Determination of The Relationship Between Exposure To Novel Industrial Toxicant HFPO-DA, C. Elegans, and Aging

doi:10.21203/rs.3.rs-741564/v1

Download PDF

Research Article

Determination of The Relationship Between Exposure To Novel Industrial Toxicant HFPO-DA, C. Elegans, and Aging

https://doi.org/10.21203/rs.3.rs-741564/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 19 Oct, 2021

You are reading this latest preprint version

Industrial toxicant hexafluoropropylene oxide dimer acid (HFPO-DA, ammonium salt with trade name “GenX”) has recently been detected in the environment. HFPO-DA’s potential aging-related effects on organisms of higher trophic levels (worms, humans, etc.) have not been extensively explored. This study aims to quantify impact on C. elegans (free-living nematode) lifespan of HFPO-DA exposure, specifically via ingestion to simulate toxicant exposure mechanisms most prevalent in nature (through lower trophic-level organisms). C. elegans N2 (wild-type) samples were prepared with uracil-based medium and E. coli OP50 (food source) at room temperature; C. elegans in the experimental, treated sample was fed E. coli OP50 incubated with 280 ng/L HFPO-DA. The target gene pqm-1 was selected due to its key role in an aging-related insulin signaling pathway evolutionarily conserved in humans. Molecular biology laboratory techniques (RNA extraction, qRT-PCR, fluorescence tagging, etc.) were used to quantify pqm-1 expression to yield four technical replicates for each sample. The data was analyzed through null hypothesis t-tests, heatmaps, protein interactions, and gene homology tools. HFPO-DA exposure through E. coli caused a statistically insignificant (0.811-fold) change in pqm-1-related aging in C. elegans. Future work includes investigating the effects of different levels of HFPO-DA exposure on C. elegans aging.

Environmental Engineering

Environmental Policy

Hexafluoropropylene oxide dimer acid (HFPO-DA)

Caenorhabditis elegans

pqm-1

gene expression

aging

HFPO-DA is an ammonium salt with the trade name “GenX” and is a potent toxicant used in manufacturing industries that has recently been detected in global river water ecosystems (Bao et al., 2018). Through this study, we sought to quantify the potential effects of HFPO-DA exposure on pqm-1 gene expression in C. elegans, a free-living transparent nematode, in order to determine whether such chemical stress could influence aging processes in C. elegans.

C. elegans was used as a model organism primarily because of its relevance to and the important role it plays in many river ecosystems. C. elegans full genome has been sequenced, and C. elegans shares many of the same genes and biological pathways with humans, which expands this study’s results to have human-centered impact (“Why use the worm in research?”). Additionally, with a life cycle of two weeks, C. elegans is relatively easy to grow in a short period of time and can produce more than 1,000 eggs daily (“Why use the worm in research?”). C. elegans is also inexpensive to maintain and only requires cultures of bacteria and a nutrient source.

The target gene pqm-1 was selected for several reasons. In C. elegans, the PQM-1 protein (encoded by pqm-1) is an important nuclear transcription activator that binds to the DAF-16 Associated Element (DAE) upstream of development (Class II) genes (Tepper et al., 2013; “Pqm-1 (gene)”). In nature, reduced insulin/IGF-1-like signaling (IIS) leads to PQM-1 remaining in the cytoplasm and thus downregulation of Class II genes, increasing lifespan (Tepper et al., 2013). IIS is also conserved across many species, including mammals; therefore, the implications of IIS in C. elegans may reflect aging outcomes in humans.

Regarding the selection of the reference gene, previous studies have shown that tba-1 (alpha tubulin subunit) expression is predominantly localized to developing germ cells and nervous system to maintain embryonic viability (Hurd, 2018). Therefore, experimental factors are unlikely to significantly affect tba-1 expression in mature adult C. elegans, in which tba-1 is only expressed at the minimum level for survival. A previous toxicology study also showed that tba-1 expression in C. elegans was stable with exposure to nano-copper oxide (industrial toxicant similar to HFPO-DA), suggesting its reliability as a reference gene when measuring gene expression in C. elegans in response to HFPO-DA exposure (Batista et al., 2008).

It was hypothesized that the difference in relative pqm-1 gene expression between the experimental and control groups will not be statistically significant and that HFPO-DA will induce a statistically significant difference in relative pqm-1 gene expression.

Animal Care and Maintenance

C. elegans N2 (wild type) was fed E. coli OP50, maintained at a temperature of 23℃, and kept in a uracil-based growth medium. The experimental group of C. elegans was fed E. coli incubated with 280 ng/L HFPO-DA, simulating how C. elegans and humans may be exposed to HFPO-DA in nature via lower trophic-level organisms.

RNA Extraction and Quantification

RNA extraction was commenced by using the M9 buffer to wash C. elegans off of the NGM plates, transferring the worms into conical tubes with a pipette, centrifuging C. elegans to the bottom of the tubes, and removing the liquid supernatant. C. elegans cells were then disrupted with Buffer RLT Plus. Four beads were added to each sample tube, and all the tubes were loaded to the Bead Mill for homogenization. Lysis and purification were conducted through the RNeasy Plus Mini Kit. The RNeasy Plus Mini Kit handbook by Qiagen was followed to ensure adherence to recommended procedural guidelines. NanoDrop 2000 was used to assess the quality and quantity of the extracted RNA; if needed, the RNA samples were exposed to DNase I and protease for further RNA purification.

qRT-PCR was used to produce quantifiable gene expression results. For pqm-1, reverse transcriptase and the DNA forward and reverse primers CACCGCCGACTACTATGCC and TCGGCTGCATTAGGTTTACTGTG, respectively, were added to the RNA solutions. Taq polymerase, a heat-stable DNA polymerase found in T. aquaticus, was also added Solutions the solutions. The solutions were then subjected to multiple heat cycles to separate DNA strands, allowing Taq polymerase to bind to primers and synthesize complementary DNA strands. The qRT-PCR was designed such that the positive control would be the samples with the reference tba-1 gene, the negative control would be samples missing a key cellular component, and the repeated measurements for each sample would serve as technical replicates.

The iTaq™ Universal SYBR® Green One-Step Kit was used for quantification of RNA products, as it contains SYBR Green I (a chemical that binds to the minor grooves in double stranded DNA and emits green light under blue light). ROX (emits red light) was used to provide a baseline reflectance level and normalize the results.

Data Analysis

The Google Sheets software was used to calculate data based on the threshold number of cycles (Ct) (i.e., the number of cycles needed to achieve a statistically significant signal increase relative to the background level). The ΔCt (difference between Ct values of target and reference genes within a sample), average ΔCt’s for each condition, ΔΔCt (difference between average ΔCt’s of experimental and control conditions), and 2^−ΔΔCt (fold relationship between target RNA transcripts of experimental and control conditions) values were calculated. A two-tailed t-test was conducted for the ΔCt values to assess the significance of the results (with a p-value threshold of 0.05).

The JMP Pro software was used to create heatmaps, a technique used to visualize gene expression data. The STRING Database was used to construct gene-to-gene and protein networks based on the pqm-1 gene and was also used to identify interactions and other pathways of interest. HomoloGene was used for gene homology analysis.

The heatmap (refer to Fig. 1) shows a slight decrease in relative pqm-1 expression in the experimental condition compared to in the control condition. After using Google Sheets for data analysis (refer to Appendix A), it was also revealed that the average ΔCt values for the experimental (HFPO-DA exposure) and control conditions were 5.694 and 5.392, respectively. The ΔΔCt value was 0.302, and the fold relationship (2^−ΔΔCt ) value from the averaged ΔCt values was 0.811. The p-value from the aforementioned two-tailed null-hypothesis t-test was 0.770.

The STRING protein interactions analysis (refer to Fig. 2) depicted PQM-1’s association with DAF-16 (transcription activator, binds to the DAF-16 Binding Element (DBE)) and DAF-2 (insulin-like receptor tyrosine kinase). PQM-1 was also associated with BLMP-1 (transcription factor regulating vulvar development), ELT-2 (promotes normal gut-specific differentiation), PHA-4 (transcription factor promoting pharyngeal cell determination), GEI-11 (needed for germ-line maintenance), and other transcription factors (e.g., NHR-77) related to development and growth (Batista et al., 2008).

Pqm-1 was found to be only exclusive to C. elegans; thus, the gene homology graph compares pqm-1 with F10B5.3, another related gene in C. elegans. Their query coverage and percent identity were 59% and 74.26%, respectively (refer to Fig. 3).

As shown in the heatmap (Fig. 1), relative pqm-1 expression was slightly lower in C. elegans exposed to HFPO-DA than in the control group by a fold change of 0.811. However, we fail to reject the null hypothesis that the difference in relative pqm-1 gene expression between the experimental and control groups was not statistically significant (p = 0.770 > 0.05, two-tailed). It can thus be concluded that the results do not indicate a significant influence of HFPO-DA exposure, via E. coli OP50, on aging in C. elegans specifically in relation to pqm-1.

The STRING analysis suggests that PQM-1 is associated with not only members of the IIS pathway, but also other proteins that are involved in development, growth, and maturation of C. elegans. This underscores the integral role of pqm-1 expression in contributing to Class II (development) gene expression and thus aging in C. elegans. Although humans and mammals share IIS pathways as C. elegans, no direct homologues for pqm-1 were found outside of the C. elegans species. The pqm-1 expression patterns analyzed in this study may not directly apply to humans; however, the STRING analysis strongly suggests that relationships between HFPO-DA exposure and aging in C. elegans and in humans share commonalities on an IIS pathway level. Thus, future research may aim to confirm the existence of such a similar relationship between HFPO-DA exposure and human aging on a developmental pathway level.

This study’s limitations include the number of technical replicates that were used for each condition. No biological replicates were analyzed; thus aging variability across the C. elegans species may not have been accurately reflected in the results. Due to time constraints, RNeasy was used for RNA extraction from the samples; however, the TRIzol protocol is more accurate and often results in higher yields.

Other future directions include exposing E. coli to different amounts of HFPO-DA and determining a potential threshold for HFPO-DA concentration and abnormal C. elegans aging. Longitudinal studies could also be conducted to explore the effects of direct HFPO-DA exposure on overall C. elegans development across the lifespan. Another possibility may be to repeat the experiment with different means of HFPO-DA exposure or in a higher order organism. This study’s results may prove useful in future research on aging with other similar toxicants.

Ethics Approval and Consent to Participate

All experimental subjects were used in adherence to approved ethical standards.

Consent for Publication

Not applicable.

Availability of data and material

Not applicable. All relevant data is included in the body of the manuscript.

Competing interests

The authors declare that they have no competing interests.

Funding

All funding was provided by the author of this manuscript.

Author contributions

VN initiated the study, performed all data analysis, and authored and edited the manuscript.

Acknowledgements

Not applicable.

Author information

VN is affiliated with Stony Brook University as part of the Honors College, Department of Neurobiology and Behavior, and the highly selective Scholars for Medicine Combined 4+4 Bachelor’s/MD program at the Renaissance School of Medicine. VN has extensive research experience in projects conducted with internationally-renowned research professionals and through high profile research institutions and entities; including the University of California, San Diego Extension; the BioScience Project; and the Boz Research and Teaching Institute. VN’s work and research has been recognized internationally through numerous publications and presentations. VN is also a member of the prestigious New York Academy of Sciences. Through publishing his work, VN hopes to advance research and contribute to the greater scientific community.

Batista PJ, Ruby JG, Claycomb JM, Chiang R, Fahlgren N, Kasschau KD, Chaves DA, Gu W, Vasale JJ, Duan S, Conte D Jr, Luo S, Schroth GP, Carrington JC, Bartel DP, Mello CC (2008) PRG-1 and 21U-RNAs interact to form the piRNA complex required for fertility in C. elegans. Molecular cell 31(1):67–78. https://doi.org/10.1016/j.molcel.2008.06.002
Bao Y, Deng S, Jian X, Qu Y, He Y, Liu L, Chai Q, Mumtaz M, Huang J, Cagnetta G, Yu G (2018) Degradation of PFOA Substitute: GenX (HFPO–DA Ammonium Salt): Oxidation with UV/Persulfate or Reduction with UV/Sulfite? Environmental Science Technology 2018 52(20):11728–11734. DOI:10.1021/acs.est.8b02172
Hurd DD Tubulins in C. elegans. (August 4, 2018), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.182.1, http://www.wormbook.org
Pqm-1 (gene) - WormBase: Nematode Information Resource. (n.d.). Retrieved August 12, 2020, from https://wormbase.org/species/c_elegans/gene/WBGene00004096
Tepper RG, Ashraf J, Kaletsky R, Kleemann G, Murphy CT, Bussemaker HJ (2013) PQM-1 complements DAF-16 as a key transcriptional regulator of DAF-2-mediated development and longevity. Cell 154(3):676–690. https://doi.org/10.1016/j.cell.2013.07.006
Why use the worm in research? (2015, June 19) Retrieved August 12, 2020, from https://www.yourgenome.org/facts/why-use-the-worm-in-research

Appendices.docx

Download PDF

Version 1

posted 19 Oct, 2021

You are reading this latest preprint version

Determination of The Relationship Between Exposure To Novel Industrial Toxicant HFPO-DA, C. Elegans, and Aging

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Animal Care and Maintenance

RNA Extraction and Quantification

Data Analysis

Results

Discussion And Conclusion

Declarations

References

Supplementary Files

Status:

Version 1