Healthy volunteers and COPD patients
All healthy volunteers and patients enrolled in the study signed written informed consent. The study was approved by the ethics committee of Shenzhen University located in Shenzhen, China (reference NSSKH201908).
Isolation of PBMCs
PBMCs from healthy and COPD individuals were isolated using 9-mL Vacuette tubes with 3.8% sodium citrate (Greiner Bio-One, Kremsmünster, Austria). Blood samples were diluted with equal volumes of tris-buffered saline solution (TBSS, pH 7.5), inverted 10 times, and centrifuged at 1700 ´ g for 30 minutes at room temperature. The uppermost PBMC-containing buffy coat was removed, resuspended and transferred to 15-mL conical tubes. Cells were washed one time with cold PBS and centrifuged at 300 ´ g for 10 minutes. If required, red blood cell contamination was mitigated with ACK lysis buffer (Leagene, Beijing, China). The PBMCs were then washed with cold PBS and spun down. The cell viability and number were measured by a Countess Automated Cell Counter (Invitrogen, Shanghai, China) according to the manufacturer’s instructions.
PBMC culture and stimulation with granulocyte-macrophage colony-stimulating factor (GM-CSF)
Isolated PBMCs were re-suspended using preheated Roswell Park Memorial Institute (RPMI) 1640 culture medium (Thermo Fisher Scientific, Shanghai, China) containing 10% fetal bovine serum (FBS, Gibco, Shanghai, China), 100 IU penicillin (Thermo Fisher Scientific, Shanghai, China), and 100 µg/mL streptomycin (Thermo Fisher Scientific, Shanghai, China), seeded in cell culture petri dishes (Thermo Fisher Scientific, Shanghai, China), and cultured at 5% CO2 at 37°C for 3 hours. The culture medium was refreshed to remove non-attached cells, followed by stimulation with 100 ng/mL GM-CSF. The stimulation process continued for 14 days, and the medium was refreshed every 2 days.
Macrophage induction using lipopolysaccharide (LPS)
After being stimulated by GM-CSF, cells were induced by 100 ng/mL LPS (Thermo Fisher Scientific, Shanghai, China) for 24 hours.
Flow cytometry
Flow cytometry was performed based on a standard protocol as published previously [25]. Briefly, PBMCs were dissociated with 0.25% trypsin (Sigma-Aldrich) and counted. Cells were washed twice using cold PBS, followed by adjusting the cell number to be 1 × 107 cells/mL. Cells were stained with 20 μL of fluorochrome-conjugated antibodies (1:1000), including phycoerythrin (PE)-Cy5-conjugated human CD86 (eBioscience, San Diego, CA), fluorescein isothiocyanate (FITC)-conjugated human CD80 (eBioscience, San Diego, CA), allophycocyanin (APC)-conjugated anti-human HLA-DQ (eBioscience, San Diego, CA), and PE-conjugated anti-human CD68 (eBioscience, San Diego, CA) for 30 minutes at room temperature in the dark. Cells were washed twice using cold PBS, followed by fixation buffer (Beyotime Biotechnology, Beijing, China) for 15 minutes. Cells were then permeabilized using permeabilization buffer (Beyotime Biotechnology, Beijing, China) for 15 minutes. Cells were washed again using cold PBS and analyzed using a BD FACSCalibur benchtop flow cytometer. Incubations with matched immunoglobulin isotypes were done in parallel as controls using APC-conjugated mouse IgG1 (P3; eBioscience, San Diego, CA), Alexa Fluor 488-conjugated mouse IgG2a (eBM2a; eBioscience, San Diego, CA), PE-conjugated mouse IgG1 (P3; eBioscience, San Diego, CA), or PerCP-Cy5.5-conjugated mouse IgG1 (P3; eBioscience, San Diego, CA). The data were analyzed using FlowJo 7.6 software (Flowjo, BD, Ashland, USA).
Extraction, quantitation, and qualitative analysis of RNA
RNA was extracted from PBMCs using the Total RNA Extraction Kit (R6834-01, Omega, USA) following the manufacturer’s instructions. Briefly, cells were lysed by Trizol (Invitrogen, Shanghai, China), followed by the addition of 200 μL of chloroform and mixed for 30 seconds. The samples were then centrifuged at 14000 ´ g for 15 minutes at 4°C. An equal volume of isopropanol was added, incubated for 10 minutes, and then the samples were centrifuged at 14000 ´ g for 10 minutes at 4°C. Finally, 60 μL of diethylpyrocarbonate (DEPC) water was used to resuspend the RNA. The yield and purity of RNA were determined by spectrophotometric measurements of the ratio of the UV absorbance at 260 and 280 nm by a Nanodrop 2000 (Thermo Fisher Scientific, Shanghai, China). Five hundred nanograms of RNA was used for cDNA synthesis, which was performed using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Shanghai, China) and then stored at -20°C. The qRT-PCR amplifications were carried out using a LightCycler® 480 SYBR® Green I Mastermix (Roche, Shanghai, China) on a LightCycler 480 system. The qRT-PCR protocol is published elsewhere [26, 27]. The specificity of primers was evaluated using a dissociation curve analysis. All reactions were performed in duplicates. The comparative CT method (2-ΔΔCT) was used to normalize target gene expression levels according to the previous method [28]. The primers used are listed in Table 1.
Table 1
Primers used for qRT-PCR in the study.
Primers
|
Sequences
|
HDAC1-F
|
5’ GGACTGTGTAGGCATCTTCTG
|
HDAC1-R
|
5’ CAATGACAGCTCCCACAAAG
|
S1PR1-F
|
5’ TAGCACATGCAGCTTCTTTC
|
S1PR1-R
|
5’ TCCATGTAAACTGGGTGGTT
|
Plasmid transient transfection
Transient plasmid transfection was performed according to previous methods [29]. Briefly, when cell confluency researched 60% to 70%, the culture medium was removed and 1 mL of transfection medium was added. The ratio of plasmid to polyethylenimine was set at 1:3, which was then mixed, incubated at room temperature for 10 minutes, and then added into the wells of a 12-well plate containing the cells. Wells were mixed gently by swirling and then incubated for 3 hours in an incubator at 37°C with 5% CO2. Three hours post-transfection, the old medium was removed, new medium was added, and the cells were incubated overnight in an incubator at 37°C with 5% CO2.
Statistical analysis
All data are expressed as the mean ± SEM. GraphPad Prism 6.0 software (San Diego, CA, USA) was used to calculate statistics. A Student’s t test was used, and p < 0.05 was considered significant.