Subject enrollment
A total of 150 women undergoing IVF treatment due to tubal pathology were recruited from the Center for Reproductive Medicine, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine. Patients who were more than 35 years of age or diagnosed with polycystic ovarian syndrome (PCOS, according to Rotterdam criteria [17]), endometriosis and other medical abnormality that could affect folliculogenesis were excluded from this research project. All participants gave their written informed consent regarding the use of clinical data, blood, and follicular fluid samples, and this study was approved by the ethics committee of Ruijin Hospital (2020104a). All patients underwent the standard GnRH antagonist protocol treatment with recombinant human FSH (rFSH; follitropin alfa; Merck, Geneva, Switzerland), which was started on the 2nd day of the menstrual cycle.
Collection of human granulosa cells and follicular fluid
Human follicular fluid was collected during oocyte retrieval. Only follicular fluid from follicles with diameters of 16–20 mm and free of blood upon macroscopic analysis were collected for further analyses. Each sample was centrifuged (250× g, 10 min,) and the supernatant was collected and stored at − 80°C until analyzed. The pellets were resuspended with phosphate-buffered saline (PBS), and the suspension was layered over 40 % Percoll (Sigma-Aldrich; Merck KGaA) and centrifuged at 450 × g, 4°C for 20 min. GCs were collected from the interphase between follicular fluid and the percoll layer and washed with PBS thrice, then incubated with trypsin (ThermoFisher Scientific, Waltham, MA, USA) at 37°C for 2 min. Next, cells were incubated with red blood cell lysis buffer for 5 min at 4°C to lyse the surplus red blood cells. Finally, the GCs were cultured overnight in DMEM/F12 (Hyclone, Logan, UT, USA) medium supplemented with 10% fetal bovine serum (FBS, Gibco, Waltham, MA, USA) and 1% penicillin-streptomycin (Hyclone).
Cell transfection and varied treatments
GCs and human granulosa-like tumor (KGN) cell line (Feiya Biotechnology Co., Ltd. Jiangsu, China) were used for in vitro study. TRIB3-shRNA and negative control (NC) plasmids were constructed by GeneChem Biotechnology Co., Ltd (Shanghai, China). KGN cells were transfected with the indicated lentiviruses (multiplicity of infection = 50) for 24 h. Then the transfected cells were selected using 1 µg/mL puromycin (Beyotime, Jiangsu, China) to generate stable cell lines. Western blotting analysis confirmed TRIB3 knockdown in target cells.
All cell lines were cultured in DMEM/F12 supplemented with 10% FBS and 1% penicillin-streptomycin, and incubated at 37°C with 5% CO2. In this study, palmitic acid (PA) (Sigma-Aldrich, St. Louis, MO, USA) was employed to investigate the FFAs effect on the GCs and KGN cells. PA was diluted with 5% FA-free BSA(Sigma) at 70°C (50 mM stock solutions) and p-Akt(Ser473) inhibitor Palomid 529 (P529) (Selleck, Houston, TX, USA) was dissolved with DMSO (100 mM stock solutions). Before each experiment, 50 mM PA was diluted in cell culture medium and used at a final concentration of 200 µM, and P529 was used at a final concentration of 60 µM in cell culture medium. Recombinant FSH (rFSH) was added to the culture dishes at a final concentration of 10 IU/mL to test the FSH-stimulated protein expression of genes in the FSHR signal pathway. To test the level of E2, 100 nM testosterone (Sigma) was added to the culture medium of shRNA-NC cells and shRNA-TRIB3 cells as a substrate for the synthesis of estrogen in vitro. Subsequently, collected human GCs with low FFAs level (FFA ≤ 0.41mM/L) were divided into four groups and treated with the reagents as follows for 24 h, respectively: (a) Blank control (no intervention); (b) rFSH; (c) 200 µM PA + rFSH; (d) 300 µM PA + rFSH. shRNA-TRIB3 cells were divided into six groups and stimulated with reagents as follows for 24 h: (a) Blank control (no intervention); (b) rFSH; (c) 200 µM PA + rFSH; (d) 300 µM PA + rFSH; (e) 200 µM PA + rFSH + P529; (f) 300 µM PA + rFSH + P529. Meanwhile, KGN cells transfected with shRNA- NC were designated as the control.
Laboratory analysis
Serum and follicular FFA concentrations were quantified as described previously [18]. Serum anti-Mullerian hormone (AMH) levels were measured with the Human AMH ELISA kit (Biotra, Guangzhou, China), and the levels of FSH, LH, E2, progesterone (P), and total testosterone were measured using a chemiluminescence immunoassay (ECLIA) kit (Beckman Coulter, Brea, CA, USA) according to the manufacturer’s instructions, respectively.
RNA extraction and qRT-PCR
Real-time PCR assay was used to determine the mRNA expression levels of ATF4, TRIB3, CYP19A1, CYP17A1, and FSHR. Total RNA was isolated using a Takara RNA Extraction Kit (Takara, Dalian, China). cDNA was synthesized by reverse transcription using an RT reaction kit (Takara), according to the manufacturer's instructions. The SYBR Green qPCR Mix (Takara) was used to perform real-time quantitative PCR (qPCR). The cycling conditions included 30 min incubation at 95°C, followed by 40 cycles at 95°C for 5 s, 60°C for 34 s and 95°C for 15 s (Applied Biosystems 7500, Fisher Scientific, USA). Meanwhile, GAPDH was used as an internal control. The 2−ΔΔCt method was used to calculate relative expression levels (defined as fold-change). Each cell sample in every group was measured thrice and a P-value < 0.05 was considered statistically significant. All primer sequences were as follows (5’ → 3’):
FSHR forward primer: GGCCATGCTCATCTTCACTG,
FSHR reverse primer: ATAGAGGAAGGGGTTGGCAC;
TRIB3 forward primer: GTCCGAGTGAAAAAGGCGTA,
TRIB3 reverse primer: TGCCCTACAGGCACTGAGTA;
ATF4 forward primer: ATGACCGAAATGAGCTTCCTG,
ATF4 reverse primer: GCTGGAGAACCCATGAGGT;
CYP17A1 forward primer: GCTGCTTACCCTAGCTTATTTG,
CYP17A1 reverse primer: ACCGAATAGATGGGGCCATATTT;
CYP19A1 forward primer: CGAAAGTGCTATCGTGGTT,
CYP19A1 reverse primer: TGTGGAAATCCTGCGTCT;
GAPDH forward primer: CACATCGCTCAGACACCATG,
GAPDH reverse primer: TGACGGTGCCATGGAATTTG
Immunofluorescence staining
Immunofluorescence staining was performed according to a previously described protocol [19]. Briefly, collected GCs were incubated for 24 h and then fixed in 4% paraformaldehyde for 30 min. After fixation, the cells were blocked with 3% bovine serum albumin (BSA, Servicebio, Wuhan, China ) for 30 min. Then, the cells were incubated with rabbit anti-TRIB3 (cat. 3868, 1:200; Proteintech, Rosemont, IL, USA) ,rabbit anti-FSHR (cat. 22665-1-AP 1:200; Proteintech), rabbit anti-ATF4 (cat. GB111137, 1:200; Servicebio) antibody at 4°C overnight, followed by incubation with secondary antibodies AlexaFluro488 (cat. GB25303, 1:200; Servicebio) for 1 h in the dark. Finally, coverslips were mounted on slides with antifade mounting medium containing DAPI (Servicebio) after the slides were washed with PBS thrice. Three independent experiments were performed for each condition. Images were captured using an pannoramic desk (P250, 3D Histech, Hungary).
Western blotting
Total protein from the GCs and KGN cells was obtained with radio-immunoprecipitation assay (RIPA, Beyotime, Jiangsu, China) lysis buffer containing 1% protease inhibitor cocktail (Roche, Basel, Switzerland), and protein concentrations were measured using the BCA protein assay kit (Beyotime) [20]. Then, 30 µg protein samples were loaded per well in 4%-12% Bis-Tris polyacrylamide gels (Tanon) and separated by electrophoresis for 1 h at 120 V. Proteins were transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA) with transmembrane equipment (Tanon) for 50 min at 400 mA, 40C. PVDF membranes containing proteins were blocked with protein free rapid blocking buffer (Epizyme, Cambridge, MA, USA) for 20 min and then incubated with specific primary antibodies overnight at 4°C. Primary antibodies included TRIB3 (1:5000, Abcam, Cambridge, UK), FSHR (1:1000, Proteintech), p-GSK3β (1:3000, Abcam), GSK3β (1:5000, Abcam), phospho-Akt (1:2000, CST), Akt (1:1000, Cell Signaling Technology [CST] Danvers, MA, USA), and tubulin (1:5000, Abcam). After washing with tris-buffered saline containing 0.1% of Tween-20 (TBST) for 10 min thrice, the PVDF membranes were incubated with horseradish peroxidase-conjugated anti-rabbit secondary antibody (1:5000, CST) for 1 h and target proteins were detected using the Western Chemiluminescent HRP Substrate Kit (Millipore), according to the manufacturer’s instructions. The results of Western blots were quantified by densitometry using ImageJ software (National Institutes of Health, Bethesda, MD, USA) and data were normalized as compared to the control treatment.
Statistical analyses
Quantified data are expressed as mean ± standard error of the mean (SEM). All statistical analysis was performed with SPSS version 24.0 (SPSS Inc., Chicago, IL, USA). After inspection for normal distribution of the data, student’s t-test was employed to compare two groups. Non-parametric Kruskall-Wallis (KW) test was employed to analyze differences between more than two groups. P < 0.05 was considered statistically significant.