 5%CO2. The medium was changed every 3 days. The treat concentration of dexamethasone was 20 µM.
The negative control (NC), agomiR-199a-3p, antagomiR-199a-3p (antagonist of miR-199a-3p) , siITGB8, wild type-ITGB8 (WT-ITGB8) and mutant type-ITGB8 (MT-ITGB8) plasmids (GenePharma, Shanghai, China) were transfected into cells using EndofectinTM-MAX kit(GeneCopoeia, USA)at the cell confluence of 50% in accordance with manufacturer's guidelines. The working concentration of agomiR-199a-3p was100 nM, and those of antagomiR-199a-3p, NC and siITGB8 were 200 nM.
Alkaline phosphatase (ALP) activity assay
The rBMSCs and MC3T3-E1 cells were seeded into 6-well plates and transfected. Based on the previously reported methods, the ALP activity was determined using an ALP activity detective kit (Wanlei Bio, China) according to the protocol of the manufacturer using a microplate reader 20, 21.
Osteogenic differentiation and evaluation
The rBMSCs and MC3T3-E1 cells were seeded into 24-well plates and transfected. When the confluence point of cells reached 80%, the medium was changed as the osteogenic differentiation medium (ODM, Cyagen, USA). Alizarin red S (ARS) staining was used to evaluate the level of osteogenic differentiation. After cultured in osteogenic differentiation for 3 weeks, the rBMSCs were fixed, stained, and washed according to the instructions of the Alizarin Red S staining kit (Solarbio, China). Based on the previously reported methods, the stained mineralization nodules were dissolved with 10% cetylpyridinium chloride at 37°C for 30 min22. The solution was added to a 96-well plate, and the OD value was measured at 562 nm for quantitative analysis.
Adipocyte differentiation and Oil red O (ORO) staining
The rBMSCs and MC3T3-E1 cells were seeded into 12-well plates and transfected. When the confluence point of cells reached 100%, the growth medium was changed as the adipocyte differentiation medium (Cyagen, USA). After cultured in adipocyte differentiation medium for 4 weeks, the rBMSCs and MC3T3-E1 cells were stained with an Oil red O staining kit (Solarbio, China) and pictured using an inverted microscope. Based on the previously reported methods, the stained lipid deposits were extracted with isopropyl alcohol at room temperature for 30 min23. Finally, the solution was added to a 96-well plate, and the OD value was measured at 562 nm for quantitative analysis.
The extraction of proteins and Western blot
Protein lysate (RIPA, Beyotime, Jiangsu, China) and phosphatase inhibitor (cocktail, Abcam, U.S.A.) were added to the cells and bone powder to extract total protein. The protein concentration of the samples was detected using a BCA protein concentration determination kit (Beyotime, China). A total of 50 μg protein was loaded into each lane, separated with 10% SDS-PAGE separation gel (Epizyme Biotech, China) at 60 V for 35 minutes and at 100V for about 70 minutes, then transferred to PVDF membrane (Millipore, USA), and closed with 5% nonfat milk in TBST buffer (CST, U.S.A.). Then, the protein bands were incubated in primary antibodies on a shaking table at 4℃ overnight. The primary antibodies used in this experiment were as follows: β-actin and OCN were purchased from Affinity (U.S.A.); Runx2 and FAK were purchased from Wanlei Bio (China); ALP was purchased from Abcam (U.S.A.); PPARγ, ERK1/2, p-ERK1/2, p-FAK were purchased from CST (U.S.A.), ITGB8 was purchased from Zenbio (China). After the application, the protein bands were washed with 1ⅹTBST three times and then incubated with secondary antibodies (Goat anti-rabbit, 1:8,000, biosharp, China) for 1 hour. Then the bands were washed with 1ⅹTBST three times. Finally, the protein was detected with an ECL reagent (Zen-Bio, China).
Dual-luciferase reporter assay
Targetscan 7.2 (www.targetscan.org) was used to predict the relationship between the ITGB8 and miR-199a-3p. Then, HEK-293T cells were cultured in H/DMEM supplied with 10% FBS (Gibco, UK), 100 U/mL penicillin(NCM, China), and 100 μg/mL streptomycin (NCM, China) at 5%CO2 and 37℃. The miR-199a-3p binding site containing the ITGB8-3’UTR (3511-3530: 5’- CTATGTGTCTTACTACTGTT -3’, 4021-4040: GTGCTAAGTTACTACTGCCG) was inserted into the GP-miRGLO vector (GenePharma). A cDNA fragment of the mutant sequence (3511-3530: 5’- CTTACACTCTTTGATGACTT -3’, 4021-4040: 5’-GTGCTAAGTTTGATGACCCG-3’) of ITGB8-3'-UTR with a target region was also inserted into the GP-miRGLO vector. The sequence of wild type and mutant type ITGB8 (MT-ITGB8) were further confirmed by sequencing. The co-transfection of WT-ITGB8 or MT-ITGB8 with agomiR-199a-3p or NC was finished using EndofectinTM-MAX reagent in the 96-well plate, respectively. Relative luciferase activity was further detected with the Dual-Luciferase reporter gene detection system (Promega).
Animal study
All experimental and animal care procedures were approved by the Research Ethics Committee of the Affiliated Hospital of Chongqing Medical University and performed following the guidelines of the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. A total of 16 female SD rats (8-week old, 180-200g) were enrolled in this study and randomly divided into 4 groups: the control rats (n=4), MPS rats (n=4), and MPS+ NC rats (n=4), MPS+antagomir-199a-3p (n=4) respectively injected with PBS, MPS, MPS+ NC and MPS+antagomir-199a-3p. The MPS was intramuscularly injected into rats and the NC and antagomir-199a-3p were injected into rats via periosteum. Based on the previous studies, intramuscular injections of 20 mg/kg tetracycline (Solarbio), 10 mg/kg calcein (Solarbio) and 30 mg/kg Alizarin red S (Solarbio) were performed at weeks 0, 2, and 4 during the experiment for fluorescence staining24-25. After injected for 6 weeks, all rats were sacrificed to harvest the femoral heads. Then the femoral heads were fixed in 4% paraformaldehyde and scanned by micro-Computed Tomography (microCT) and analyzed by immunohistochemistry and histology.
A micro-CT (Skyscan1174 X-Ray Microtomography, Bruker, Belgium) was used to scan the rat femoral heads. After scanning, software N-Recon was used for 3-dimensional reconstruction of the femoral heads, and software CT-AN was used to analyze the osteogenic parameters including BV/TV (bone volume per tissue volume), Tb.Sp (trabecular separation), Tb.Th (trabecular thickness) and Tb. N (trabecular number).
Histological analyses and immunohistochemistry (IHC)
The collected femoral heads were fixed with 4% paraformaldehyde for a week and decalcified with EDTA decalcifying solution. The H&E staining was finished and pictured using an optical microscope to detect the effect of miR-199a-3p on rat femoral heads. The expression of RUNX2 and CD31 in bone tissue was measured using IHC staining.
Immunofluorescence staining
The femoral heads were fixed in 4% formaldehyde for 72 h, dehydrated with a gradient of ethanol, and ether for 24 h at each step. The specimens were infiltrated with polymethylmethacrylate and then embedded. Then, 10 μm thick sections were made with a Leica hard tissue slicer. The images of the fluorescent-labeled specimens were captured using a confocal laser scanning microscope (Leica, Heidelberg, Germany). The excitation/emission wavelengths were set as follows: 405/560–590 nm (tetracycline, blue), 543/580–670 nm (alizarin red, red), and 488/500–550 nm (calcium green, green).
Statistical analysis
Statistical analyses were performed using GraphPad PRISM8.0. All of the measurement data were expressed as means ± standard deviation (SD). For the comparison between two groups, the Student's T-test method was used, while for the comparison among multiple groups, the one-way ANOVA and Tukey test methods were used. P-value ≤0.05 was considered statistically significant.