Association among biofilm formation, virulence gene expression, and antibiotic resistance in Proteus mirabilis isolates from diarrhetic animals in northeast China

doi:10.21203/rs.2.16502/v2

Download PDF

Research article

Association among biofilm formation, virulence gene expression, and antibiotic resistance in Proteus mirabilis isolates from diarrhetic animals in northeast China

https://doi.org/10.21203/rs.2.16502/v2

This work is licensed under a CC BY 4.0 License

Journal Publication

published 05 Jun, 2020

Read the published version in BMC Veterinary Research →

You are reading this older preprint version

Read the latest preprint version →

Background

The aim of this study was to investigate the association among biofilm formation, virulence gene expression, and antibiotic resistance in P. mirabilis isolates collected from diarrhetic animals (n = 176) in northeast China between September 2014 and October 2016.

Results

Approximately 92.05% of the isolates were biofilm producers, whereas 7.95% of the isolates were non-producers. The prevalence of virulence genes in biofilm producers was significantly higher than that in non-producers. Biofilm production was significantly associated with the expression of ureC , zapA , rsmA , hmpA , mrpA , atfA , and pmfA ( P < 0.05). Drug susceptibility tests revealed that approximately 76.7% of the isolates were multidrug-resistant (MDR) and extensively drug-resistant (XDR). Biofilm production was significantly associated with resistance to doxycycline, tetracycline, sulfamethoxazole, kanamycin, and cephalothin ( P < 0.05). Although the pathogenicity of the biofilm producers was stronger than that of the non-producers, the biofilm-forming ability of the isolates was not significantly associated with morbidity and mortality in mice ( P > 0.05).

Conclusion

Our findings suggested that a high level of multidrug resistance in diarrhetic animals infected with P. mirabilis in northeast China.The results of this study indicated that the positive rates of the genes expressed by biofilm-producing P. mirabilis isolates were significantly higher than those expressed by non-producing isolates.

Animal Science

Proteus mirabilis

Animal

Diarrhea

Biofilm

Virulence gene

Antibiotic resistance

Pathogenicity

Proteus mirabilis is a motile gram-negative bacillus belonging to the family Enterobacteriaceae. It is an opportunistic pathogen of great importance that is found in water and soil as well as in the intestinal tracts of mammals. It has been recognized as a leading cause of urinary tract infections [1] and the primary infectious factor in patients with indwelling urinary catheters [2]. P. mirabilis can cause food poisoning, respiratory and wound infections, bacteremia, and other infections [3–6]. In the past decade, diseases associating with P. mirabilis infection have also been reported in birds with reproductive failure [7], weaned infant rhesus monkeys (Macaca mulatta) and ferrets (Mustela putorius furo) with diarrhea [8], and dogs with chronic otitis externa [9]. Although P. mirabilis,as an opportunistic pathogen capable of causing serious infections, should not be neglected.

Various virulence factors contribute to the pathogenicity of P. mirabilis. These factors include the presence of fimbriae and specific outer membrane proteins; flagella-based and swarming motility; urease activity;environmental iron binding;cell invasiveness,in addition to lipopolysaccharides and hemolysins,most of which are involved in the ability of bacteria to adhere, colonize, and invade tissues, thereby promoting pathogenicity [10, 11]. Virulence gene expression is not the only factor responsible for the pathogenicity of P. mirabilis; biofilm formation exacerbates the complexity of P. mirabilis infection [12], as biofilms are recognized as the ultimate cause of persistent and destructive infections and inflammatory processes [13]. A biofilm is an assemblage of microbial cells that adhere to specific surfaces and neighboring cells, and it is covered with an extracellular matrix [14, 15]. Biofilms inadvertently contribute to bacterial survival, thereby enabling better adaptation to the conditions of the external environment and more effective use of nutrition [16]. P. mirabilis has been found to produce bioﬁlms on a wide range of surfaces, including polystyrene, silicone, latex, glass, and various biological surfaces [17, 18]. In recent years, studies have reported a correlation between biofilm formation and various virulence factors in P. mirabilis isolates from humans [19, 20]. For instance, catheter encrustation has been reported to be brought about by the activity of urease-producing biofilms [19, 21]. Jansen et al. discovered thatmannose-resistant Proteus-like fimbriae produced by P. mirabilis, whichinfects the urinary tract, can induce biofilm formation, with the fimbriae aiding in the aggregation of the bacteria [20]. However, most reports of P. mirabilis describe urinary tract infections in humans, and there are few reports on P. mirabilis isolated from diarrhetic animals. In addition, the association between biofilm formation and various virulence factors in P. mirabilis isolates from diarrhetic animals is still unknown.

Over the past two decades, due to the identification of multiple multidrug-resistant (MDR) and extensively drug-resistant (XDR) P. mirabilis isolates, the treatment of P. mirabilis infections has become increasingly difficult [22–25]. For instance, the production of biofilms by P. mirabilis exacerbates the complexity of bacterial resistance, prolongs the treatment time, and further aggravates the infection. In essence, biofilms protect organisms from the host immune system and antimicrobial agents [26]. Furthermore, a previous study has demonstrated that certain antibiotics can induce biofilm formation [27]. However, it is unclear whether antibiotics are linked to biofilm formation by P. mirabilis isolates obtained from diarrhetic animals.

Here, we investigate biofilm formation, antimicrobial susceptibility, and virulence gene expression in P. mirabilis isolates recovered from feces of various diarrhetic animals in northeast China and discuss the association among the pathogenicity, drug resistance, and virulence of P. mirabilis from the perspective of biofilm formation.

2.1 Prevalence of P. mirabilis isolates

The prevalence rates of P. mirabilis in the diarrheal samples are listed in Table 1. Overall, 28.66% (176/614) ofdiarrheal specimens were positive for P. mirabilis. The positive isolation rate of P. mirabilis in different species was less than 40%. The positive rates of P. mirabilis isolated from specimens was 32.76% for dog, followed by 28.7% for mink, 23.26% for cattle, and 22.5% for fowl.

2.2 Biofilm formation

Of the P. mirabilis isolates (n = 176) tested, 162 (92.05%) were biofilm producers and 14 (7.95%) were non-producers. Of the biofilm producers (n = 162), 78 (48.15%) were moderate biofilm producers, whereas 62 (38.27%) and 22 (13.58%) were strong and weak biofilm producers, respectively.

2.3 Virulence gene expression

The prevalence rates of ureC, zapA, rsmA, hmpA, mrpA, atfA, pmfA, FliL, and ucaA in P. mirabilis are listed in Table 2. Of the P. mirabilis isolates, the most prevalent gene was ureC, which was identified in 90.91% of the isolates, followed by zapA, rsmA, hmpA, mrpA, atfA, pmfA, FliL,and ucaA, which were detected in 85.8%, 81.25%, 70.45%, 65.91%, 64.77%, 60.23%, 56.82%, and 32.95% of the isolates, respectively. The positive rates of genes identified in the biofilm-producing isolates were significantly higher than those in the non-producing isolates. Furthermore, except for hmpA,eight genes tested in the moderate biofilm producing isolates were higher than those in the strong and weak biofilm producing isolates.All nine genes tested in this study showed the lowest prevalence rates among the non-producers. Biofilm production was significantly associated with the expression of ureC, zapA, rsmA, hmpA, mrpA, atfA, and pmfA (P < 0.05).

2.4 Antimicrobial susceptibility testing

The antimicrobial resistance patterns of the P. mirabilis isolates are shown in Figure 1. Variable degrees of resistance of these isolates to all antibiotics tested were observed. The resistance to doxycycline was the highest (112, 63.64%), followed by ampicillin (104, 59.09%), ciprofloxacin (101, 57.39%), streptomycin (98, 55.68%), tetracycline (97, 55.12%), piperacillin/tazobactam (88, 50%), cefotaxime (86, 48.87%), sulfamethoxazole (76, 43.19%), nitrofurantoin (75, 42.61%), polymyxin B (69, 39.2%), ceftriaxone (67, 38.07%), kanamycin (67, 38.07%), ceftazidime (62, 35.23%), gentamicin (60, 34.09%), cephalothin (53, 30.12%), cefoperazone (50, 28.41%), levofloxacin (45, 25.57%), meropenem (44, 25%), and imipenem (36, 20.45%). Of the sensitive strains, meropenem (57.96%) and imipenem (64.78%) showed the strongest antimicrobial effect on P. mirabilis (Fig. 1A).

The MDR patterns of the P. mirabilis isolates are shown in Figure 1B. No isolate was sensitive to all the antibiotics. Of the P. mirabilis isolates, 18 and 23 isolates were resistant to only one or two of the 19 antibiotics tested, respectively, and 106 isolates were MDR, whereas 29 isolates were XDR. Thus, approximately 76.7% of the strains exhibited MDR or XDR.

The antibiotic susceptibility patterns of the biofilm producing and non-producing P. mirabilis isolates are shown in Table 3. Both biofilm producers and non-producers were highly resistant to doxycycline and moderately resistant to cefotaxime. Of the 19 antibiotics, doxycycline, ampicillin, tetracycline, cefotaxime, and kanamycin were found to be non-susceptible to non-producers. A sensitivity of 62.95% was observed for the biofilm-producing isolates to imipenem, whereas a sensitivity of 85.71% was noticed for the non-producing isolates to meropenem and imipenem. Isolates showing sensitivity to doxycycline, ampicillin, ciprofloxacin, streptomycin, tetracycline, piperacillin/tazobactam, cefotaxime, nitrofurantoin, sulfamethoxazole, and ceftriaxone produced more bioﬁlm than strains showing resistance to these antibiotics. For other antibiotics, such as polymyxin B, ceftazidime, kanamycin, gentamicin, cefoperazone, cephalothin, meropenem, levofloxacin, and imipenem, we observed opposite findings. Biofilm production was significantly associated with resistance to doxycycline, tetracycline, sulfamethoxazole, kanamycin, and cephalothin (P < 0.05).

2.5 Pathogenicity test in mice

The morbidity and mortality of mice that received 32 different isolates of pathogenic bacteria is demonstrated in Table 4. Mice in the negative control group were obviously asymptomatic and in good overall health. Within 12 h of challenge, different symptoms of variable degrees were observed in mice of the experimental groups. These symptoms included gloomy spirit, inactivity, and loss of appetite. In the biofilm-producing group, some mice died within 12 h of challenge. Mice in both the biofilm producing and non-producing groups showed severe clinical symptoms, such as diarrhea, abrosia, subdued behavior, hunched appearance, and absence of grooming within 24 h of challenge. Eleven mice (45.83%) in the biofilm producing and non-producing groups died within 48 h of challenge. After 72 h of challenge, the symptoms began to gradually disappear, and the health of most mice returned to normal. Only two mice (25%) in the non-producing group died within 72 h of challenge. The biofilm-forming ability of P. mirabilis was not significantly associated with morbidity and mortality in mice (P > 0.05).

Biofilm formation by P. mirabilis has recently become an issue of increasing concern. In a previous study, P. mirabilis isolates recovered from urine samples showed a higher degree of biofilm production than those isolated from different catheter segments [28]. In this study, the prevalence of P. mirabilis was high, which is in agreement with the results of studies on urine from catheterized patients [12,28]. Taken collectively, these findings indicate that further studies on P. mirabilis biofilm formation are needed to better understand the disease process and to develop new preventive and therapeutic options.

As a target gene, ureC, was used to positively identify P. mirabilis as described previously [30]. Ali et al. reported that 96.66% of human P. mirabilis isolates (n = 30) recovered from the urinary tract expressed ureC [29]. In this study, 90.91% of the isolates were positive for ureC. However, its prevalence was relatively low when compared to the results of an earlier study [30]. Our findings revealed that testing only ureC increased the likelihood of obtaining P. mirabilis negative results. Therefore, we used a PCR method based on 16S rRNA expression to detect P. mirabilis. The results of our study showed that the prevalence rates of zapA, rsmA, hmpA, mrpA, atfA, pmfA, FliL, and ucaA were relatively high. Furthermore, the overall prevalence of P. mirabilis was much higher in our study than that in previous studies [52, 31–35].

The prevalence rates of eight genes expressed by moderate biofilm producers were significantly higher than those expressed by strong and weak biofilm producers. These results show that moderate biofilm producers are highly virulent. This is also the first study reporting that the biofilm-forming ability of P. mirabilisis significantly associated with the expression of ureC, zapA, rsmA, hmpA, mrpA, atfA, and pmfA (P < 0.05). Biofilm formation is associated with the adhesion and aggregation of bacteria [20], and rsmA, mrpA, and atfA have been reported to be involved in bacterial adhesion and aggregation [31–33], which is consistent with the results of this study. Biofilm formation was also associated with ureC expression, as previously reported [19, 21]. However, the association between zapA and hmpA, and biofilm formation needs further study.

The results of antimicrobial susceptibility tests revealed high resistance rates of the P. mirabilis isolates to several antibiotics such as doxycycline and ampicillin. The resistance rates ranged from 30% to 50%. The P. mirabilis isolates that were resistant to antibiotics were similar to those previously isolated from chicken products in Hong Kong [50]. However, the resistance rates of P. mirabilis to streptomycin, sulfamethoxazole, kanamycin, ampicillin, ciprofloxacin, cephalothin, gentamicin, cefotaxime, and ceftazidime were significantly higher than those reported in an earlier study, which isolated P. mirabilis from dogs [36]. Our results on the resistance rates of P. mirabilis to nitrofurantoin, tetracycline, and polymyxin B were much lower than those reported in a human study [37], although the resistant rates to other antibiotics, except nitrofurantoin, tetracycline, and polymyxin B, were generally high [37,38]. In a previous study, P. mirabilis isolates from dogs were found to be highly sensitive to ciprofloxacin and gentamicin [39]. In this study, meropenem and imipenem were the most effective antibiotics against P. mirabilis, which is consistent with the results of an earlier study [40]. Meropenem and imipenem are classified as carbapenems, and our results showed that carbapenems were highly effective against P. mirabilis. We also found that approximately 76.7% of the isolates were MDR or XDR, which is very high compared to the rate reported in a previous study [41]. This finding reveals that resistance to P. mirabilis was steadily increasing. It is also important to mention that the high number of MDR P. mirabilis isolates obtained from companion animals may pose a potential threat to human health. Further studies are needed to define the mechanism of resistance, which may improve the treatment of P. mirabilis infections in the future.

In this study, we found that the resistance to several antibiotics, including piperacillin/tazobactam, ceftazidime, cefoperazone, ceftriaxone, meropenem, and imipenem, was significantly higher among biofilm producers than non-producers, indicating that biofilm producers were more resistant to antibiotics than non-producers. Presently, few studies have described an association between biofilm formation and drug resistance of P. mirabilis, although similar studies have been performed for other pathogens such as uropathogenic E. coli [42,43], coagulase-negative staphylococci [44], and Haemophilus parasuis [45]. Except for piperacillin/tazobactam, ceftazidime, cefoperazone, ceftriaxone, meropenem, and imipenem, the antibiotic resistance rates of non-producers were higher than those of producers. This finding is consistent with an earlier study that reported non-MDR Acinetobacter baumannii isolates to participate in robust biofilm formation [27]. Different resistance mechanisms are likely to be responsible for the differences in antibiotic resistance and biofilm formation in various bacteria. We also found that the biofilm-forming ability of the P. mirabilis isolates was significantly associated with the resistance to doxycycline, tetracycline, sulfamethoxazole, kanamycin, and cephalothin (P < 0.05). β-lactamase has been reported to decrease the ability of E. coli to form biofilms by inhibiting peptidoglycans, which are required for the assembly of surface molecules on the biofilm. Under sub-inhibitory concentrations of tetracycline and ampicillin, the overexpression of the TetA(C) pump, which contributes to the osmotic stress response and induces capsular colanic acid production, promoted the formation of mature biofilms [46]. In addition, there was an association between the resistance to aminoglycoside and extracellular DNA in Pseudomonas aeruginosa [47]. Thus, we hypothesize that antibiotic resistance is associated with the composition of P. mirabilis biofilms, thereby affecting biofilm formation.

Although the pathogenicity of the biofilm producers was stronger than that of the non-producers, the biofilm-forming ability of the isolates was not significantly associated with morbidity and mortality in mice (P > 0.05). The high pathogenicity of the biofilm producers may have been due to the fact that the biofilm-forming ability of P. mirabilis associated with the expression of ureC, zapA, rsmA, hmpA, mrpA, atfA, and pmfA (P < 0.05). Furthermore, it has been reported that ureC and zapA expressed by P. mirabilis associate with diarrhea in goats [48]. Gabidullin et al. found that diarrhea caused by P. mirabilis was related to enterotoxins [49]. Thus, the mechanism responsible for P. mirabilis-induced diarrhea needs further study.

In conclusion, our study revealed a high level of multidrug resistance in P. mirabilis isolates recovered from diarrhetic animals in northeast China. Therefore, the use of antimicrobial agents in animals needs to be controlled so as to minimize the emergence and eventual spread of resistant pathogens, which is warranted in order to protect human health. The results of this study indicated that the positive rates of the genes expressed by biofilm-producing P. mirabilis isolates were significantly higher than those expressed by non-producing isolates. Furthermore, this is the first study to report that the biofilm-forming ability of P. mirabilis isolates from diarrhetic animals is significantly associated with the expression of ureC, zapA, rsmA, hmpA, mrpA, atfA, and pmfA and the resistance to doxycycline, tetracycline, sulfamethoxazole, kanamycin, and cephalothin. Further studies on biofilm formation by P. mirabilis are necessary to better understand the disease process and to develop effective treatments for mammals with antibiotic resistant P. mirabilis.

5.1 Sample collection

Six hundred and fourteen fecal swabs were collected randomly from different farms in northeast China between September 2014 and October 2016 and transferred to the laboratory in ice-filled containers. Fecal swabs were collected from different animals (i.e., dog, mink, cattle, and fowl) with diarrhea.

5.2 P. mirabilis screening

P. mirabilis was isolated as described previously [50]. To grow the bacteria, the fecal swabs were incubated with 1 mL of Luria–Bertani broth for 6 h at 37 C, and a 30 µL aliquot of the broth was added to buffered peptone water (Aobox, Beijing, China). The resultant mixture was incubated for 24 h at 37 C to enrich the culture, and then streaked onto xylose lysine deoxycholate agar plates (Hopebiol, Qingdao, China). All plates were incubated at 37 C for a minimum of 16 h. One isolate from each sample was selected for further characterization.

5.3 Identification of isolates

To identify P. mirabilis isolates, standard biochemical tests were used as described previously [51]. The isolates were gram-negative bacilli that were positive for glucose, methyl red, and urease but negative for maltose, sucrose, mannitol, indole, and gelatin liquefaction. The Voges–Proskauer test yielded negative results for the isolates. Urease C (ureC) and mannose-resistant Proteus-like fimbriae (mrpA) were amplified by the polymerase chain reaction (PCR) to identify P. mirabilis from the presumptive isolates [52]. Positive results were randomly selected for sequencing. When the results were negative for ureC and mrpA expression, a segment of the 16S rRNA gene was amplified. The 16S rRNA segment was sequenced [53]. The sequences were compared with ureC, mrpA, and 16S rRNA in GenBank using BLAST.

5.4 Quantification of biofilm production

Biofilm production was assessed using a microtiter plate assay as described previously [54]. P. mirabilis isolates were grown in tryptic soy broth (Hopebiol) supplemented with 0.25% glucose overnight at 37 C. Subsequently, the cultures were diluted to 1 10⁶ CFU mL^–1 in fresh tryptic soy broth supplemented with 0.25% glucose, and 200 µL of the diluted culture was transferred into each well of a sterile flat-bottom 96-well polystyrene microtiter plate. After incubation for 24 h at 37 C without shaking, the wells were gently washed three times with 200 µL of distilled water. The biofilms were fixed with 200 µL of 99% methanol for 15 min. The supernatant was removed, and the plate was air-dried. The biofilms were then stained with 200 µL of 1% crystal violet for 10 min. The excess dye was removed by washing the plate under running tap water. Finally, the bound crystal violet was released by adding 200 µL of 33% acetic acid. The optical density (OD) of each well was measured at 590 nm using a microtiter plate reader. To determine the background OD, control experiments were performed with uninoculated broth. This assay was repeated three independent times. The biofilm formation capacity of each isolate was analyzed using the method of Khoramian et al. [55].

5.5 Expression of virulence genes

P. mirabilis virulence genes were detected by PCR. These genes were ureC, extracellular metalloprotease (zapA),, swarming behavior (rsmA),, hemolysin (hpmA),, mrpA, ambient-temperature fimbriae (atfA),, P. mirabilis fimbriae (pmfA),, flagellar basal body protein (FliL),, and uroepithelial cell adhesin fimbriae (ucaA) (Table 5) [10]. The base sequences and predicted sizes of the PCR products for the specific oligonucleotide primers used in this study are listed in Table 5. Subsequently, total genomic DNA was isolated from stationary-phase broth cultures that were grown overnight in Luria–Bertani broth with the TIANamp Bacterial DNA Kit (TIANGEN, Beijing, China) according to the manufacturer’s instructions. All PCR products were analyzed by agarose gel electrophoresis, and the results were recorded with a gel documentation system. All amplifications were repeated three independent times in parallel with a negative control (distilled water served as the PCR template).

5.6 Antimicrobial resistance test

The antimicrobial resistance of the isolates to 19 antibiotics, including doxycycline, ampicillin, ciprofloxacin, streptomycin, tetracycline, piperacillin/tazobactam, cefotaxime, nitrofurantoin, sulfamethoxazole, ceftriaxone, polymyxin B, ceftazidime, kanamycin, gentamicin, cefoperazon, cephalothin, meropenem, levofloxacin, and imipenem (BIO-KONT, Wenzhou, China), was determined by the Kirby–Bauer disc diffusion method [56]. In brief, 0.5 McFarland P. mirabilis inoculum was spread onto Mueller–Hinton agar plates (Hopebiol), and the antibiotic discs were dispensed on the agar. The plates were incubated at 37 C for 18 h. Escherichia coli (E. coli) ATCC 25922 was used as the control microorganism. The inhibitory zone around each disc was measured, and the results were interpreted according to the guidelines provided by the manufacturers and the Clinical and Laboratory Standards Institute [57]. The results were interpreted as resistant, intermediate, and susceptible. MDR was defined as acquired non-susceptibility to at least one agent in three or more antimicrobial categories. XDR was defined as non-susceptibility to at least one agent in all but two or fewer antimicrobial categories [58]. Non-MDR was defined as resistance to none or up to two antimicrobial categories [27].

5.7 Pathogenicity test in mice

The pathogenicity test was performed as described previously [59]. In brief, healthy, 6-week-old, female BALB/c mice (n = 99) (Changsheng Biotechnology Co., Ltd., Liaoning, China) were used to investigate the pathogenicity of P. mirabilis. The mice were randomly divided into thirty-three groups (n = 3/per group) as follows: one control group and thirty-two experimental groups, which tested 32 P. mirabilis isolates for their pathogenicity to produce biofilm, to express various virulence genes, and to resist different drugs. Each mouse received a 0.2-mL intraperitoneal injection of a bacterial suspension at a concentration of 1 10⁸ CFU mL^–1, whereas control mice were challenged with vehicle alone. The mice were fed normally and observed daily for the activity level and water intake for up to 14 days, and deaths were recorded.

5.8 Statistical analysis

Data were analyzed with SPSS 18.0 Software (SPSS Statistics, Inc., Chicago, IL, USA). The Chi-square test was adopted for analysis. P-values < 0.05 were considered statistically significant.

Abbreviations

P. mirabilis, Proteus mirabilis; PCR, polymerase chain reaction; MDR, multidrug-resistant; XDR, extensively drug-resistant; BPW, buffered peptone water; OD, optical density; E. coli, Escherichia coli; AT, annealing temperature.

Acknowledgments

The authors thank Dr. Songfeng Zheng (Missouri State University, USA) for his help with statistical analysis.

Ethics approval and consent to participate

This study was performed in accordance with the Guide for the Care and Use of Laboratory Animals of the Ministry of Health, China. The protocol was reviewed and approved by the Institutional Animal Care and Use Committee of Northeast Agricultural University (2014-SRM–24). The specimens were collected from animals for laboratory analyses only, and unnecessary pain and suffering of the animals was avoided. The animal owners provided written consent for the collection of specimens. Animal experiments were carried out according to animal welfare standards.

Consent for publication

Signed informed consent was obtained from each participant. The informed consent is available upon request.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Competing interests

The authors have no financial or personal relationships with other individuals or organizations that could have inappropriately influenced or biased the contents of this paper.

Funding

This work was supported by the “Academic Backbone” Project of Northeast Agricultural University (17XG10), the National Natural Science Foundation of China (31672532), and the SIPT Program (201910224139). The role of the funding bodies was to pay for the consumables used in this study. They had no role in the design of the study; the collection, analysis, and interpretation of data and in the writing of the manuscript.

Authors’ contributions

All authors participated in study design and planning. Yadong Sun and ShanShan Wen conceived and designed the study as well as acquired and extracted the data. Yadong Sun performed data analysis. Yadong Sun, ShanShan Wen, Lili Zhao, Yue Pan, and Qiqi Xia drafted the manuscript. Yadong Sun, ShanShan Wen, Hanghang Liu, Chengwei Wei, Hongyan Chen, Junwei Ge, and Hongbin Wang interpreted the data, revised the manuscript, and approved this version of the manuscript for publication.

Authors’ information

Affiliations

College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030, P. R. China

Yadong Sun, Shanshan Wen, Qiqi Xia, Yue Pan, Hanghang Liu, Chengwei Wei, Junwei Ge, and Hongbin Wang

State Key Laboratory of Veterinary Biotechnology, Heilongjiang Provincial Key Laboratory of Laboratory Animal and Comparative Medicine, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150069, P. R. China

Lili Zhao, Hongyan Chen

Northeastern Science Inspection Station, China Ministry of Agriculture Key Laboratory of Animal Pathogen Biology, Harbin 150030, P. R. China

Junwei Ge

Liaoning Vocational College of Ecological Engineering, Shenyang 110122, P. R. China

Yadong Sun

Corresponding author: Hongbin Wang (E-mail: hbwang@neau.edu.cn)

[1] Chen CY, Chen YH, Lu PL, Lin WR, Chen TC, Lin CY. Proteus mirabilis urinary tract infection and bacteremia: risk factors, clinical presentation, and outcomes. Journal of Microbiology, Immunology and Infection. 2012;45:228–36.

[2] Liu MC, Lin SB, Chien HF, Wang WB, Yuan YH, Hsueh PR, et al. 10′(Z), 13′(E)-heptadecadienylhydroquinone inhibits swarming and virulence factors and increases polymyxin B susceptibility in Proteus mirabilis. PloS one. 2012;7:e45563.

[3] Mobley HL, Belas R. Swarming and pathogenicity of Proteus mirabilis in the urinary tract. Trends in microbiology. 1995;3:280–4.

[4] Wang Y, Zhang S, Yu J, Zhang H, Yuan Z, Sun Y, et al. An outbreak of Proteus mirabilis food poisoning associated with eating stewed pork balls in brown sauce, Beijing. Food Control. 2010;21:302–5.

[5] Wang JT, Chen PC, Chang SC, Shiau YR, Wang HY, Lai JF, et al. Antimicrobial susceptibilities of Proteus mirabilis: a longitudinal nationwide study from the Taiwan surveillance of antimicrobial resistance (TSAR) program. BMC infectious diseases. 2014;14:486.

[6] Habibi M, Karam MRA, Bouzari S. Construction and evaluation of the immune protection of a recombinant divalent protein composed of the MrpA from MR/P fimbriae and flagellin of Proteus mirabilis strain against urinary tract infection. Microbial pathogenesis. 2018.

[7] Cabassi C, Taddei S, Predari G, Galvani G, Ghidini F, Schiano E, et al. Bacteriologic findings in ostrich (Struthio camelus) eggs from farms with reproductive failures. Avian diseases. 2004;48:716–22.

[8] Yu W, He Z, Huang F. Multidrug-Resistant Proteus mirabilis Isolated From Newly Weaned Infant Rhesus Monkeys and Ferrets. Jundishapur journal of microbiology. 2015;8.

[9] Malayeri HZ, Jamshidi S, Salehi TZ. Identification and antimicrobial susceptibility patterns of bacteria causing otitis externa in dogs. Veterinary research communications. 2010;34:435–44.

[10] Rózalski A, Sidorczyk Z, Kotełko K. Potential virulence factors of Proteus bacilli. Microbiology and Molecular Biology Reviews. 1997;61:65–89.

[11] Legnani-Fajardo C, Zunino P, Piccini C, Allen A, Maskell D. Defined mutants ofProteus mirabilislacking flagella cause ascending urinary tract infection in mice. Microbial pathogenesis. 1996;21:395–405.

[12] Hola V, Peroutkova T, Ruzicka F. Virulence factors in Proteus bacteria from biofilm communities of catheter-associated urinary tract infections. FEMS Immunology & Medical Microbiology. 2012;65:343–9.

[13] Fusco A, Coretti L, Savio V, Buommino E, Lembo F, Donnarumma G. Biofilm Formation and Immunomodulatory Activity of Proteus mirabilis Clinically Isolated Strains. International journal of molecular sciences. 2017;18:414.

[14] Donlan RM. Biofilms: microbial life on surfaces. Emerging infectious diseases. 2002;8:881.

[15] Kwiecinska-Pirog J, Skowron K, Bartczak W, Gospodarek-Komkowska E. The ciprofloxacin impact on biofilm formation by Proteus mirabilis and P. vulgaris strains. Jundishapur journal of microbiology. 2016;9.

[16] Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Science. 1999;284:1318–22.

[17] McLean RJ, Lawrence JR, Korber DR, Caldwell DE. Proteus mirabilis biofilm protection against struvite crystal dissolution and its implications in struvite urolithiasis. The Journal of urology. 1991;146:1138–42.

[18] Rocha SP, Elias WP, Cianciarullo AM, Menezes MA, Nara JM, Piazza RM, et al. Aggregative adherence of uropathogenic Proteus mirabilis to cultured epithelial cells. FEMS Immunology & Medical Microbiology. 2007;51:319–26.

[19] Stickler D, Ganderton L, King J, Nettleton J, Winters C. Proteus mirabilis biofilms and the encrustation of urethral catheters. Urological research. 1993;21:407–11.

[20] Jansen AM, Lockatell V, Johnson DE, Mobley HL. Mannose-resistant Proteus-like fimbriae are produced by most Proteus mirabilis strains infecting the urinary tract, dictate the in vivo localization of bacteria, and contribute to biofilm formation. Infection and immunity. 2004;72:7294–305.

[21] Ranjbar-Omid M, Arzanlou M, Amani M, Shokri Al-Hashem SK, Amir Mozafari N, Peeri Doghaheh H. Allicin from garlic inhibits the biofilm formation and urease activity of Proteus mirabilis in vitro. FEMS microbiology letters. 2015;362:fnv049.

[22] Rahal K, Wang F, Schindler J, Rowe B, Cookson B, Huovinen P, et al. Reports on surveillance of antimicrobial resistance in individual countries. Clinical infectious diseases. 1997;24:S169-S75.

[23] Alabi OS, Mendonça N, Adeleke OE, da Silva GJ. Molecular screening of antibiotic-resistant determinants among multidrug-resistant clinical isolates of Proteus mirabilis from SouthWest Nigeria. African health sciences. 2017;17:356–65.

[24] Bie L, Wu H, Wang XH, Wang M, Xu H. Identification and characterization of new members of the SXT/R391 family of integrative and conjugative elements (ICEs) in Proteus mirabilis. International journal of antimicrobial agents. 2017;50:242–6.

[25] Bameri Z, Karam MRA, Habibi M, Ehsani P, Bouzari S. Determination immunogenic property of truncated MrpH. FliC as a vaccine candidate against urinary tract infections caused by Proteus mirabilis. Microbial pathogenesis. 2018;114:99–106.

[26] Jacobsen SM, Shirtliff ME. Proteus mirabilis biofilms and catheter-associated urinary tract infections. Virulence. 2011;2:460–5.

[27] Qi L, Li H, Zhang C, Liang B, Li J, Wang L, et al. Relationship between antibiotic resistance, biofilm formation, and biofilm-specific resistance in Acinetobacter baumannii. Frontiers in microbiology. 2016;7.

[28] Kwiecinska-Piróg J, Bogiel T, Skowron K, Wieckowska E, Gospodarek E. Proteus mirabilis biofilm-Qualitative and quantitative colorimetric methods-based evaluation. Brazilian Journal of Microbiology. 2014;45:1423–31.

[29] Ali HH, Yousif MG. Detection of some virulence factors genes of Proteus mirablis that isolated from urinary tract infection. Int J. 2015;3:156–63.

[30] Zhang W, Niu Z, Yin K, Liu P, Chen L. Quick identification and quantification of Proteus mirabilis by polymerase chain reaction (PCR) assays. Annals of microbiology. 2013;63:683–9.

[31] Shi X, Lin Y, Qiu Y, Li Y, Jiang M, Chen Q, et al. Comparative screening of digestion tract toxic genes in Proteus mirabilis. PloS one. 2016;11:e0151873.

[32] Barbour EK, Hajj ZG, Hamadeh S, Shaib HA, Farran MT, Araj G, et al. Comparison of phenotypic and virulence genes characteristics in human and chicken isolates of Proteus mirabilis. Pathogens and global health. 2012;106:352–7.

[33] Zunino P, Geymonat L, Allen AG, Legnani-Fajardo C, Maskell DJ. Virulence of a Proteus mirabilis ATF isogenic mutant is not impaired in a mouse model of ascending urinary tract infection. FEMS Immunology & Medical Microbiology. 2000;29:137–43.

[34] Zunino P, Sosa V, Allen AG, Preston A, Schlapp G, Maskell DJ. Proteus mirabilis fimbriae (PMF) are important for both bladder and kidney colonization in mice. Microbiology. 2003;149:3231–7.

[35] Sosa V, Schlapp G, Zunino P. Proteus mirabilis isolates of different origins do not show correlation with virulence attributes and can colonize the urinary tract of mice. Microbiology. 2006;152:2149–57.

[36] Harada K, Niina A, Shimizu T, Mukai Y, Kuwajima K, Miyamoto T, et al. Phenotypic and molecular characterization of antimicrobial resistance in Proteus mirabilis isolates from dogs. Journal of medical microbiology. 2014;63:1561–7.

[37] Adamus-Bialek W, Zajac E, Parniewski P, Kaca W. Comparison of antibiotic resistance patterns in collections of Escherichia coli and Proteus mirabilis uropathogenic strains. Molecular biology reports. 2013;40:3429–35.

[38] Kanayama A, Kobayashi I, Shibuya K. Distribution and antimicrobial susceptibility profile of extended-spectrum β-lactamase-producing Proteus mirabilis strains recently isolated in Japan. International journal of antimicrobial agents. 2015;45:113–8.

[39] Pedersen K, Pedersen K, Jensen H, Finster K, Jensen VF, Heuer OE. Occurrence of antimicrobial resistance in bacteria from diagnostic samples from dogs. Journal of Antimicrobial Chemotherapy. 2007;60:775–81.

[40] Huang Y, Xu Y, Wang Z, Lin X. Antimicrobial resistance and genotype analysis of Extended-Spectrum-β-Lactamase-Producing Proteus mirabilis. Open Journal of Clinical Diagnostics. 2014;4:57.

[41] Okonko I, Nkang A, Fajobi E, Mejeha O, Udeze A, Motayo B, et al. Incidence of multi-drug resistant (MDR) organisms in some poultry feeds sold in Calabar Metropolis, Nigeria. Electronic Journal of Environmental, Agricultural & Food Chemistry. 2010;9.

[42] Neupane S, Pant ND, Khatiwada S, Chaudhary R, Banjara MR. Correlation between biofilm formation and resistance toward different commonly used antibiotics along with extended spectrum beta lactamase production in uropathogenic Escherichia coli isolated from the patients suspected of urinary tract infections visiting Shree Birendra Hospital, Chhauni, Kathmandu, Nepal. Antimicrobial resistance and infection control. 2016;5:5.

[43] Tajbakhsh E, Ahmadi P, Abedpour-Dehkordi E, Arbab-Soleimani N, Khamesipour F. Biofilm formation, antimicrobial susceptibility, serogroups and virulence genes of uropathogenic E. coli isolated from clinical samples in Iran. Antimicrobial Resistance & Infection Control. 2016;5:11.

[44] Shrestha LB, Bhattarai NR, Khanal B. Antibiotic resistance and biofilm formation among coagulase-negative staphylococci isolated from clinical samples at a tertiary care hospital of eastern Nepal. Antimicrobial Resistance & Infection Control. 2017;6:89.

[45] Zhang J, Xu C, Shen H, Li J, Guo L, Cao G, et al. Biofilm formation in Haemophilus parasuis: relationship with antibiotic resistance, serotype and genetic typing. Research in veterinary science. 2014;97:171–5.

[46] May T, Ito A, Okabe S. Induction of multidrug resistance mechanism in Escherichia coli biofilms by interplay between tetracycline and ampicillin resistance genes. Antimicrobial agents and chemotherapy. 2009;53:4628–39.

[47] Hall CW, Mah TF. Molecular mechanisms of biofilm-based antibiotic resistance and tolerance in pathogenic bacteria. FEMS Microbiology Reviews. 2017;41:276–301.

[48] Yue L. Identification of Proteus Mirabilis from Goat and Detection of its Major Virulence Genes Southwest University for Nationalities 2016.

[49] Gabidullin Z, Zhukova S, Ezepchuk I, Bondarenko V. The detection of a choleriform thermolabile enterotoxin in clinical strains of Proteus isolated in different infections. Zhurnal mikrobiologii, epidemiologii, i immunobiologii. 1989:14–6.

[50] Wong MHY, Wan HY, Chen S. Characterization of multidrug-resistant Proteus mirabilis isolated from chicken carcasses. Foodborne pathogens and disease. 2013;10:177–81.

[51] Songer J, Post K. Veterinary Microbiology: bacterial and fungal agents of animal disease. St Louis. Elsevier Saunders, St Louis. 2005.p.687.

[52] Stankowska D, Kwinkowski M, Kaca W. Quantification of Proteus mirabilis virulence factors and modulation by acylated homoserine lactones. J Microbiol Immunol Infect. 2008;41:243–53.

[53] Leite A, Miguel M, Peixoto R, Ruas-Madiedo P, Paschoalin V, Mayo B, et al. Probiotic potential of selected lactic acid bacteria strains isolated from Brazilian kefir grains. Journal of dairy science. 2015;98:3622–32.

[54] Peeters E, Nelis HJ, Coenye T. Comparison of multiple methods for quantification of microbial biofilms grown in microtiter plates. Journal of microbiological methods. 2008;72:157–65.

[55] Khoramian B, Jabalameli F, Niasari-Naslaji A, Taherikalani M, Emaneini M. Comparison of virulence factors and biofilm formation among Staphylococcus aureus strains isolated from human and bovine infections. Microbial pathogenesis. 2015;88:73–7.

[56] Bauer A, Kirby W, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. American journal of clinical pathology. 1966;45:493.

[57] Wayne P. CLSI. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fifth Informational Supplement. CLSI Document M100-S25, Clinical and Laboratory Standards Institute. 2015.

[58] Magiorakos AP, Srinivasan A, Carey R, Carmeli Y, Falagas M, Giske C, et al. Multidrug‐resistant, extensively drug‐resistant and pandrug‐resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clinical microbiology and infection. 2012;18:268–81.

[59] Osman KM, Samir A, Abo-Shama UH, Mohamed EH, Orabi A, Zolnikov T. Determination of virulence and antibiotic resistance pattern of biofilm producing Listeria species isolated from retail raw milk. BMC microbiology. 2016;16:263.

Table 1. Prevalence of P. mirabilis in collected diarrheal samples.

Host	Number of samples	Number of positive samples (%)
Dog	232	76 (32.76) 62 (28.7)
Mink	216	76 (32.76) 62 (28.7)
Cattle	86	20 (23.26)
Fowl	80	18 (22.5)
Total	614	176 (28.66)

Table 2. Prevalence of ureC, zapA, rsmA, hmpA, mrpA, atfA, pmfA, FliL and ucaA genes in P. mirabilis isolates.

Virulence gene	P. mirabilis
Virulence gene	High biofilm producer n=62	Moderate biofilm producer n=78	Weak biofilm producer n=22	Non biofilm producer n=14	P value
ureC	58(93.54%)	76(97.43%)	16(72.72%)	10(71.43%)	P <0.0001
zapA	52(83.87%)	72(92.31%)	15(68.18%)	12(85.71%)	0.037
rsmA	50(80.64%)	70(89.74%)	14(63.64%)	9(64.29%)	0.013
hmpA	48(77.42%)	60(76.92%)	10(45.45%)	6(42.85%)	0.002
mrpA	41(66.13%)	65(83.33%)	8(36.36%)	2(14.29%)	P <0.0001
atfA	40(64.52%)	62(79.49%)	10(45.45%)	2(14.29%)	P <0.0001
pmfA	38(61.29%)	58(74.36%)	8(36.36%)	2(14.29%)	P <0.0001
FliL	33(53.23%)	50(64.1%)	10(45.45%)	7(50%)	0.329
ucaA	14(22.58%)	32(41.03%)	7(31.82%)	5(35.71%)	0.146

Table 3. Antibiotic resistance pattern of the biofilm producing and non-producing P. mirabilis isolates.

	Biofilm producer (n = 162)			Non biofilm producer (n= 14)
Antibiotic	resistance	intermediate	sensitive	resistance	intermediate	sensitive	P value
Doxycycline	98(60.49%)	28(17.28%)	36(22.23%)	14(100%)	0(0%)	0(0%)	0.015
Ampicillin	92(56.79%)	36(22.23%)	34(20.98%)	12(85.71%)	2(14.29%)	0(0%)	0.078
Ciprofloxacin	90(55.56%)	44(27.16%)	28(17.28%)	11(78.57%)	0(0%)	3(21.43%)	0.084
Streptomycin	88(54.32%)	30(18.52%)	44(27.16%)	10(71.42%)	2(14.29%)	2(14.29%)	0.445
Tetracycline	85(52.47%)	41(25.3%)	36(22.23%)	12(85.71%)	2(14.29%)	0(0%)	0.034
Piperacillin/tazobactam	84(51.85%)	26(16.05%)	52(32.1%)	4(28.58%)	2(14.29%)	8(57.13%)	0.15
Cefotaxime	78(48.15%)	54(33.33%)	30(18.52%)	8(57.13%)	6(42.87%)	0(0%)	0.255
Nitrofurantoin	67(41.36%)	39(24.07%)	56(34.57%)	8(57.13%)	2(14.29%)	4(28.58%)	0.492
sulfamethoxazole	64(39.5%)	36(22.23%)	62(38.27%)	12(85.71%)	0(0%)	2(14.29%)	0.004
Ceftriaxone	62(38.27%)	45(27.78%)	55(33.95%)	5(35.7%)	3(21.43%)	6(42.87%)	0.776
Polymyxin B	61(37.66%)	32(19.75%)	69(42.59%)	8(57.13%)	2(14.29%)	4(28.58%)	0.357
Ceftazidime	58(35.8%)	28(17.28%)	76(46.92%)	4(28.58%)	0(0%)	10(71.42%)	0.131
Kanamycin	57(35.19%)	42(25.93%)	63(38.88%)	10(71.42%)	4(28.58%)	0(0%)	0.005
Gentamicin	52(32.1%)	24(14.82%)	86(53.08%)	8(57.13%)	2(14.29%)	4(28.58%)	0.143
Cefoperazone	48(29.63%)	46(28.4%)	68(41.97%)	2(14.29%)	2(14.29%)	10(71.42%)	0.104
Cephalothin	45(27.78%)	37(22.84%)	80(49.38%)	8(57.13%)	0(0%)	6(42.87%)	0.030
Meropenem	42(25.93%)	30(18.52%)	90(55.55%)	2(14.29%)	0(0%)	12(85.71%)	0.061
Levofloxacin	39(24.07%)	30(18.52%)	93(57.41%)	6(42.87%)	0(0%)	8(57.13%)	0.117
Imipenem	36(22.23%)	24(14.82%)	102(62.95%)	0(0%)	2(14.29%)	12(85.71%)	0.114

Table 4. Pathogenicity to mice in 32 biofilm producing and non-producing P. mirabilis isolates from animal with diarrhea.

Pathogenicity	P. mirabilis
Pathogenicity	Biofilm producer (n = 24)	Non biofilm producer (n= 8)	P value
morbidity	17(70.83%)	5(62.5%)	0.660
mortality	11(45.83%)	2(25%)	0.299

Table 5. Primers used in the PCRs carried out in this study.

Target gene	Primer	Nucleotide Sequence (5’-3’)	Amplicon (bp)	AT*	Reference
16S rRNA	27F	AGAGTTTGATCCTGGCTCAG	1463	49	Leite et al. (2015)
	1492R	GGTTACCTTGTTACGACTT
ureC	ureC-F	GTTATTCGTGATGGTATGGG	317	52	Stankowska et al. (2008)
	ureC-R	ATAAAGGTGGTTACGCCAGA
zapA	zapA-F	ACCGCAGGAAAACATATAGCCC	540	53	Stankowska et al. (2008)
	zapA-R	GCGACTATCTTCCGCATAATCA
rsmA	rsmA-F	TAGCGAGTGTTGACGAGTGG	562	49	Shi et al. (2016)
	rsmA-R	AGCGAGGTGAAGAACGAGAA
hpmA	hpmA-F	CCAGTGAATTAACGGCAGGT	654	49	Shi et al. (2016)
	hpmA-R	CGTGCCCAGTAATGGCTAAT
mrpA	MRP-F	ACACCTGCCCATATGGAAGATACTGGTACA	550	40	Barbour et al. (2012)
	MRP-R	AAGTGATGAAGCTTAGTGATGGTGATGGTG
		ATGAGAGTAAGTCACC
FliL	FliL-F	CTCTGCTCGTGGTGGTGTCG	770	40	Barbour et al. (2012)
	FliL-R	GCGTCGTCACCTGATGTGTC
ucaA	ucaA-F	GTAAAGTTGTTGCGCAAAC	560	50	Sosa et al. (2006)
	ucaA-L	TTGAGCCACTGTGGATACA
pmfA	pmfA-F	CAAATTAATCTAGAACCACTC	618	54	Zunino et al. (2003)
	pmfA-R	ATTATAGAGGATCCCTTGAAGGTA
atfA	atfA-F	CATAATTTCTAGACCTGCCCTAGCA	382	50	Zunino et al. (2000)
	atfA-R	CTGCTTGGATCCGTAATTTTTAACG

AT* anneling temperature

Download PDF

Journal Publication

published 05 Jun, 2020

Read the published version in BMC Veterinary Research →

Editorial decision: Minor revision
28 Feb, 2020
Editor assigned by journal
06 Feb, 2020
Editor invited by journal
05 Feb, 2020
Submission checks completed at journal
23 Jan, 2020

You are reading this older preprint version

Read the latest preprint version →

Association among biofilm formation, virulence gene expression, and antibiotic resistance in Proteus mirabilis isolates from diarrhetic animals in northeast China

Status:

Journal Publication

Version 2

Abstract

Figures

1. Background

2. Results

3. Discussion

4. Conclusions

5. Methods

Declarations

Abbreviations

Acknowledgments

Ethics approval and consent to participate

Consent for publication

Availability of data and materials

Competing interests

Funding

Authors’ contributions

Authors’ information

References

Tables

Status:

Journal Publication

Version 2