Plant material and reagents
The fresh leaves of A. rosea were purchased from the herbal medicine market of Mashhad, Iran. The soybean lecithin (purity of 99%) was purchased from Sigma Aldrich (Germany). The E. coli (O157: H7) as a food-borne pathogen was obtained from the microbial culture collection of Islamic Azad University of Mashhad, Iran. For the gene expression analysis the RNeasy Mini kit (Qiagen, Hilden, Germany), cDNA synthesis Quantitect Reverse Transcription kit (Qiagen, Hilden, Germany), and SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) were used. The DNA extraction kit used in this study was QIAamp DNA Stool Mini Kit from Qiagen GmbH, Hilden, Germany. The other reagents not mentioned here were from Merck (Germany).
Fractionation and total phenolic determination
In the first step, the fresh leaves were cleaned by sterile distilled water, dried in shadow for two weeks in room temperature. The dried leaves finely ground (powder form) using a grinder mill. Then, the 100g of the dried powder was extracted with 900 mL aqueous methanol (80% (v/v)) and 100 mL of 6 M HCl using the reflux method for 2 hours (Karimi et al. 2019). Finally, the extract was filtered and the filtrate was evaporated at the temperature of 60oC by rotary evaporator (Buchi, Flawil, Switzerland). In the second step, the dried aqueous-methanolic extract was fractionated using separating funnel and different solvents including hexane, chloroform, ethyl acetate, n-butanol, and water-based on the Oskoueian et al (Oskoueian et al. 2020). Upon fractionation, the supernatant was filtered and concentrated using a vacuumed rotary evaporator. The total phenolic compounds (TPC) evaluation of each fraction was carried out by adding 0.1 ml of the extract, 2.5 ml of Folin-Ciocalteu reagent (1:10 v/v), and 2 ml of 7.5 % sodium carbonate into a test tube covered with aluminum foil. The test tubes were vortexed and the absorbance was measured at 765 nm (Oskoueian et al. 2020). The results were expressed as milligrams of gallic acid equivalents (GAE) per gram dry weight. The fraction containing the highest phenolic content is named as a phenolic rich fraction (PRF).
Nanoliposomes preparation
The four grams of lecithin were agitated for 2 h by 196 g of hot water (80 oC) using stirrer at 300 rpm. Then, the PRF after dissolving in ethanol was added to the mixture and stirred for 2h to reach the final concentration of 2000 ppm. Finally, the solution was bath-sonicated at 80% power (Sonorex RK100, Germany) during 4 to 6 minutes and the obtained nanoliposomes-loaded PRF from A. rosea was prepared and used for further characterization.
Characterization of nanoliposomes
At the beginning, the nanoliposomes-loaded PRF was diluted by water (1:20) to decrease the aggregation and inhibit the noise scattering. The dynamic light scattering (DLS) method was performed to determine the average size of particles and their stability (zeta potential). The measurements were analyzed three times by a Malvern Zetasizer Nano ZS (Malvern, UK). Moreover, Field Emission Scanning Electron Microscopy (FESEM) was applied to verify the shape and nanoliposomes size dimensions. The total phenolic content of nanoliposomes was determined as described earlier in the fractionation section (Oskoueian et al. 2020).
Phenolic profiling of nanoliposomes
The Reversed-Phase High-Performance Liquid Chromatography (RP-HPLC) analysis was carried out to investigate the types of phenolic compounds present in the nanoliposomes. Briefly, the solvents comprising of deionized water (solvent A) and acetonitrile (solvent B), the pH of solvent A was adjusted to 2.5 using concentrated trifluoroacetic acid. The column was equilibrated by 85 % solvent A and 15 % solvent B for 15 min before injection. Then, the ratio of solvent B was increased to 85 % after 50 min. After 5 min (at the 55th minute of running the experiment), the ratio of solvent B was reduced to 15 %. This ratio was maintained for 60 min for the next analysis with a flow rate of 1 ml/min. An analytical column (Intersil ODS-3 5um 4.6×150 mm Gl Science Inc. USA) was used for the detection of phenolic at 280 nm. The phenolic standards used in this study were gallic acid, syringic acid, vanillic acid, salicylic acid, caffeic acid, pyrogallol, catechin, cinnamic acid, ellagic acid, naringin, chrysin, and ferulic acid.
Animal trial
The 40 white male Balb/c mice (20-25 g) were obtained from the Razi vaccine and serum research institute of Mashhad. The mice were kept in the individual cages at 58%±10% humidity and 23°C±1°C with 12-hour light/dark periods for 7 days to be adapted with lab condition. We divided the mice into four groups of ten. With free access to the standard pellet diet (Javaneh Khorasan, Mashhad, Iran) and tap water. The experimental treatments were as follow:
T1: normal diet
T2: normal diet +infected by E. coli (O157: H7) on day 21
T3: Normal diet enriched by nonencapsulated PRF (10 mg TPC/kg BW/day) + infected by E. coli (O157: H7) on day 21
T4: Normal diet enriched by nanoliposome-encapsulated PRF (10 mg TPC/kg BW/day) + infected by E. coli (O157: H7) on day 21
All mice received experimental treatments for 4 weeks and the oral infection through gavage needle (108 CFU of Escherichia coli O157: H7) was conducted for once on day 21. Animals were monitored daily for general health and the amount of food eaten. At the end of the experiment (day 28), the mice were euthanized with pentobarbital-HCL (50 mg/kg, i.p.) and sacrificed. The blood, liver, and ileum samples were collected immediately and used for liver enzyme analysis, lipid peroxidation assay, gene expression analysis, and morphometric evaluation of ileum, respectively. The mice were weighed three times at the beginning, middle, and at the end of the experiment. All animal experiments were conducted according to the ethical principles approved by the Islamic Azad University of Mashhad with the code of ethics IR.IAU.MSHD.REC.1399.016.
Liver enzymes and lipid peroxidation assay
The main liver enzymes in the serum including alanine aminotransferase (ALT), aspartate transaminase (AST), and alkaline phosphatase (ALP) were determined using blood auto-analyzer (Hitachi 902, Japan). The lipid peroxidation in the liver tissue was determined as described earlier by Shafaei et al. (Shafaei et al. 2020). Briefly, the liver tissue was homogenized and 200 µl of lysate were mixed by distilled water (300 µl), BHT (35 µl), sodium dodecyl sulfate (165 µl) and thiobarbituric acid (2 ml) respectively. Then, after heating (90oC for 60 min) the cooled solution was mixed by 2 mL of n-butanol and centrifuged at 2000 ×g for 5 min. Finally, the absorbance of the n-butanol part was read at 532 nm and the results were expressed as percentage malondialdehyde (MDA) changes relative to the control.
Histopathology and morphometric analyses
At the end of the in vivo experiment, the mice were sacrificed and the liver, kidney, and ileum were separated and washed using the physiological serum. Then, they were fixed in buffered formalin (10% formalin in 0.1M sodium phosphate buffer, pH7). Finally, they were paraffinized, sliced, and stained according to the hematoxylin/eosin protocol (Shafaei et al. 2020). The histopathology slides were observed under a light microscope using a magnification of 20X. The morpho-structural characteristics of ileum including villus height, villus width, crypt depth, and goblet cell count were determined (Navarrete et al. 2015).
Gene expression analysis
To investigate the response of ileum tissue to different treatments, the expression of major inflammation biomarker genes such as cyclooxygenase 2 (COX2), inducible nitric oxide synthase (iNOS) and antioxidant-related genes including superoxide dismutase (SOD) and glutathione peroxidase (GPx) were determined. The miceʼs ileum tissues which were freshly frozen in the liquid nitrogen, crushed and prepared for RNA extraction by an RNeasy Mini kit (Qiagen, Hilden, Germany) following the recommended protocols. Then, cDNA was synthesized using a Quantitect Reverse Transcription kit (Qiagen, Hilden, Germany). Next, the sets of primer sequences for the key genes and a housekeeping (Beta-actin) gene were applied in the experiment as shown in Table 1. The SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) was used in a comparative Real-time PCR (Roche Diagnostics). The targeted genes were amplified as follows: 95oC for 5 min (1X) for initial denaturation, followed by 35 cycles of 95oC for 30s, primer annealing at 60 and 58 for 30s for the inflammatory genes and antioxidant genes, respectively and extension of 72oC for 30s. The expressions of genes were normalized to beta-actin as a reference gene and then normalized to the expression of respective genes in the control group (Kathirvel et al. 2010). The characteristics of the primer used in this study are presented in Table 7.
|
Table 7. The primer sets characteristics used in this study.
|
|
Gene
|
Forward (5 ́ →3 ́)
|
Reverse (5 ́ →3 ́)
|
References
|
|
COX2
|
caagcagtggcaaaggcctcca
|
ggcacttgcattgatggtggct
|
(Jain et al. 2008)
|
|
iNOS
|
caccttggagttcacccagt
|
accactcgtacttgggatgc
|
(Kou et al. 2011)
|
|
SOD
|
gagacctgggcaatgtgact
|
gtttactgcgcaatcccaat
|
(Kathirvel et al. 2010)
|
|
GPx
|
caagtttttgatgccctggt
|
tcggacgtacttgagggaat
|
(Kathirvel et al. 2010)
|
|
β-actin
|
cctgaaccctaaggccaacc
|
cagctgtggtggtgaagctg
|
(Shafaei et al. 2020)
|
E. coil population analysis
The real-time PCR (LightCycler 96 instrument, Roche, Basel, Switzerland) was used to determine the fold changes of E. coli (O157: H7) population in the ileum digesta. Since the major sites of microbial fermentation and propagation and colonization of enteropathogens in the monogastric is the ileum, that is why in this study the population of E. coil was analyzed only in the ileum section. The real-time PCR condition was 95oC for 5 min (1X) for initial denaturation, followed by 35 cycles of 95oC for 30s, primer annealing at 60, and 55 for 25s for the E. coil and total bacteria, respectively and extension of 72oC for 20s. The primer characteristics are shown in Table 8. The DNA from ileum digesta was extracted using QIAamp DNA Stool, extraction kit (QIAGEN, Germany). The SYBR GREEN Master Mix (BIOFACT, Korea) was used in this study. The previously published primers were used for quantitative real-time PCR assay. The real-time PCR data were analyzed using ∆∆Ct method to determine the fold changes in the E. coli bacteria population and the data were expressed as fold changes of E. coil relative to the total bacteria (Feng et al. 2010; Si et al. 2007).
|
Table 8. The list of the primers used for ileum microbial population analysis
|
|
Bacteria
|
Forward (5 ́ →3 ́)
|
Reverse (5 ́ →3 ́)
|
References
|
|
E. coli (O157:H7)
|
ttaccagcgataccaagagc
|
caacatgaccgatgacaagg
|
(Si et al. 2007)
|
|
Total bacteria
|
cggcaacgagcgcaaccc
|
ccattgtagcacg tgtgtagcc
|
(Denman and McSweeney 2006)
|
Statistical Analysis
The data obtained were subjected to the general linear models (GLM) procedure of SAS [(9.1) (2002-2003) (SAS Institute Inc., Cary, NC, USA)] in a completely randomized design (CRD) and the means were compared with Duncan's Multiple Range Test. The difference was considered significant when the P-value was < 0.05.