Chemokine Receptor 7 (CCR7) Participates in the Migration of DCs&nbsp;and Has Impact on the Progression of Primary Pterygium

doi:10.21203/rs.3.rs-74132/v1

PDF

Research

Chemokine Receptor 7 (CCR7) Participates in the Migration of DCs and Has Impact on the Progression of Primary Pterygium

https://doi.org/10.21203/rs.3.rs-74132/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 18 Sep, 2020

You are reading this latest preprint version

Background: The effect of chemokine receptors and their ligands for dendritic cells (DCs) plays a critical role in the immune response, but whether chemokine receptor 7 (CCR7) has an impact on DCs migrating in pterygia remains unclear. The aim of this article is to investigate the involvement of CCR7 signaling in pathogenesis of primary pterygium.

Methods: Slip lamp photographs of 85 pterygia patients were used to divide the pterygia into three groups, the width, extension, and area of pterygia were measured by computer software, the blood vessels of pterygium and general eye redness were quantitatively analyzed by a specific algorithm. Expression of CCR7 and its ligands C-C motif ligand 19 (CCL19) and C-C motif ligand 21 (CCL21) in normal conjunctivae and excised pterygia collected in surgery were analyzed by qRT-PCR and immunofluorescence staining. The phenotype of CCR7-expressing cells was identified by double-staining with major histocompatibility complex II (MHC II), CD11b and CD11c.

Results: The level of CCR7 was significantly increased with 9.6-fold in pterygium when compared with normal conjunctivae (p=0.008). The higher expression of CCR7, the more blood vessels in pterygium ((R2=0.44, p<0.001) and more general ocular redness ((R2=0.25, p<0.001) pterygium patients had. CCR7 positive cells were co-located with D11b+, CD11c+ or MHC II in mature DCs. Immunofluorescence staining showed CCL21 co-staining with CCR7, which implied CCL21 may be a key ligand of CCR7 in pterygia, rather than CCL19. And CCR7 was significantly associated with the extension of pterygia (R2=0.083, p=0.047, β=0.192).

Conclusions: Our research revealed a possible involvement of CCR7 in the migration of mature DCs and influence the progression of primary pterygia. Targeting CCR7 may be considered as a potential therapeutic approach for the treatment of pterygium.

Translational Medicine

Pterygium

Immune Response

Chemokine Receptor 7

Dendritic Cells

Pterygia is a multifactorial ocular surface disease caused by fibrovascular hyperplasia [1]. The common clinical symptoms of pterygia, which include irritation, foreign body sensation, dryness, decreased visual acuity and blindness, can have a debilitating impact on daily activities. The overall prevalence of pterygia in China is 9.9% (15–84 years old) [2]. Nowadays, there are more than 180 million pterygia patients and 20.1% of them are over 60 years old [3]. The reported rate of recurrence after simple excision without adjuvant treatment ranges from 24–89% [4]. It is a significant burden for society to manage pterygium. However, the pathogenesis of pterygia has not been elucidated yet. Recently, the important role of immunopathologic mechanisms have been mentioned in the pathogenesis of pterygia [2, 5].

CC chemokine receptor 7 (CCR7), a G protein-coupled receptor, is expressed in the mature dendritic cells (DCs). CCR7 has been reported to be the master mediator in the highly complex migratory process in which mature DCs migrate from the affected tissue to the lymph node paracortex in some ocular diseases such as dry eye disease[6, 7], ocular allergy [8], immune rejection [9]. However, there have not been any papers studying CCR7 in pterygia yet. Ligands C-C motif ligand 19(CCL19) and ligands C-C motif ligand 21 (CCL21), the two important ligands of CCR7, are found in the paracortical regions of the lymph node, and CCL21 could also be expressed by lymphatic vessels in nonlymphoid tissue [10]. In the findings of our previous research [11], DCs which populate in the cornea of dry eye migrating to the lymphatic vessels could be affected by CCL21 and CCL19. Thus, the chemokine axis CCR7-CCL21/CCL19 may also accelerate migration of DCs to lymphatic vessels, which may represent the first stage of immune response in pterygia.

DCs capture antigens in the ocular surface and then migrate to the secondary lymph node. As an afferent pathway of immunological response, lymphatic vessels would transform DCs. Once antigens meet with naïve T cell in the Paracortical region of lymph node, the inflammatory cells and pathological T cells are generated to damage the ocular tissues through the transportation of blood vessels. In our previous study, we found that the more severity the pterygia had, the more lymphatic vessels increased in the pterygia. The high expression of vascular endothelial growth factor C (VEGF-C) may contribute to the occurrence of lymphangiogenesis [3]. What’s more, both lymph-microvascular density and lymph-vascular area were correlated with the width and area of pterygia as well as lymph-vascular areas were also correlated with the extension of pterygia [12]. In addition, there are a huge number of immunocompetent cells and inflammatory factors in pterygia such as Mast cells, plasma cells, lymphocytes, DCs, CD4 + T cells, CD8 + T cells, macrophages, tumor necrosis factor α (TNF-α), platelet-derived growth factor (PDGF), VEGF and so on [5, 13]. It suggested that cellular immune response may directly participate in the progression of pterygia.

This study presents the association between CCR7 and pterygia and focuses on the functional impact of CCR7 in pterygia. As far as we know, it is the first time to illuminate the effect of CCR7 in pterygia, so our findings will assist the further understanding on the immunological pathogenesis of pterygia.

Subject

After excluding conjunctivitis, keratitis, dry eye and some other ocular inflammatory diseases, eighty-five patients (37 males and 48 females; average age, 46.3±9.1 years) whose primary pterygia were located in nasal sides were included in the study. All patients underwent excision by the bare sclera technique and combined with conjunctival transplantation in the Department of Ophthalmology at the Third Affiliated Hospital of Sun Yat-sen University. The head, neck and a part of body (approximate 3mm from limbus) of the pterygia were collected as pterygium samples. Twenty-three nasal-side epibulbar conjunctival segments (patients average age, 21±8.6 years, 10 males and 13 females) excised during strabismus surgery near the limbus, were used as control tissues. Forty-eight pterygia and eight epibulbar conjunctival tissues were used for quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR). Fourteen pterygia and six epibulbar conjunctival tissue were used for immunohistochemistry. And twenty-three pterygia and nine epibulbar conjunctival tissue were used for immunofluorescence.

The grading and size of pterygia

Pterygia were defined as a radially oriented fibrovascular lesion crossing the nasal or temporal limbus [14, 15]. Grading of pterygia was performed as previous^3,14. Briefly, Grade 1 denoted a pterygium in which episcleral vessels underlying the body of the pterygium were unobscured and with mild clinical signs of inflammation (conjunctival congestion and edema). Grade 2 was defined as vessels partially visible with moderate inflammation, and Grade 3 as vessels wholly obscured with severe signs of inflammation (Figure 1).

Total area was measured with computer software to circle the area of pterygia and circulated automatically. The extent of two intersecting points between pterygia and cornea was measured as the width of pterygia. And the horizontal extension from pterygia to cornea limbus was recognized as the extension of pterygia (millimeters).

The quantitative evaluation of general redness and blood vessels of pterygium

The degree of visible blood vessels in the pterygium and general redness were quantitatively analyzed by an automatic recognition program. The algorithm mainly adopted a traditional image processing method. Binarization contour extractions of pterygium images were implemented for obtaining the edge information of blood vessels. The HSV color model was used to extract the red pixels to obtain the hyperaemic regions. The interference information was eliminated by morphological method which was usually used for picture processing. By counting the number of pixels in the characteristic area and obtaining the area (unit: pixel), the proportion of blood vessels in the pterygium and general redness could be calculated respectively (Microsoft Visual C++, version 14.1, USA). What’s more, the composite result of general redness, and blood vessels of pterygium was considered as the average of those two proportion.

Quantitative real-time PCR

TRIzol (Invitrogen, United States) was used for total RNA extraction and purification. Reverse transcription into cDNA was performed with a reverse transcriptase kit (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s instructions. The primer sequences used for CCR7, C-C motif ligand 19 (CCL19), C-C motif ligand 21 (CCL21) and Human Tubulin Beta (TUBB) are listed in Table 1. The Quantitative real-time PCR was performed with the StepOne Real-Time PCR System (Applied Biosystems, Alameda, CA, USA) according to the manufacturer’s instructions. For the qRT-PCR analysis, the parameters consisted of predenaturation at 95°C for 60 seconds, followed by 40 cycles of denaturation at 95°C for 10 seconds, annealing, and extension at 60°C for 30 seconds. Then, a melt curve analysis was conducted to assess amplification specificity. Threshold cycle (CT) values were calculated for each well using the software of the real-time thermocycler. Gene expression and the fold change in gene expression were calculated using the ΔΔCt method. The ΔCt data were calculated using GAPDH as the housekeeping gene, and the fold change was calculated using the 2−ΔΔCt method. samples were used as controls and processed and analyzed separately using the same method.

Immunohistochemistry and Immunofluorescence

After being fixed in 4% paraformaldehyde for 24h, samples were embedded in paraffin, serially sectioned at a thickness of 5μm, and rehydrated with graded ethanol-water mixtures. These excised segments were washed by distilled water. Endogenous peroxidase activity was blocked by incubating the sections with 30 mL/L hydrogen peroxidase for 30 min. For antigen retrieval, these tissue sections were autoclaved at 121°C in 10 mmol/L citrate buffer (pH 6.0) for 5 min. Then, these sections were allowed to cool at room temperature for 30 min.

For immunohistochemistry, each sample was cut into 10 sections and each section was eight-micrometer. These sections were incubated overnight at 4°C with a mouse anti-human CCR7 antibody (1:100, Abcam PLC, Cambridge, UK), and a goat anti-mouse IgG antibody (1:500, Abcam PLC, Cambridge, UK) was used as the secondary antibody. These slides were incubated with diaminobenzidine (DAB) and counterstained with hematoxylin. The color of CCR7+ cells was brown after staining. Next, the sections were analyzed using standard light microscopy (Carl Zeiss, Oberkochen, Germany) under 200X and 400X magnification.

Immunofluorescence

For immunofluorescence, these sections were double-stained and the following antibodies were used: a rabbit anti-human CCR7 antibody, a mouse anti-human MHCII (major histocompatibility complex class II) antibody, a mouse anti-human CD11c antibody, a goat anti-human CD11b antibody (1:100, Abcam PLC, Cambridge, UK) and a goat anti-human CCL21 antibody. Then, an Alexa Fluor 488-conjugated donkey anti-rabbit IgG antibody (1:500, Abcam PLC, Cambridge, UK) was used to detect the anti-CCR7 antibody. An Alexa Fluor 555-conjugated donkey anti-goat IgG antibody was used as the secondary antibody for the anti-CD11b and an Alexa Fluor 555-conjugated goat anti-mouse IgG antibody was used to detect staining with the anti-MHCII and anti-CD11c antibodies. Epifluorescence microscopy (Carl Zeiss, Oberkochen, Germany) was used for examination. Pictures of the same location in one section were taken in two excitation wavelengths under 400X magnification. Next, the two pictures were merged and if the proteins were located, it would show yellow.

Statistical analysis

Mann-Whitney and Bonferroni’s test were used to analyze differences in the PCR, results between the grades of pterygia and normal conjunctiva. Spearman’s analysis was used to analyze the association among CCR7, CCL19 and CCL21. Linear regression was used to analyze the association between CCR7 and the characters of pterygium, and between the proportion of blood vessels in the ocular surface and CCR7. Values are shown as the mean ± SD. All reported P-values are 2-tailed, and statistical significance was defined at the α=0.05 level. All analyses were performed using SPSS software (version 26.0; SPSS, Inc., Chicago, IL).

CCR7 more highly expressed in severe pterygia

We detected the CCR7 mRNA level of pterygia and normal conjunctivae using q-RTPCR. The expression level of CCR7 in pterygia was about 9.6 times higher than normal conjunctivae (p=0.008). With the use of immunohischemistry staining, CCR7 positive cells were stained by brown and we could see that there were lots of CCR7 positive cells in the pterygia while few in the normal conjunctivae (Figure 2). After grading the severe of pterygia (grade 1: twelve, grade 2: twenty-two, grade 3: fourteen) by slit lamp, samples were used to detect the CCR7 expression by qRT-PCR. The CCR7 mRNA expression levels in grade 1, 2 and 3 were approximately 6.8 times (p=0.037), 8.1 times (p=0.006) and 14.3 times (p=0.002) higher than normal conjunctiva (Figure 3D). However, there were not significantly difference among grade 1, grade 2 and grade 3 in CCR7 expression (p=0.079).

In addition, the proportion of blood vessels in the pterygium and general redness which calculated by specific algorithm were associated with CCR7. The higher expression of CCR7, the more blood vessels in pterygium and more general ocular redness pterygium patients had. The detail results were illuminated in the table 2. The pictures which the computer recognized and outputted were showed in the Figure 3B and 3C.

CCR7 expressed in the mature DCs

MHCII, CD11c and CD11b are the marks of the mature DCs. Double-stained immunofluorescence was used to detect whether the CCR7 expressed in mature DCs in pterygia. We used excitation wavelength with 555nm to detect the expression of MHCII, CD11c or CD11b that were showed in red. The CCR7+ cells were displayed in green in excitation wavelength with 488nm. After merging two kind of pictures taken in the same view, some areas appeared yellow (Figure 4). It suggested that numbers of green signal colocalized with the red signal, which meant many cells expressed both CCR7 and MHCII /CD11c / CD11b.

CCR7 was corelated with the extension of pterygia

Characters of pterygia like the extension, width, and area were measure by the computer software in the photograph (Table 3). The extension (p=0.773) and the width (p=0.792) of pterygia increased with the grade, while the differences among grades were not significant. Then, we analyzed the association among CCR7, the extension, width and area of pterygia. The expression of CCR7 was significantly associated with the extension of pterygia (R²=0.083, p=0.047, β=0.192, 95%CI 0.002-0.383). However, the co-relationship among the expression of CCR7, the width (p=0.098) and area of pterygia (p=0.081) were not statistically different.

CCR7 combined with CCL21 in pterygia

CCL19 and CCL21, as the two commonest ligands of CCR7, were detected in pterygia. Although the mRNA expression of CCL21 (p=0.785) and CCL19 (p=0.056) in pterygia were not higher than normal conjunctivae (Figure 3E, 3F), after analyzing the relationship between CCR7 and its legends in pterygium, it showed that CCR7 was significantly associated with CCL21 in pterygium (p=0.02). Thus, we further investigated their association using double-stained immunofluorescence. Some CCR7 positive cells showed green co-located with red CCL21, which made the cells showed orange. The orange staining revealed that chemokine, CCL21, was combined with CCR7 positive cell which implied CCL21 may be a key ligand of CCR7 in pterygia, rather than CCL19 (Figure 5).

Because of the high prevalence and recurrence after surgery, pterygia always make ophthalmologists anxious. Although the techniques for pterygium surgery is developing, it still can’t satisfy the increasing number of pterygia patients. Thus, the pathogenesis pterygium should be understood more clearly to assist the progress of treatment. Our previous study demonstrated that pterygia are greatly associated with lymphatic vessels which are the afferent pathway of immunological response [3, 12, 14, 16]. The first and crucial step of immune response is antigen transportation. However, for pterygium, we couldn’t explain the specific way that how the antigens arrive at the lymph node and activate the naïve T cells to induce inflammatory cells and factors yet.

Chemokine axes play important roles in the migration of antigen-presenting cells from peripheral tissues to lymphatic vessels and the following with the lymph fluid arrive at the lymph nodes [17]. CCR7, as one of the most important chemokine receptors, make effect in many diseases like ocular allergy [8, 18], immune rejection of allogeneic corneal transplants[19-21] and so on. To our knowledge, this is the first time to study CCR7 in the pterygia. Our research demonstrated that high level of CCR7 which expressed in the mature DCs had impacts on the development of pterygia, especially in the extension of pterygia to the cornea. CCL21, one of commonest ligands of CCR7, may contribute to the migration of mature DCs when combining with CCR7.

DCs are highly potent stimulators of the immune system, and their contribute to the pathogenesis of ocular surface inflammatory disease has been well established [22-23]. To identify the relationship between CCR7 and DCs in pterygia, we co-stained the markers of DC (MHCII, CD11c and CD11b) and CCR7 in pterygia. As we assumed, CCR7 expressed in mature DCs in pterygia. However, DC is not the only immune cell that migrates from the periphery to the lymph node with the assistance of CCR7. The effect of CCR7 chemokine axis takes T cells and mature DCs flow to the lymph node in which Naive T cells could meet cognate antigen presented by DCs [24, 25]. What’s more, regulatory T (Treg) cells contribute to the immunological tolerance that can suppress pathogenic T cells and abnormal immune responses to maintain the tissue homeostasis. With the high expression of CCR7, Treg cells get access to lymph node from periphery circulation and achieve lymphoid tissues through high endothelial venules [26-28]. Our research only focused on DCs, thus, the influence of CCR7 for T cells in pterygium needs more researches.

The increasing of lymphatic vessels in pterygium, which is illustrated in our previous researches [12, 14], combined with the results of this study implied that CCR7 may activate DC migrating to lymphatic vessels, and accomplish the first step of immune response in pterygia. What’s more, we measured the characters of the pterygium, including the horizontal extension onto the cornea from the limbus (the extension of pterygium), the width of the base at the limbus and the total area of pterygium. We found that the extension of pterygium was significantly associated with the expression of CCR7. It implied that CCR7 might make effects in the invasion of pterygia from limbus to the center of cornea. In addition, one of main innovative contributions of our research was that it is also the first time to use algorithm to quantitatively measure blood vessels of pterygium and general redness in pterygium patients. The grading for pterygium in previous studies [13, 14] is usually a manual classification and thus inherently subjective. We utilized a computer technique to calculate the proportion of blood vessel in the pterygium and general redness to analyze the association between them and the expression of CCR7. It may be more objective and make more sense for the clinical treatment of pterygium.

Although the mRNA levels of CCL19 and CCL21 did not significantly increase, CCL21 was corelated with CCR7 in pterygium. Double-stained immunofluorescence showed that some CCR7 positive cells combined with CCL21. Blood vessels and lymphatic vessels form the two arms of immunological reflex. When CCR7 expressed in the mature DC combines with CCL21, antigens captured by DCs tend to be more effective to migrate to lymphatic vessels [29], and the first step of immunological response was activated. Antigens following with lymphatic fluid arrive at the lymph nodes, and T cells are stimulated by antigens to produce numerous of inflammatory cells and factors. Subsequently, these inflammatory cells and factors return to the ocular surface through blood vessels, which cause the ocular damage (figure 6). Thus, CCR7 may accelerate the immune response in pterygium to some extent and affect the extension of pterygia to invade the cornea. However, our results also implied that there may be some other chemokines that would combine with CCR7 in pterygium, and the influence of CCL21 need further confirmation.

We gave evidences for the first time that CCR7 combined with CCL21, as a significant chemokine axis, is involved in the progression of pterygia invading to the cornea and could accelerate the migration of mature DCs in pterygia. Our findings suggest a novel action of CCR7-CCL21 chemokine axis in pterygium, which may serve as a potential therapeutic target for treatment.

Acknowledgements

Not applicable.

Authors’ contributions

Ting Wang and SQL contributed to the concept of the study. Tao Wang, LZ, XYL XHJ and TCB provided and collected the tissues. Ting Wang Tao Wang and LZ performed the bioinformatics. HQN, Ting Wang and JX contributed to the data analysis. Ting Wang wrote the original draft, while SQL and HTL reviewed and edited. The project was funded by HTL. All authors read and approved the final manuscript.

Funding

This research was supported by the Grant of National Key R&D Program of China (Grant Number 2018YFC0116500) and Guangzhou Key Laboratory Project (202002010006). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request

Ethics approval and consent to participate

All patients and controls have been informed of the experimental nature of this procedure and signed consents have been beforehand. All procedures were conducted according to the principles expressed in the Declaration of Helsinki and was approved by the IRB of the 3rd Affiliated Hospital of Sun Yat-Sen University (NO: [2018] 02-009-01).

Consent for publication

Not application.

Competing interests

The authors have no financial conflicts of interest.

Bock F, Maruyama K, Regenfuss B, Hos D, Steven P, Heindl LM, et al. Novel anti(lymph)angiogenic treatment strategies for corneal and ocular surface diseases. Prog Retin Eye Res. 2013; 34:89-124.
Song P, Chang X, Wang M, An L. Variations of pterygium prevalence by age, gender and geographic characteristics in China: A systematic review and meta-analysis. Plos One. 2017; 12(3):e174587.
Ling S, Liang L, Lin H, Li W, Xu J. Increasing lymphatic microvessel density in primary pterygia. Arch Ophthalmol. 2012; 130(6):735-742.
Cardenas-Cantu E, Zavala J, Valenzuela J, Valdez-Garcia JE. Molecular Basis of Pterygium Development. Semin Ophthalmol. 2016; 31(6):567-583.
Golu T, Mogoanta L, Streba CT, Pirici DN, Malaescu D, Mateescu GO, et al. Pterygium: histological and immunohistochemical aspects. Rom J Morphol Embryol. 2011; 52(1):153-158.
Kodati S, Chauhan SK, Chen Y, Dohlman TH, Karimian P, Saban D, et al. CCR7 is critical for the induction and maintenance of Th17 immunity in dry eye disease. Invest Ophthalmol Vis Sci. 2014; 55(9):5871-5877.
Ji YW, Seo Y, Choi W, Yeo A, Noh H, Kim EK, et al. Dry eye-induced CCR7+CD11b+ cell lymph node homing is induced by COX-2 activities. Invest Ophthalmol Vis Sci. 2014; 55(10):6829-6838.
Schlereth S, Lee HS, Khandelwal P, Saban DR. Blocking CCR7 at the ocular surface impairs the pathogenic contribution of dendritic cells in allergic conjunctivitis. Am J Pathol. 2012; 180(6):2351-2360.
Yang X, Lian K, Meng T, Liu X, Miao J, Tan Y, et al. Immune Adjuvant Targeting Micelles Allow Efficient Dendritic Cell Migration to Lymph Nodes for Enhanced Cellular Immunity. ACS Appl Mater Interfaces. 2018; 10(39):33532-33544.
Purvanov V, Matti C, Samson G, Kindinger I, Legler DF. Fluorescently Tagged CCL19 and CCL21 to Monitor CCR7 and ACKR4 Functions. Int J Mol Sci. 2018; 19(12).
Wang T, Li W, Cheng H, Zhong L, Deng J, Ling S. The Important Role of the Chemokine Axis CCR7-CCL19 and CCR7-CCL21 in the Pathophysiology of the Immuno-inflammatory Response in Dry Eye Disease. Ocul Immunolo Inflamm. 2019; 00(00): 1–12
Liu L, Ling SQ, Li QL, Wang T, Ye H, Yang JZ, et al. Relations between lymphangiogenesis and the size of pterygium. Int J Ophthalmol. 2012; 5(3):312-316.
Bianchi E, Scarinci F, Grande C, Plateroti R, Plateroti P, Plateroti AM, et al. Immunohistochemical profile of VEGF, TGF-beta and PGE (2) in human pterygium and normal conjunctiva: experimental study and review of the literature. Int J Immunopathol Pharmacol. 2012; 25(3):607-615.
Lin H, Luo L, Ling S, Chen W, Liu Z, Zhong X, et al. Lymphatic microvessel density as a predictive marker for the recurrence time of pterygium: a three-year follow-up study. Mol Vis. 2013; 19:166-173.
Awdeh RM, DeStafeno JJ, Blackmon DM, Cummings TJ, Kim T. The presence of T-lymphocyte subpopulations (CD4 and CD8) in pterygia: evaluation of the inflammatory response. Adv Ther. 2008; 25(5):479-487.
Zhao W, Wang T, Deng J, Zhong L, Huang W, Ling S. Conjunctival Lymphangiogenesis Was Associated with the Degree of Aggression in Substantial Recurrent Pterygia. J Ophthalmol. 2016; 2016:1592514.
Ma T, Luan S, Tao R, Lu D, Guo L, Liu J, et al. Targeted Migration of Human Adipose-Derived Stem Cells to Secondary Lymphoid Organs Enhances Their Immunomodulatory Effect and Prolongs the Survival of Allografted Vascularized Composites. Stem Cells. 2019; 37(12):1581-1594.
Khandelwal P, Blanco-Mezquita T, Emami P, Lee HS, Reyes NJ, Mathew R, et al. Ocular mucosal CD11b+ and CD103+ mouse dendritic cells under normal conditions and in allergic immune responses. Plos One. 2013; 8(5):e64193.
Hua J, Stevenson W, Dohlman TH, Inomata T, Tahvildari M, Calcagno N, et al. Graft Site Microenvironment Determines Dendritic Cell Trafficking Through the CCR7-CCL19/21 Axis. Invest Ophthalmol Vis Sci. 2016; 57(3):1457-1467.
Hos D, Dorrie J, Schaft N, Bock F, Notara M, Kruse FE, et al. Blockade of CCR7 leads to decreased dendritic cell migration to draining lymph nodes and promotes graft survival in low-risk corneal transplantation. Exp Eye Res. 2016; 146:1-6.
Lee HJ, Ko JH, Ko AY, Kim MK, Wee WR, Oh JY. Intravenous infusion of mesenchymal stem/stromal cells decreased CCR7(+) antigen presenting cells in mice with corneal allotransplantation. Curr Eye Res. 2014; 39(8):780-789.
Saban DR. The chemokine receptor CCR7 expressed by dendritic cells: a key player in corneal and ocular surface inflammation. Ocul Surf. 2014; 12(2):87-99.
Saban DR, Calder V, Kuo CH, Reyes NJ, Dartt DA, Ono SJ, et al. New twists to an old story: novel concepts in the pathogenesis of allergic eye disease. Curr Eye Res. 2013; 38(3):317-330.
Park K, Mikulski Z, Seo GY, Andreyev AY, Marcovecchio P, Blatchley A, et al. The transcription factor NR4A3 controls CD103+ dendritic cell migration. J Clin Invest. 2016; 126(12):4603-4615.
Tang F, Chen JN, Zhang NN, Gong LP, Jiang Y, Feng ZY, et al. Expression of CCL21 by EBV-associated gastric carcinoma cells protects CD8(+)CCR7(+) T lymphocytes from apoptosis via the mitochondria-mediated pathway. Pathology. 2018; 50(6):613-621.
Hu Z, Li Y, Van Nieuwenhuijze A, Selden HJ, Jarrett AM, Sorace AG, et al. CCR7 Modulates the Generation of Thymic Regulatory T Cells by Altering the Composition of the Thymic Dendritic Cell Compartment. Cell Rep. 2017; 21(1):168-180.
Chauhan SK, Saban DR, Dohlman TH, Dana R. CCL-21 conditioned regulatory T cells induce allotolerance through enhanced homing to lymphoid tissue. J Immunol. 2014; 192(2):817-823.
Schneider MA, Meingassner JG, Lipp M, Moore HD, Rot A. CCR7 is required for the in vivo function of CD4+ CD25+ regulatory T cells. J Exp Med 2007; 204(4):735-745.
He J, Li X, Zhuang J, Han J, Luo G, Yang F, et al. Blocking Matrix Metalloproteinase-9 Abrogates Collagen-Induced Arthritis via Inhibiting Dendritic Cell Migration. J Immunol. 2018; 201(12):3514-3523.

Table 1 Primer sequences for qRT-PCR
Gene	Primer sequences (5′-3′)	Product length(bp)	Tm (℃ )
CCR7	F: GTGGTGGCTCTCCTTGTCATTT	160	60
NM_001838.3	R: ACATGATAGGGAGGAACCAGGC
CCL21	F: TGAGCCTCCTTATCCTGGTTCTG	221	60
NM_002989.3	R: CTCCTTTGGGTCTGCACATAGCT
CCL19	F: GGCACCAATGATGCTGAAGACT	191	60
NM_006274.2	R: CTCTGGATGATGCGTTCTACCC
TUBB	F: CTGACCACACCAACCTACGG	158	60
NM_178014.2	R: CCAGGCATAAAGAAATGGAGAC

Table 2 the relationship between CCR7 and characters evaluated by computer
proportion	average (%)	SD (%)	R²	p*	β
blood vessels of pterygium	12.92	5.98	0.44	<0.001	0.66
general redness	29.64	23.27	0.25	<0.001	0.5
the composite result of two factors	21.28	13.14	0.35	<0.001	0.59
*Linear regression was used to test

Table 3 Extension, width and area of pterygia
	Extension of pterygia(mm) Mean±SD	Width of pterygia(mm) Mean±SD	Area of pterygia(mm²) Mean±SD
Total	1.65±0.53	2.21±0.58	8.91±3.66
Grade 1	1.49±0.47	2.10±0.60	7.89±3.85
Grade 2	1.61±0.33	2.23±0.44	8.62±2.47
Grade 3	1.86±0.76	2.27±0.77	10.23±4.81

PDF

Version 1

posted 18 Sep, 2020

You are reading this latest preprint version

Chemokine Receptor 7 (CCR7) Participates in the Migration of DCs and Has Impact on the Progression of Primary Pterygium

Status:

Version 1

Abstract

Figures

Introduction

Methods

Results

Discussion

Conclusions

Declarations

References

Tables

Status:

Version 1