Animals and ethical statement
This study used 8- to 12-week-old C57BL/6J male mice (CLEA Japan Inc., Tokyo, Japan) as syngeneic donors for islet and diabetic recipients. They were housed under specific pathogen-free conditions and freely fed diet and water. There was no fasting treatment before a challenge or assessment except before the glucose tolerance test (GTT). The care of mice and experimental procedures complied with the “Principles of Laboratory Animal Care” (Guide for the Care and Use of Laboratory Animals, National Institutes of Health publication 86 − 23, 1985). The experimental protocol was approved by the Animal Care and Use Committee of Fukuoka University (approval number: 2010058).
Islet isolation
The islet isolation technique was summarized by collagenase digestion and purification. The current study’s protocol was modified from the original method shown by Gotoh et al.28 Pancreatic tissue digestion, using 1 mg/mL collagenase V (Merck, Sigma-Aldrich, St. Louis, MO, USA) solution, was undertaken at 37°C for 18 min, after which islets were isolated by Biocall-Separating solution (Biochrom GmbH, Berlin, Germany), density gradient (1.100, 1.083, 1.077, and 1.040), and centrifugation at 2,000 rpm for 13 min. Approximately 100% purity was guaranteed using a 70 µm Cell Strainer (Corning Inc., Corning, NY, USA) and handpicking under the microscope.
Adiponectin treatment
Isolated islets were cultured in low glucose Dulbecco’s Modified Eagle Medium (DMEM; Thermo Fisher Scientific, Gibco, Tokyo, Japan) with 0.2% bovine serum albumin (Merck, Sigma-Aldrich) and 1% penicillin-streptomycin solution (Thermo Fisher Scientific, Invitrogen™, Waltham, MA, USA) overnight. Fetal bovine serum (FBS) was not used to avoid the influence of some growth factors in FBS, which may ameliorate the condition of isolated islets. Inoculation of adiponectin to the islets was done by containing recombinant mouse adiponectin (10 µg/mL; Adiponectin Mouse HEK293, BioVendor Research and Diagnostic Products, Brno, Czech Republic) in the culture medium (defined as adiponectin (+) group). As the control, islets without adiponectin treatment were prepared (adiponectin (−) group). The dose of adiponectin was determined according to previous publications22,29.
Real-time reverse-transcription polymerase chain reaction analysis
Total RNA was extracted from islets (over 500 islets) using TRIzol™ Reagents (Invitrogen™, Thermo Fisher Scientific) and a PureLink® RNA Mini Kit (Thermo Fisher Scientific) following the manufacturer’s instructions. Reverse-transcription was performed using the QuantiTect Reverse-Transcription Kit (QIAGEN K.K., Tokyo, Japan). Real-time reverse-transcription polymerase chain reaction (RT-PCR) analysis was undertaken using the CFX Connect™ Real-Time PCR Detection Systems (Bio-Rad Laboratories, Inc., Hercules, CA, USA) with THUNDERBIRD® SYBR® qPCR Mix (Toyobo Co., LTD., Osaka, Japan). All primers were designed by Fasmac Co., Ltd. (Atsugi, Japan). The results were normalized to housekeeping genes (Actb). Data are presented as fold difference over the detectable Ct value, which was calculated using the ΔΔCt method. Primers for real-time RT-PCR are shown as follows:
Primer Sequence (5′-3′) Tm (℃)
Actb F: CATCCGTAAAGACCTCTATGCCAAC 67.2
Actb R: ATGGAGCCACCGATCCACA 69.0
AdipoR1 F: CCGTCCGGGCAGTACACT 61.4
AdipoR1 R: ATCTGTGAAGGAGCAGCAG 57.1
AdipoR2 F: CACCGGAGCTGCCCTCTA 60.8
AdipoR2 R: AGTGAAACCAGATGTCACA 53.9
Ins2 F: TCAAGCAGCACCTTTGTGGTT 63.1
Ins2 R: TCCACCCAGCTCCAGTTGT 61.7
Itgb1 F: CCATGCCAGGGACTGACAGA 64.7
Itgb1 R: GAGCTTGATTCCAATGGTCCAGA 64.8
Itgb2 F: GCATCTGTGGGCAGTGTGTA 60.8
Itgb2 R: ATTTGCCACAGTTGCAGGA 60.3
Vegfa F: ACATTGGCTCACTTCCAGAAACAC 67.2
Vegfa R: TGGTTGGAACCGGCATCTTTA 68.2
Vegfb F: CACTGGGCAACACCAAGTC 64.4
Vegfb R: TGTCTGGCTTCACAGCACTC 64.4
Vegfc F: CAGTGCATGAACACCAGCACA 68.5
Vegfc R: TAGACATGCACCGGCAGGAA 68.9
Glucose-stimulated insulin secretion and measurement of insulin content in islet
Glucose-stimulated insulin secretion (GSIS) was assessed using 10 islet equivalents (IEQs; 150 µm-sized islets). Islets were preincubated with 3.3 mM glucose for 60 min. After preincubation, the islets were stimulated with glucose at 3.3 mM (low glucose) and 16.5 mM (high glucose) for 60 min. Insulin in the culture supernatants was measured by the enzyme-linked immunosorbent assay (ELISA) using a Mouse Insulin ELISA Kit (RTU; FUJIFILM Wako Shibayagi Co., Shibukawa, Gumma, Japan). iMark Plate Reader (Bio-Rad Laboratories, Inc.) with Microplate Manager® Software (ver. 6.3, Bio-Rad Laboratories, Inc.) were used for reading plates. The stimulation index, defined as the ratio of insulin volumes between high and low glucose stimulation, was calculated. Furthermore, the volume of insulin in an islet was measured using this ELISA kit. For this assessment, insulin was extracted from 10 IEQs using 1 mL RIPA buffer (FUJIFILM Wako Chemical, Osaka, Japan) containing protease inhibitor cocktail (×100; Nacalai Tesque, Kyoto, Japan) and phosphatase inhibitor cocktail (Nacalai Tesque).
Cellular viability of islets
Islets were stained with Hoechst® 33342 and propidium iodide (PI) (Thermo Fisher Scientific). Cellular viability of islets was defined as ([Hoechst® 33342-positive cells] − [PI-positive cells])/[Hoechst® 33342-positive cells] × 100 (%).
Quantification of internal vascular endothelial growth factor and integrin β1 in islets
The quantifications of internal vascular endothelial growth factor (VEGF), an angiogenic factor, and integrin β1, a receptor for various extracellular matrices including collagen, fibronectin, and laminin, were performed using an ELISA kit. Islets were cultured in a low glucose DMEM culture medium with 0.2% bovine serum albumin and 1% penicillin-streptomycin solution with or without adiponectin at 37 ℃ and 5% CO2 for 24 h. Regarding VEGF, 50 islets were dissolved by 100 µL radioimmunoprecipitation assay buffer (RIPA) buffer with protease and phosphatase inhibitor. Moreover, the lysates were collected as samples. Mouse VEGF Detection Kit (Chondrex, Inc., Woodinville, WA, USA) was used following the manual. Regarding integrin β1, 10 islets were seeded on Costar® 96 well cell culture plate (Life Science, Corning, Glendale, AZ, USA) with the treatment of poly-L-lysine (Merck, Sigma-Aldrich) and cultured in low glucose DMEM culture medium with 0.2% bovine serum albumin and 1% penicillin-streptomycin solution with or without adiponectin at 37 ℃ and 5% CO2 for 24 h. CytoGlow™ Integrin β1 (Assay Biotechnology, Fremont, CA, USA) was used for quantification following the manual. Primary antibody (rabbit polyclonal anti-integrin β1 antibody or mouse monoclonal antiglyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody was used as an internal control) was incubated at 4 ℃ for 16 h after treatments of endogenous peroxidase inactivation and blocking. Color development was then done by adding TMB substrate after reaction of horseradish peroxidase-conjugated secondary antibody. Absorbance at 450 nm (optical density, OD450) was determined using iMark™ Microplate Absorbance Reader with Microplate Manager® Software 6.
Diabetes induction in recipient mice
Diabetes was induced in recipient mice by one-shot intravenous injection of streptozotocin (180 mg/kg body weight; Merk, Sigma-Aldrich). The blood glucose levels of the mice were measured using the Glutest Mint (Sanwa Kagaku Kenkyusho Co. Ltd., Nagoya, Japan) at 5–7 days after injection. Mice with blood glucose levels exceeding 400 mg/dL were used as diabetic recipients.
Islet transplantation and monitoring
Eighty islets were transplanted into the renal subcapsular space of diabetic mice under general anesthesia using isoflurane (FUJIFILM Wako Pure Chemical Corporation). Engraftment/rejection assessment of transplanted islets was performed by monitoring blood glucose and plasma insulin levels and changes in blood glucose level in the GTT. Nonfasting blood glucose level was measured at 8–10 a.m. on postoperative days (PODs) 0 (i.e., pretransplantation), 1, 3, 5, 7, 10, 14, 17, 21, 24, 28, 35, 42, 49, and 56. Moreover, normoglycemia was defined as a BG level of < 200 mg/dL. Blood samples for plasma insulin were collected from the tail veins of the mice on PODs 0, 3, 7, 14, 28, and 56. The collected blood volume was 200 µL (approximately 80 µL plasma was obtained from each blood sample). The samples were isolated in plasma and preserved at − 80°C until measurement. Plasma insulin levels were measured using a Mouse Insulin ELISA Kit (RTU). Intraperitoneal glucose tolerance tests (IPGTTs) were also performed 2 months after transplantation. Furthermore, glucose solution (2 g/kg body weight) was injected into the peritoneal cavity of the mice after 10–12 h of fasting, and glucose levels were measured at 0, 30, 60, 90, and 120 min after injection. In addition, the area under the curve values for blood glucose level in GTT (AUCs-GTT) were calculated.
Graftectomy
After the assessment of the ITx therapeutic effect, the left kidneys were recovered from the mice in both adiponectin (+) and adiponectin (−) groups under general anesthesia. The left nephrectomy procedure was characterized by ligation of the left renal artery and vein at the hilum of the kidney. Blood glucose levels in adiponectin (+) group were measured before and after the nephrectomy.
Histological assessment
Kidney and isolated islets samples were used for histological assessment. The left kidney was recovered at PODs 14 and 56 after transplantation to evaluate any early changes in transplanted islets. Moreover, islets embedded in 2% agarose (UltraPure™ LMP Agarose; Invitrogen™) gel were used to detect adiponectin receptor AdipoR1. The organs and tissues were fixed using a 10% neutral formalin buffer solution and embedded using paraffin. Paraffin sections (3 µm) of kidney specimens were either stained with hematoxylin and eosin or subjected to immunohistochemistry to examine insulin (to detect islets) and von Willebrand factor (vWF, to detect vessels). The primary antibodies were guinea pig anti-insulin (1:100; Agilent, Dako, Tokyo, Japan), rabbit anti-vWF antibody (1:100; Abcam, Cambridge, UK), rabbit anti-AdipoR1 (1:1,000; Abcam), and goat anti-AdipoR2 (1:250; Abcam). After incubation with the primary antibodies, Alexa 488-conjugated donkey anti-guinea pig (1:100; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA), Alexa 647-conjugated donkey antirabbit (1:100; Jackson ImmunoResearch Laboratories, Inc.), Alexa 488-conjugated goat antirabbit (1:100; Jackson ImmunoResearch Laboratories, Inc.), Cy3-conjugated goat antirabbit (1:100; Jackson ImmunoResearch Laboratories, Inc.), Alexa 488 antigoat, and Cy3 antigoat were used as secondary antibodies. Nuclear staining was performed using 4′,6-diamidino-2-phenylindole (DAPI). All histology was observed using a BZ-X700 microscope (Keyence, Itasca, IL, USA). These findings were quantified for statistical evaluation. The vessel density in the engrafted islets was calculated using the following formula: [numbers of vessels (vWF-positive) in an islet/area of an islet] (/mm2) and [vWF-positive area / area of an islet] in a field of view at ×200 magnification. AdipoR1 or AdipoR2-positive area per islet (in percentage) was also quantified using the same method. These quantifications were performed using ImageJ® software (National Institutes of Health, Bethesda, MD, USA).
Statistical analysis
Blood glucose, plasma insulin, and change in blood glucose in the IPGTT were compared between the fat-covered and other groups using two-way repeated-measures analysis of variance. Comparison of normoglycemia rate was made using the Kaplan–Meier method with the log-rank test. All multiple comparisons were assessed using Dunnett’s test. All the data are presented as mean ± standard error of the mean. Significant differences were defined as P < 0.05. All tests were two-sided, and all statistical analyses were performed by JMP®12.0.0 (SAS Institute Inc., Cary, NC, USA).
Statement on ARRIVE guidelines
Study is reported in accordance with ARRIVE guidelines. All experiments were performed in accordance with relevant guidelines and regulations.