Clinical patient samples
ESCC tissues and normal esophageal tissues were collected from The Fifth Affiliated Hospital, Sun Yat-sen University. All the positive samples were esophageal squamous cell carcinoma, as diagnosed by pathologists who confirmed the diagnosis, and none of the patients received chemoradiotherapy or targeted biotherapy before the operation. In this study, the patients provided written consent, and the collection of patient specimens was approved by the ethics committee.
Cell culture condition
The human esophageal cancer cell lines KYSE450, and TE1 were obtained from the Institute of Basic Medical Science, Chinese Academy of Medical Sciences. The cell lines were cultured in Roswell Park Memorial Institute (RPMI) 1640 supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The cell lines were cultured in a humidified 5% CO2 atmosphere at 37°C.
Immunohistochemical staining
Immunohistochemical staining for IGF2BP2 was performed. A rabbit polyclonal IGF2BP2 antibody (1:400; Cell Signaling Technology, MA, USA) was used to detect the IGF2BP2 protein levels in the cytoplasm. The cytoplasmatic staining intensity was evaluated by two independent investigators who were unaware of the clinical parameter values. If the replicates of the same tumor differed in staining intensity, then median values were used for further analysis.
Total RNA extraction and RT-qPCR
Total RNA was extracted from KYSE450, and TE1 cells, and tissues using TRIzol (Invitrogen) according to the manufacturer’s instructions. Two microliters of total RNA was reversed into cDNA by using PrimeScript™ RT Master Mix (Perfect Real Time) (Takara Bio). A SYBR Green PCR Kit (Invitrogen) was used to determine the levels of the RNA transcripts with the Bio-Rad CFX96 optical real-time PCR system (Bio-Rad, USA). IGF2BP2 expression was normalized to β-actin expression and calculated using the comparative CT (2-ΔΔCT) method. The primers used were IGF2BP2 forward 5′-AGCTAAGCGGGCATCAGTTTG-3′ and reverse 5′-CCGCAGCGGGAAATCAATCT-3′ and β-actin forward 5′-CCAACCGCGAGAAGATGA-3′ and reverse 5′-TCCATCACGATGCCAGTG-3′. All the samples were tested in triplicate.
Western blotting and antibodies
KYSE450 and TE1 cells were washed three times with cold PBS and incubated with RIPA lysis buffer (Beyotime Biotechnology, Shanghai, China) and protease inhibitors and phosphatase inhibitors cocktails for 30 min on ice. The lysates were collected in an EP tube and centrifuged at maximum speed for 15min. The supernatant was placed into a new EP tube, and the protein concentration was detected. Then, the proteins were boiled with SDS/PAGE sample buffer (50 mM Tris-HCl [pH 6.8], 2% SDS, 0.1% bromophenol blue, 10% glycerol, and 1 mM dithiothreitol) for 10 min, and the proteins were separated by SDS/PAGE. The proteins were transferred to nitrocellulose filter membranes (Roche, USA), blocked with 5% nonfat milk in TBST buffer for 1 h, and then incubated with IGF2BP2 antibodies at 4°C overnight. After washing the NC membranes for three times and incubating with HRP-conjugated secondary antibodies (Cell Signaling Technology, MA, USA) at 37°C for 1 h, we used Gension™ Enhanced ECL (solution A: solution B = 1:1) (Gension, Guangzhou, China) to detect the protein bands, and a ChemiDocXRS+imaging system (Bio-Rad, USA) was used to image the protein bands. The gray values of the IGF2BP2 and β-actin bands were detected by using ImageJ software (National Institutes of Health, USA). The antibodies were used included: anti-IGF2BP2 (1:1000, Cell Signaling Technology), anti-β-actin (1:5000, Cell Signaling Technology), anti-Snail (1:1000, Cell Signaling Technology), anti-E-cadherin (1:1000, Cell Signaling Technology), anti-β-Catenin (1:1000, Cell Signaling Technology), anti-PI3K (1:1000, Cell Signaling Technology), anti-AKT (1:1000, Cell Signaling Technology), and anti-p-AKT (1:1000, Cell Signaling Technology).
Wound healing assay
A total of 6×105 cells were inoculated in 6-well plates. When the cells reached 80% confluence, 5 stripes were scratched on the petri dishes by the tip of a sterile 200-µl pipette, and a straight line was maintained to simulated a wound. PBS was used to wash the wells 3 times to remove the unmattached cells. Serum-free medium was added, and the plates were incubated in a humidified 5% CO2 atmosphere at 37°C. Photographs were taken at 0 h and 36 h injury to observe the healing of the wound.
Cell invasion and migration assays
We diluted Matrigel to 200 μg/ml with serum-free RPMI 1640 medium, and 100 μl diluted Matrigel was used to cover 24-well plates, which were incubated at 37°C for 2 h. The cells were placed in the culture plate and a 600 μl serum-free medium was added to the lower chamber. The serum-free medium was allowed to incubate at room temperature for 30 min to rehydrate the Matrigel. Before preparing the cell suspension, the cells were starved for 12 h. The cells were digested, and centrifuged, and the culture medium was discarded, Then, the cells were washed twice with PBS and resuspended in serum-free medium. The cell density was adjusted to 5×104/cells well; 200μl of the cell suspension was added to the Transwell chamber, and 600 μl RPMI 1640 medium with 10% FBS was added to the lower chamber of the 24-well plate. Bubbles between the lower chambers and the upper chambers were eliminated. After conventional culture for 24 h, the unmigrated cells were removed from the upper surface of the membrane with cotton swabs, and the migrated cells were fixed in formaldehyde, and stained with crystal violet, Then the cells were counted.
Cell proliferation assay
KYSE450 and TE1 cells were successfully cultured in 6-well plates and then transferred with sh-IGF2BP2-1, sh-IGF2BP2-2, and NC for 24 h. The KYSE450 and TE1 cell lines were seeded in 96-well plates (1×104 cells/well) and cultured for 24 h at 37°C with 5% CO2. A CCK-8 assay(Meilunbio Da Lian China) was used to determine cell proliferation. Every 96-well plate was washed twice with PBS, and then, 100 μl suspension medium (90 μl medium with 10% FBS and 10 μl CCK-8) was added and cultured routinely for 2 h, The OD value was measured at 450 nm on an enzyme plate meter. Three independent experiments were performed.
Plasmids and lentiviral shRNA infection
The sequence of the interfering RNAs were as follows: sh-IGF2BP2-1 TTTCAGTTTCCCAAAGATCCG; sh-IGF2BP2-2 GCTGTTAACCAACAAGCCAAT; NC GTTCTCCCGAACGTGTCACGT (GenePharma, China). The sequences for IGF2BP2 overexpression are shown in Table S1 of the additional file 1. The sh-IGF2BP1,2 was synthesized, annealed, and cloned into the pGDV6/GFP/Neo vector to lentivirus-mediated interference (Shanghai Jikai Gene Medicine Technology Co., Ltd, China).
In vivo experimental study
After discussion and approval by the Animal Ethics Committee of the Fifth Affiliated Hospital of Sun Yat-sen University, we were allowed to purchase male 4-week-old BALB/C nude mice from Guangdong Animal Center (Guangzhou, China), and we performed all the animal experiments following the Animal Care Ethics Guidelines (000178). A total of 2×106 KYSE450 esophageal carcinoma cells were subcutaneously injected into the right hindquarters subcutaneous of nude mice to form subcutaneous tumors. Vernier calipers were used to measure the length and diameter of the tumor to calculate the size and volume of the tumor. An in situ xenograft model was successfully constructed, and the method for establish this model was as follows Nude mice were injected with sodium pentobarbital (60 mg/kg) in the enterocoelia to maintain the anesthetic effect, and then we opened the enterocoelia of the mice at the midline of the abdomen. Then, the gastric segment was identified and pulled down to expose the segment of the esophagus in the abdomen[16-17]. Stably transfected KYSE-450-luciferase cells were suspended in PBS (Corning, Tewkesbury, MA, USA), and 50 μl tumor cell suspension was injected into the esophagus. Notably, there was no extravasation of the tumor cell suspension and no injection into the esophageal lumen. The edematous appearance of the esophagus indicated that the mice were successfully injected. The enterocoelia was closed, and the skin was sutured.
Statistical analysis
In this study, all the experiments were performed repeatedly for three times. All the data are summarized expressed as the mean ± SD. The two groups were evaluated by using a two-tailed Student's t-test and variance. SPSS (version 20.0 (Chicago, IL, USA) ) and GraphPad Prism (version 8.0 GraphPad Software, La Jolla, USA) was used for statistical analysis. When the P-value was < 0.05, the results were considered to be significally in statistics.