DOI: https://doi.org/10.21203/rs.3.rs-72190/v1
Background: Alpha actinins (ACTNs) are major cytoskeletal proteins and exhibit many non-muscle functions. Emerging evidence have uncovered the regulatory role of ACTNs in tumorigenesis, however, the expression pattern, biological functions, and underlying mechanism of ACTN1 in hepatocellular carcinoma (HCC) remain largely unexplored.
Methods: Immunohistochemical analysis of a HCC tissue microarray (n = 157) was performed to determine the expression pattern and prognostic value of ACTN1 in HCC. In vitro loss-of-function study in HCC cells were carried out to investigate ACTN1 knockdown on cell proliferation. In vivo subcutaneous xenograft model and intrahepatic transplantation model were generated to decipher the contribution of ACTN1 in the tumor growth of HCC. Gene set enrichment analysis, quantitative real-time PCR, Co-immunoprecipitation, immunofluorescence and western blotting were performed to identify the underlying molecular mechanism.
Results: It was found that ACTN1 was significantly upregulated in HCC tissues and closely related to llpha-fetoprotein level, tumor thrombus, tumor size, TNM stage and patient prognoses. Knockdown of ACTN1 suppressed in vitro cell proliferation and in vivo tumor growth of HCC cells. Mechanistically, knockdown of ACTN1 increased Hippo signaling pathway activity and decrease Rho GTPases activities. Mechanistically, ACTN1 could competitively interact with MOB1 and decrease the phosphorylation of LATS1 and YAP. The growth-promoting effect induced by ACTN1 was significantly abrogated by pharmacological inhibition of YAP with verteporfin or super-TDU.
Conclusions: ACTN1 is highly expressed in HCC tissues and acts as a tumor promoter by suppressing Hippo signaling via physical interaction with MOB1. ACTN1 may serve as a potential prognostic marker and therapeutic target for HCC.
Hepatocellular carcinoma (HCC) is a leading cause of cancer-related mortality worldwide [1]. HCC has a high mortality due to the high rate of postoperative recurrence and metastasis [2, 3]. Hepatitis B virus (HBV) and hepatitis C virus (HCV) infection have been well documented to be the main risk factors of HCC. Until now, hepatic resection and liver transplantation are the most curative therapeutic choices for HCC patients. However, the long-term survival rate remains poor because of the recurrence and metastasis after operation [4]. It was recognized that HCC development was affected by various intracellular signaling molecules and extracellular components [5, 6]. Therefore, it is of great importance to explore these molecular alterations and to identify therapeutic targets for this deadly disease.
Hippo signaling is a crucial regulator of organ development, tissue hemostasis and regeneration [7]. Dysregulation of the Hippo pathway has been characterzied in a variety of human cancers, including HCC [8-10]. Hippo signaling can be activated by many biological factors, such as: cell polarity or adhesion molecules, cellular metabolic status or other cellular signaling. Hippo signaling is initiated by a series of kinase cascades that lead to the regulation of two transcriptional coactivators, Yes-Associated Protein (YAP) and Tafazzin (TAZ) [11, 12]. Its core consists of the serine/threonine kinases mammalian sterile 20-like kinase 1 and 2 (MST1 and MST2) and large tumor suppressor 1 and 2 (LATS1 and LATS2). Firstly, MST1/2 and Salvador Family WW Domain Containing Protein 1 (SAV1) form a complex, and phosphorylate and activate LATS1/2. Then LATS1/2 phosphorylates and inactivates YAP/TAZ. YAP/TAZ loses its transcriptional activation of pro-proliferation and anti-apoptosis genes when it is restrained in the cytoplasm. By phosphorylation, YAP and TAZ are prevented from nuclear accumulation and interaction with transcription factors such as TEA transcriptional factor (TEAD)-1, TEAD2, TEAD3 and TEAD4 to prime transcriptional activity [13, 14].
Actinin is a kind of cytoskeletal molecules that belongs to the actin filament cross-linking proteins [15]. Actinins participate in cytokinesis by balancing the contraction of myosin II, then form a contractile ring with the latter [16]. In muscle cells, actinins are crucial in the linking of adjacent sarcomeres together through thin filaments, thus coordinate muscle contraction. Actinins also format and disassemble cell-matrix adhesion through the activation of phosphoinositide 3- kinase (PI3K), or build different cell to cell adhesions by working with integrins and intercellular adhesion molecules (ICAMs) [17, 18]. Recent reports indicated that there are four isoforms of actinin in mammals, named as ACTN1-ACTN4 respectively. ACTN1 is crucial for glioma cell motility, and also plays an important role in the progression of lung adenocarcinoma [19, 20]. ACTN2 and ACTN3 can interact with the parafibromin, which is involved in the hypermethylation and suppression of many oncogenes [21]. High expression of ACTN4 is associated with the poor prognosis in many types of cancers and contributes to diverse oncogenic activities [22-24]. However, the biological functions and underlying mechanism of actinin in HCC remain unclear until now.
In this study, we found that ACTN1 was significantly upregulated in HCC tissues and closely related to tumor size, TNM stage or patient prognoses. Genetic silencing of ACTN1 suppresses HCC cell proliferation and tumor growth. Furthermore, mechanism studies reveal that the effects of ACTN1 on the biological behaviors of HCC cells are dependent on the signaling of MOB1-LATS1-YAP axis.
2.1 Cell culture and reagents
Liver cancer cell lines of human, including HepG2, Huh-7, LM3, MHCC-97H, MHCC-97L, SK-Hep1, SMMC-7721, SNU-423 and SNU-475 were obtained from Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Liver cancer cells were cultured in a specific culture medium according to ATCC instructions, supplemented with 10% (v/v) fetal bovine serum (FBS, Gibco, Grand Island, NY, USA) and 1% (v/v) penicillin (100 U/ml) and astreptomycin (0.1 mg/ml). All of above cells were incubated in a humidified incubator under 5% CO2 at 37 °C. Verteporfin (VP, S1786) and Super-TDU (S8554) were purchased from Selleck (Shanghai, China). Huh-7 cells were treated with 50 nM Verteporfin or 50 nM Super-TDU (1-31), respectively.
2.2 Clinical HCC and non-cancerous liver tissues
Human HCC tissues and corresponding non-cancerous liver (NCL) tissues (n = 20) were all collected from Renji Hospital, Shanghai Jiaotong University, School of Medicine. The tissue microarray of human contained 157 HCC samples was generated at Renji Hospital, School of Medicine, Shanghai Jiaotong University. All samples were received from the patients who underwent surgical resection and signed informed consent before their operations. The clinicopathological parameters of the HCC patients from whom the samples were obtained. This research was approved by the Research Ethics Committee of the World Health Organization Collaborating Center for Research in Human Production (authorized by the Shanghai Municipal Government).
2.3 Quantitative real-time PCR
Total RNA of HCC tissues or HCC cells was was isolated using TRIzol reagent (Invitrogen, Carlsbad, USA). Then 2 μg of RNA were reverse-transcribed into complementary DNA (cDNA) by using a PrimeScriptTM 1st Strand cDNA Synthesis Kit (Takara, Japan) according to the manufacturer’s instructions. Resultant cDNA served as templates for PCR amplification by SYBR Premix Ex Taq (Takara) on a 7500 real-time PCR system (Applied Biosystems, USA). Primer sequences used in this study were shown as follows: ACTN1-F: TGAGGAGTGGTTGCTGAATGAG, ACTN1-R: AACTTCTCTGCCAGGTGGTCC; CTGF-F: TGGAGATTTTGGGAGTACGG, CTGF-R: CAGGCTAGAGAAGCAGAGCC; ANKRD1-F: GTGTAGCACCAGATCCATCG, ANKRD1-R: CGGTGAGACTGAACCGCTAT; CYR61-F: CCCGTTTTGGTAGATTCTGG, CYR61-R: GCTGGAATGCAACTTCGG. β-Actin was used as internal control for quantification. The data were analyzed by using the 2−ΔΔCt approach.
2.4 Immunohistochemical analysis
Paraffin-embedded sections were 5-μm thick sections, deparaffinized with xylene and ethanol, and then heated in 0.1 mol/L citrate buffer (pH 6.0) by microwaving for 15 min. After being cooled at room temperature, the sections were incubated in 3% hydrogen peroxide for 20 minutes to block endogenous peroxidase. Then, the sections were blocked with 10% (v/v) BSA (Sangon, Shanghai, China) to inhibit non-specific binding, followed by incubation with primary antibody for ACTN1 (Abcam, ab50599) at 4 °C overnight with a dilution at 1:200. After washing with PBS for three times, sections were incubated with secondary reagent. All the slides were labeled with DAB substrate liquid (Cell signaling Technology, USA) and counterstained by hematoxylin, and photographed with a microscope (Carl Zeiss, USA). Scoring was conducted according to the intensity of positive staining and the proportion of stained tumor cells (score 0: 0-5%, 1: 6-30%, 2: 31-70%, and 3: > 71%. Scoring was evaluated by two independent investigators who were blinded to the clinical information. Disagreements were resolved by consensus.
2.5 Western blotting analysis
HCC tissues or cells were lysed in using RIPA Lysis Buffer (Beyotime Co., Jiangsu, China) containing the protease inhibitors following the manufacturer's protocols. The protein concentration was determined with a BCA kit (Beyotime Co., Jiangsu, China). Lysates from cells were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis, transferred onto polyvinylidene fluoride (PVDF) membranes (PerkinElmer, Boston, MA, USA). After blocking in PBS/Tween-20 containing 5% (v/v) BSA, the membranes were blotted with indicated antibodies at 4°C overnight. Then the membranes were then incubated by species-specific secondary antibodies (LI-COR) separately for 1 h at room temperature. The signals were detected by an Odyssey infrared imaging system (LI-COR, Lincoln, NE) and quantified by ImageJ software. The following antibodies were used in this study: ACTN1 (Abcam, ab50599, diluted at 1:1000), phospho-LATS1 (Cell Signaling Technology, #9157, diluted at 1:1000), total-LATS1 (Cell Signaling Technology, #3477, diluted at 1:1000), phospho-YAP (Cell Signaling Technology, #13008, diluted at 1:1000), total-YAP (Cell Signaling Technology, #14074, diluted at 1:1000), CTGF (Abcam, ab6992, diluted at 1:1000), ANKRD1 (ProteinTech, 11427-1-AP, diluted at 1:2000), CYR61 (ProteinTech, 26689-1-AP, diluted at 1:2000), and GAPDH (Abcam, ab2205, diluted at 1:1000).
2.6 Lentivirus production
ACTN1 ORF of human was subcloned into the pEZlv105 vector (GeneCopoeia, USA) to generate pEZ-lv105-ACTN1 plasmid. Virus packaging was performed in 293T cells after transfection of pEZ-lv105-ACTN1 by using Lipofectamine 3000 (Invitrogen). Viruses were harvested at 48 hour and 72 hour respectively after transfection, and virus titers were determined. Target cells including Huh-7 and LM3 cells were infected with 1×106 recombinant lentivirus-transducing units in the presence of 6 μg/ml polybrene (Sigma-Aldrich, Shanghai, China).
2.7 Cell viability assay
To determine cell viability, 2 × 103 MHCC-97H, SNU-423, Huh-7 or LM3 cells were seeded into a 96-well plate per well. A premixed solution of 10% (v/v) Cell Counting Kit-8 (CCK8, Dojindo, Japan) was added into each well and incubated in a humidified incubator under 5% CO2 at 37 °C for 2 hour. After incubation, the plate was taken and the optical densities of 24, 48 and 72 hours was measured respectively by using a microplate reader (Thermo Scientific) at a wavelength of 450 nm.
2.8 Plate colony formation assay
MHCC-97H, SNU-423, Huh-7 or LM3 cells with indicated genetic manipulation were seeded into in 6-well tissue culture plates at a density of 500 cells per well. After 10-14 days, the colonies were fixed in ethanol, stained with 0.1% crystal violet, and counted by two individuals.
2.9 Subcutaneous and orthotopically intrahepatic transplanted model
For generation of subcutaneous transplanted model, 2 × 106 sh-ACTN1 or sh-control MHCC-97H cells were detached and suspended in 100 μl serum-free DMEM. The cells were subcutaneously injected into mice (male, 6 weeks old, n = 5 per group). For generation of orthotopically intrahepatic transplanted model, 2 × 106 sh-ACTN1 or sh-control MHCC-97H cells 40 μl serum-free DMEM/matrigel (1:1) for each BALB/c-nu/nu mouse. Through a 1 cm transverse incision in the upper abdomen under anesthesia, the cells were injected into the left hepatic lobe of each mouse (male, 6 weeks old, n = 5 per group). All mice were sacrificed after 4 weeks, and the tumors and livers were taken and fixed with phosphate-buffered neutral formalin and prepared for standard histological examination. Subcutaneous tumor and liver metastases were detected by hematoxylin and eosin (H&E) staining. All of mice were manipulated and housed according to protocols approved by the Shanghai Jiaotong University Animal Care Commission. All animals received humane care according to the criteria outlined in the “Guide for the Care and Use of Laboratory Animals” prepared by the National Academy of Sciences and published by the National Institutes of Health.
2.10 GTPase activation assay
GTPase activation was performed according to standard procedures as described elsewhere [25]. In brief, Cells were harvested in magnesium-containing lysis buffer and the lysates were sonicated for 5 seconds and centrifuged for 30 minutes at 18,000× g and 4°C the Rho/Rac/Cdc42 Assay Reagent Kit (Thermo Scientific, USA) according to the manufacturer’s instructions. The primary antibodies used were anti-RhoA (Cell Signaling Technology, #2117, diluted at 1:1000), and anti-Rac1 (Millipore, 05-389, clone 23A8, diluted at 1:200), anti-Cdc42 (Cell Signaling Technology, #2462, diluted at 1:1000).
2.11 Co-immunoprecipitation
For intracellular immunoprecipitation, Huh-7 cell lysates transfected with HA-tagged ACTN1 or vector control were subjected to immunoprecipitation with anti-HA monoclonal antibody (Millipore) or control IgG. Then the immunoblotting with anti-MOB1 antibody was performed.
2.12 Immunofluorescence analysis
MHCC-97H cells were seeded at 12-well U-Chamber (Ibidi, Germany), fixed with 4% paraformaldehyde for 15 min, and permeabilized with 0.05% (v/v) Triton X-100 for 1 min at room temperature. Then the cells were incubated with primary antibodies against ACTN1 (Abcam, ab50599, diluted at 1:100) or MOB1 (Cell Signaling Technology, #13730, diluted at 1:100) for 90 minutes, followed by an Alexa Fluor 594-conjugated anti-rabbit antibody and Fluor 488 conjugated anti-mouse antibody (Jackson). The nucleus was stained with DAPI (Sigma-Aldrich, Shanghai, China) and the immunoflurescene signals were captured using confocal-scopy (Carl Zeiss, USA).
2.13 Statistical analysis
Values are expressed as the mean ± standard error of the mean. Statistical analyses were performed using SPSS 16.0 for windows. Survival curves were plotted using the Kaplan–Meier method and analyzed with the log-rank test. The association between ACTN1 expression and the clinicopathological parameters of HCC patients was evaluated using Pearson’s Chi-square test. One-way analysis of variance was used for comparison between groups. P < 0.05 was considered to indicate a statistically significant difference.
3.1 Highly expressed ACTN1 predicts a poor clinical outcome in HCC patients
To investigate the expression pattern of ACTN1 in HCC tissues, we first analyzed ACTN1 mRNA expression in paired HCC and non-cancerous liver (NCL) tissues (n = 20) by real-time qPCR. As shown in Figure 1A, ACTN1 mRNA level had an approximately three-fold increase in HCC tissues compared to NCL tissues. To further determine ACTN1 expression in HCC tissues, western blotting and immunohistochemical staining were performed. Western blotting analysis of 5 independent cases revealed that ACTN1 was found to be markedly increased in HCC tissues compared with NCL tissues (Figure 1B). Immunohistochemical result confirmed the overexpression pattern of ACTN1 in HCC and thrombus tissues and its cytoplasmic distribution (Figure 1C).
Next, a tissue microarray containing 157 cases of matched HCC samples and NCL tissues was used to analyze the correlation between ACTN1 expression and corresponding clinicopathological parameters. Immunohistochemical analysis showed that ACTN1 was highly expressed in 69.4% (132/157) of HCC patients (Figure 1D and 1E). To evaluate the clinical significance of ACTN1 in HCC, the Chi-square test was used to determine the correlation between ACTN1 expression and corresponding clinicopathologic parameters including age, gender, hepatitis history, gamma-glutamytransferase, alpha-fetoprotein, tumor thrombus, tumor differentiation, vascular invasion, tumor size, and TNM stage. Interestingly, we found that the expression of ACTN1 was closely associated with alpha-fetoprotein level, tumor thrombus, tumor size and TNM stage (Table 1). Moreover, the correlation between ACTN1 expression and clinical follow-up was analyzed by Kaplan-Meier analysis and log-rank test. As displayed in Figure 1F, high expression of ACTN1 was positively correlated with poor overall survival (OS, P = 0.027) in HCC. However, ACTN1 did not predict a poor disease-free survival (DFS; Figure 1G). By data mining TCGA cohort, we noticed that HCC samples with high ACTN1 expression were prone to have a poor clinical outcome (Figure 1H).
Table 1. Correlations between ACTN1 expression and clinicopathologic parameters in HCC patients
Variable |
ACTN1 (n) |
|||
Low (n = 41) |
High (n = 116) |
P-value |
||
Age |
≤ 50 years |
20 |
53 |
0.733 |
> 50 years |
21 |
63 |
||
Gender |
Female |
7 |
21 |
0.882 |
Male |
34 |
95 |
||
Hepatitis history |
Yes |
32 |
91 |
0.957 |
No |
9 |
25 |
||
Gamma-glutamytransferase |
≤ 50(U/L) |
13 |
40 |
0.747 |
> 50(U/L) |
28 |
76 |
||
*Alpha-fetoprotein |
≤ 20 ng/mL |
19 |
27 |
0.005 |
> 20 ng/mL |
22 |
89 |
||
*Tumor thrombus |
Yes |
7 |
41 |
0.029 |
No |
34 |
75 |
||
Tumor differentiation |
I-II |
15 |
44 |
0.878 |
III |
26 |
72 |
||
Vascular invasion |
Yes |
18 |
36 |
0.136 |
No |
23 |
80 |
||
*Tumor size |
≤ 5 cm |
35 |
79 |
0.033 |
> 5 cm |
6 |
37 |
||
*TNM stage |
I-II |
33 |
73 |
0.039 |
III |
8 |
43 |
Pearson’s χ2 test was used. The asterisk indicates P-values with significant differences.
3.2 Genetic silencing of ACTN1 suppresses in vitro cell proliferation of HCC cells
The close relationship between ACTN1 expression and poor clinical outcome indicative of a potential oncogenic role of ACTN1 in HCC, we therefore determined the cellular functions of ACTN1 in HCC cells. Firstly, we detected the mRNA expression of ACTN1 in 9 liver cancer cell lines and the non-malignant LO2 cells. The result showed that ACTN1 was commonly up-regulated in liver cancer cells compared to LO2 cells (Figure 2A). Notably, ACTN1 had higher expression levels in MHCC-97H and SNU-423 cells, which were further selected for shRNA-mediated loss-of-function study. Through real-time qPCR analysis, we found that two shRNA against ACTN1 successfully silenced ACTN1 expression in MHCC-97H and SNU-423 cells (Figure 2B). This result was further confirmed by western blotting (Figure 2C). Then we investigated the biological function of ACTN1 in the cell proliferation of HCC cells. By CCK8 assay, we found that the cell viability of MHCC-97H or SNU-423 cells was significantly suppressed at 48-hour and 72-hour time points respectively after ACTN1 was silenced (Figure 2D). To observe the long-term effect of ACTN1 knockdown on HCC cell proliferation, we carried out plate colony formation assay. Expectedly, the number of colonies was significantly reduced by ACTN1 knockdown in both MHCC-97H and SNU-423 cells (Figure 2E). Collectively, these data above suggest that ACTN1 is critically involved in the cell proliferation of HCC.
3.3 Knockdown of ACTN1 suppresses in vivo tumor growth of HCC
To investigate the growth-promoting effect of ACTN1 in vivo, we generated a subcutaneous xenograft model by injection of sh-ACTN1-1 and sh-Ctrl MHCC-97H cells into nude mice. After 4 weeks, mice were sacrificed and tumor tissues were dissected (Figure 3A). As a result, we found that ACTN1 knockdown significantly retarded tumor growth as revealed by reduced tumor weight (Figure 3B). By IHC staining, we also found that the proliferation index PCNA expression in the sh-ACTN1 group was markedly lower than that in the vehicle group (Figure 3C).
To assess intrahepatic HCC tumor growth, we orthotopically injected sh-ACTN1 and control MHCC-97H cells into nude mice. Four weeks later, mice were sacrificed and liver tissues were dissected (Figure 3D). Histological H&E staining of the liver tissues showed that mice transplanted with sh-ACTN1-1 cells had lesser intrahepatic tumor nodules than those transplanted with sh-Ctrl cells (Figure 3E). In another cohort, mice survival time in the sh-ACTN1-1 group was significantly increased compared with the sh-Ctrl group (Figure 3F). Collectively, these findings above suggest that ACTN1 is profoundly implicated in the tumor growth of HCC cells.
3.4 ACTN1 regulates Hippo signaling activity and Rho GTPases activities
To uncover the underlying molecular mechanism of the association of ACTN1 with HCC, we analyzed ACTN1-associated gene expression profiles by using the RNA sequencing data of HCC patients in the TCGA cohort. Based on the median value of ACTN1, HCC patients were divided into two groups: ACTN1-high and ACTN1-low. Gene set enrichment analysis revealed that ACTN1 was closely related with Hippo signaling and Rho GTPases signaling (Figure 4A). To check whether ACTN1 affects Hippo signaling, we performed western blotting analyses and found that knockdown of ACTN1 in MHCC-97H cells significantly increased the phosphorylated level of LATS1 and YAP (Figure 4B), suggesting a inhibitory role of ACTN1 on Hippo signaling. Additionally, ACTN1-silenced and control MHCC-97H cells were allowed to serum starvation for 24 h and subjected for analysis of activities of Rho GTPases by pull-down assays. Intriguingly, RhoA and Cdc42 activities were significantly downregulated by ACTN1 knockdown, while Rac1 activity remained unchanged (Figure 4B). Moreover, we also analyzed the mRNA levels of three canonical YAP target genes, including connective tissue growth factor (CTGF), ankyrin repeat domain 1 (ANKRD1), and cysteine rich angiogenic inducer 61 (CYR61). Real-time qPCR result showed that the mRNA level of CTGF, ANKRD1 and CYR61 were significantly reduced in ACTN1-silenced MHCC-97H cells (Figure 4C). By data mining the HCC samples in TCGA cohort, we also noticed a close correlation between ACTN1 expression and these YAP target genes (Figure 4D).
3.5 ACTN1 competitively interacts with MOB1 to regulate Hippo signaling activity
Next, we investigated whether ACTN1 affects Hippo signaling via directly association with the components of the Hippo signaling pathway by co-immunoprecipitation experiments. To achieve this, we overexpressed ACTN1 in Huh-7 cells, in which ACTN1 had a lower endogenous expression level. Huh-7 cells were transfected with HA-tagged ACTN1 or vector control. Interestingly, we found that immunoprecipitates of ACTN1 from Huh-7 cells contained MOB1, an accessory protein of LATS1 (Figure 5A). By immunofluorescence staining, the co-localization of ACTN1 and MOB1 was observed in MHCC-97H cells (Figure 5B).
Moreover, overexpression of ACTN1 significantly suppressed the phosphorylation of LATS1 or YAP in Huh-7 cells (Figure 5C). Meanwhile, we also knocked down MOB1 in Huh-7 cells, and found that the phosphorylation of LATS1 or YAP was inhibited in MOB1-silenced Huh-7 cells (Figure 5D). These findings suggest that ACTN1 may affect Hippo signaling via physical interaction with MOB1. To determine whether ACTN1-mediated growth-promoting effect is dependent on Hippo signaling, we detected Huh7 and LM3 cell viability upon ACTN1 overexpression in the presence or absence of Verteporfin (VP) or Super-TDU (1-31) (ST), which are inhibitors of the YAP-TEAD complex. As was expected, VP and ST could largely compromise the increased cell viability induced by ACTN1 in Huh-7 or LM3 cells proliferation (Figure 5E).
Altogether, these results suggested that ACTN1 could competitively interact with MOB1 and decrease the phosphorylation of LATS1/YAP, thus suppress Hippo signaling and promote the cell proliferation of HCC (Figure 6A). When ACTN1 was knocked down, MOB1 could interact with LATS1, then increase the phosphorylation of LATS1/YAP and activate Hippo signaling, which led to the inhibitory effects on the tumor growth of HCC (Figure 6B).
ACTN1 has been proved to be associated with the poor prognosis in breast cancer, oral squamous cell carcinoma, and acute lymphoblastic leukemia [26-28]. Targeting ACTN1 by Oroxylin A could remodel stromal microenvironment and restrain breast cancer metastasis [29]. In this study, we for the first time investigated the detailed biological functions and related mechanism of ACTN1 in HCC. It was found that the expression of ACTN1 is closely related with tumor size, TNM stage, and patient prognoses. The in vitro and in vivo experiments revealed that ACTN1 is crucial for the cell proliferation and tumor growth of HCC. All of these data suggested that ACTN1 plays an important role in the development of HCC.
During the progression of cancer, Hippo signaling pathway plays diverse important roles [10, 30]. It was reported that the Hippo pathway is profoundly implicated in modulating various cancer-related malignant phenotypes, including cell proliferation, invasion and metastasis of tumor cells [30, 31]. In HCC, Hippo signaling is recognized as a major tumor suppressive pathway by inhibiting hepatocyte proliferation, survival and HCC formation [32, 33]. Activation of YAP/TAZ transcription activity is essential for HCC proliferation [34, 35]. Hippo signaling inhibits YAP/TAZ transcription activity via activating LTAS kinases that directly phosphorylates YAP/TAZ, resulting in YAP/TAZ cytoplasmic retention and subsequent degradation [11, 13]. In the current study, our findings revealed that knockdown of ACTN1 increases the phosphorylation level of YAP and LATS1, and thus restrained them in the cytoplasm where they lost their transcriptional activation. Furthermore, these results were confirmed by detecting the alteration of canonical YAP target genes. YAP/TAZ is emerged as novel therapeutic targets in cancers [36, 37]. Therefore, targeting ACTN1-mediated YAP activation might provide a new avenue for HCC treatment. Indeed, blocking the YAP-TEAD complex is sufficient to inhibit ACTN1-mediated growth-promoting effect.
Moreover, in this research we further found that ACTN1 could directly interact with MOB1, which may lead to the loss of combination of MOB1 with LATS1, thus decreased the phosphorylation of LATS1/YAP and suppressed Hippo signaling. Identifying the interaction between ACTN1 and MOB1 provides a direct evidence for the important role of ACTN1 in the regulation of Hippo signaling. Also, we found that ACTN1 overexpression-induced HCC cell proliferation was largely abrogated by the inhibitors of the YAP-TEAD complex, indicating that ACTN1-induced HCC cell proliferation are dependent on the context of inhibition of Hippo signaling. Notably, ACTN1 is also involved in the focal adhesion kinase-Src complex formation [38], destabilization of E-cadherin-based adhesions [28], and luminogenesis [39]. Therefore, more works are needed to uncover whether these ACTN1-related activities are implicated in HCC development and progression. Previously, ACTN1 has been reported to play contrasting roles in RhoA signaling of astrocytoma cells [40]. Here, we identified a positive regulatory role of ACTN1 in Rho GTPases in HCC cells. However, the detailed molecular mechanism underlying ACTN1-mediated Rho GTPases activities is warranted for further investigations.
In conclusion, in this study we found that ACTN1 is crucial for the cell proliferation and tumor growth of HCC. ACTN1 suppresses the Hippo signaling pathway in HCC by interacting with MOB1, contributing to the phosphorylation of LATS1/YAP and increased HCC cell proliferation. ACTN1 may be acted as a novel Hippo signaling modulator in HCC and is a potential therapeutic target for HCC.
ACTN1, α-actinin 1; HCC, hepatocellular carcinoma; NCL, non-cancerous liver; OS, overall survival; DFS, disease-free survival; YAP, Yes Associated Protein; LATS1, Large Tumor Suppressor Kinase 1; CTGF, Connective Tissue Growth Factor; ANKRD1, Ankyrin Repeat Domain 1; CYR61, Cysteine Rich Angiogenic Inducer 61.
Acknowledgements
This work was supported by the National Natural Science Foundation of China (81671517, 81873857) and Shanghai Jiao Tong University Medicine-Engineering Fund (YG2017ZD11).
Availability of data and materials
All data generated or analyzed during this research are included in this manuscript.
Authors’ contributions
QC, AJZ and KH designed the study. QC and XWZ performed the study and participated in parts of the experiments and analysis of the data. QC, AJZ and KH wrote the paper. All authors read and approved the final manuscript.
Consent for publication
We have obtained consent to publish from the participant to report individual patient data.
Competing interests
The authors declare that they have no competing interests.
Ethics approval and consent
All human samples were obtained with informed consent. The protocols were approved by the ethical review committee of the World Health Organization Collaborating Center for Research in Human Production (authorized by the Shanghai Municipal Government). All animals received humane care according to the criteria outlined in the “Guide for the Care and Use of Laboratory Animals” prepared by the National Academy of Sciences and published by the National Institutes of Health.
Funding
This work was supported by the National Natural Science Foundation of China (grant nos. 81671517, 81873857) and Shanghai Jiao Tong University Medicine-Engineering Fund (YG2017ZD11).
[1] Kulik L and El-Serag HB. Epidemiology and Management of Hepatocellular Carcinoma. Gastroenterology 2019; 156: 477-491 e471.
[2] Hartke J, Johnson M and Ghabril M. The diagnosis and treatment of hepatocellular carcinoma. Semin Diagn Pathol 2017; 34: 153-159.
[3] Greten TF, Lai CW, Li G and Staveley-O'Carroll KF. Targeted and Immune-Based Therapies for Hepatocellular Carcinoma. Gastroenterology 2019; 156: 510-524.
[4] Ruiz de Galarreta M and Lujambio A. Hepatocellular carcinoma: killing one bird with two stones. Gut 2019; 68: 1543-1544.
[5] Monga SP. beta-Catenin Signaling and Roles in Liver Homeostasis, Injury, and Tumorigenesis. Gastroenterology 2015; 148: 1294-1310.
[6] Li R, Wang Y, Zhang X, Feng M, Ma J, Li J, Yang X, Fang F, Xia Q, Zhang Z, Shang M and Jiang S. Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasis. Mol Cancer 2019; 18: 18.
[7] Halder G and Johnson RL. Hippo signaling: growth control and beyond. Development 2011; 138: 9-22.
[8] Hong AW, Meng Z and Guan KL. The Hippo pathway in intestinal regeneration and disease. Nat Rev Gastroenterol Hepatol 2016; 13: 324-337.
[9] Plouffe SW, Hong AW and Guan KL. Disease implications of the Hippo/YAP pathway. Trends Mol Med 2015; 21: 212-222.
[10] Mo JS, Park HW and Guan KL. The Hippo signaling pathway in stem cell biology and cancer. EMBO Rep 2014; 15: 642-656.
[11] Calses PC, Crawford JJ, Lill JR and Dey A. Hippo Pathway in Cancer: Aberrant Regulation and Therapeutic Opportunities. Trends Cancer 2019; 5: 297-307.
[12] Johnson R and Halder G. The two faces of Hippo: targeting the Hippo pathway for regenerative medicine and cancer treatment. Nat Rev Drug Discov 2014; 13: 63-79.
[13] Meng Z, Moroishi T and Guan KL. Mechanisms of Hippo pathway regulation. Genes Dev 2016; 30: 1-17.
[14] Fu V, Plouffe SW and Guan KL. The Hippo pathway in organ development, homeostasis, and regeneration. Curr Opin Cell Biol 2017; 49: 99-107.
[15] Murphy AC and Young PW. The actinin family of actin cross-linking proteins - a genetic perspective. Cell Biosci 2015; 5: 49.
[16] Fujiwara K, Porter ME and Pollard TD. Alpha-actinin localization in the cleavage furrow during cytokinesis. J Cell Biol 1978; 79: 268-275.
[17] Foley KS and Young PW. The non-muscle functions of actinins: an update. Biochem J 2014; 459: 1-13.
[18] Honda K, Yamada T, Endo R, Ino Y, Gotoh M, Tsuda H, Yamada Y, Chiba H and Hirohashi S. Actinin-4, a novel actin-bundling protein associated with cell motility and cancer invasion. J Cell Biol 1998; 140: 1383-1393.
[19] Sen S, Dong M and Kumar S. Isoform-specific contributions of alpha-actinin to glioma cell mechanobiology. PLoS One 2009; 4: e8427.
[20] Hirooka S, Akashi T, Ando N, Suzuki Y, Ishida N, Kurata M, Takizawa T, Kayamori K, Sakamoto K, Fujiwara N, Kojima M and Eishi Y. Localization of the invadopodia-related proteins actinin-1 and cortactin to matrix-contact-side cytoplasm of cancer cells in surgically resected lung adenocarcinomas. Pathobiology 2011; 78: 10-23.
[21] Agarwal SK, Simonds WF and Marx SJ. The parafibromin tumor suppressor protein interacts with actin-binding proteins actinin-2 and actinin-3. Mol Cancer 2008; 7: 65.
[22] Honda K, Yamada T, Hayashida Y, Idogawa M, Sato S, Hasegawa F, Ino Y, Ono M and Hirohashi S. Actinin-4 increases cell motility and promotes lymph node metastasis of colorectal cancer. Gastroenterology 2005; 128: 51-62.
[23] Tentler D, Lomert E, Novitskaya K and Barlev NA. Role of ACTN4 in Tumorigenesis, Metastasis, and EMT. Cells 2019; 8:
[24] Jung J, Kim S, An HT and Ko J. alpha-Actinin-4 regulates cancer stem cell properties and chemoresistance in cervical cancer. Carcinogenesis 2020; 41: 940-949.
[25] Jennings RT and Knaus UG. Rho family and Rap GTPase activation assays. Methods Mol Biol 2014; 1124: 79-88.
[26] Xie GF, Zhao LD, Chen Q, Tang DX, Chen QY, Lu HF, Cai JR and Chen Z. High ACTN1 Is Associated with Poor Prognosis, and ACTN1 Silencing Suppresses Cell Proliferation and Metastasis in Oral Squamous Cell Carcinoma. Drug Des Devel Ther 2020; 14: 1717-1727.
[27] Yang X, Pang Y, Zhang J, Shi J, Zhang X, Zhang G, Yang S, Wang J, Hu K, Wang J, Jing H, Ke X and Fu L. High Expression Levels of ACTN1 and ACTN3 Indicate Unfavorable Prognosis in Acute Myeloid Leukemia. J Cancer 2019; 10: 4286-4292.
[28] Kovac B, Makela TP and Vallenius T. Increased alpha-actinin-1 destabilizes E-cadherin-based adhesions and associates with poor prognosis in basal-like breast cancer. PLoS One 2018; 13: e0196986.
[29] Cao Y, Cao W, Qiu Y, Zhou Y, Guo Q, Gao Y and Lu N. Oroxylin A suppresses ACTN1 expression to inactivate cancer-associated fibroblasts and restrain breast cancer metastasis. Pharmacol Res 2020; 159: 104981.
[30] Harvey KF, Zhang X and Thomas DM. The Hippo pathway and human cancer. Nat Rev Cancer 2013; 13: 246-257.
[31] Yu FX, Zhao B and Guan KL. Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer. Cell 2015; 163: 811-828.
[32] Lachenmayer A, Hoshida Y and Llovet JM. Hippo tumor supressor pathway: novel implications for the treatment of hepatocellular carcinoma. Gastroenterology 2010; 139: 692-694.
[33] Sohn BH, Shim JJ, Kim SB, Jang KY, Kim SM, Kim JH, Hwang JE, Jang HJ, Lee HS, Kim SC, Jeong W, Kim SS, Park ES, Heo J, Kim YJ, Kim DG, Leem SH, Kaseb A, Hassan MM, Cha M, Chu IS, Johnson RL, Park YY and Lee JS. Inactivation of Hippo Pathway Is Significantly Associated with Poor Prognosis in Hepatocellular Carcinoma. Clin Cancer Res 2016; 22: 1256-1264.
[34] Kim W, Khan SK, Liu Y, Xu R, Park O, He Y, Cha B, Gao B and Yang Y. Hepatic Hippo signaling inhibits protumoural microenvironment to suppress hepatocellular carcinoma. Gut 2018; 67: 1692-1703.
[35] Moon H, Cho K, Shin S, Kim DY, Han KH and Ro SW. High Risk of Hepatocellular Carcinoma Development in Fibrotic Liver: Role of the Hippo-YAP/TAZ Signaling Pathway. Int J Mol Sci 2019; 20:
[36] Zanconato F, Battilana G, Cordenonsi M and Piccolo S. YAP/TAZ as therapeutic targets in cancer. Curr Opin Pharmacol 2016; 29: 26-33.
[37] Nguyen CDK and Yi C. YAP/TAZ Signaling and Resistance to Cancer Therapy. Trends Cancer 2019; 5: 283-296.
[38] Craig DH, Haimovich B and Basson MD. Alpha-actinin-1 phosphorylation modulates pressure-induced colon cancer cell adhesion through regulation of focal adhesion kinase-Src interaction. Am J Physiol Cell Physiol 2007; 293: C1862-1874.
[39] Milanini J, Fayad R, Partisani M, Lecine P, Borg JP, Franco M and Luton F. EFA6 proteins regulate lumen formation through alpha-actinin 1. J Cell Sci 2018; 131:
[40] Quick Q and Skalli O. Alpha-actinin 1 and alpha-actinin 4: contrasting roles in the survival, motility, and RhoA signaling of astrocytoma cells. Exp Cell Res 2010; 316: 1137-1147.