Ovary collection from high- and low-yielding sows (Sus scrofa)
Litter size records (a total of 8,567 parities) at Hanshiwei Food Co., Ltd. (Dahua pig farm, Guangxi, China) from 2016 to 2018 were collected, sorted and analyzed. The low-yielding group was defined as less than 9.3 heads per litter, and the high-yielding group was defined as more than 14.7 heads per litter [16]. The ovarian tissues of three high- and low-yielding ‘Yorkshire’ × ‘Landrace’ sows having the same physiological status and similar body weights were collected.
Ovarian tissues and immunohistochemistry
Fresh ovarian tissues were removed, washed with normal saline, and fixed with paraformaldehyde, at greater than 7 to 10 times the volume of the ovaries, for 24 h at room temperature. They were then embedded in paraffin and sliced into sections for HE staining. The largest cross sections were selected for FGF21 (sc-81946,1/1000) immunohistochemical staining.
Granulosa cells isolation and culture
Fresh porcine ovaries(n=30) from cyclic sows were collected and immediately placed in a saline solution containing 100 IU/mL of double-antibody (cyano-streptomycin) at 37 °C. These ovaries were shipped back to the laboratory within 2 h and cleaned in a thermostatic saline solution. The antral follicles(3-6 mm diameters)located on the ovarian surface were punctured to collect follicular fluid. The cumulus-oocyte complex was removed using a 70-mm cell strainer to obtain GCs. GCs were resuspended in DMEM/F12 (Servicebio, Wuhan, China) containing 3% BSA, and then, they were inoculated into a cell culture well and cultured in a cell incubator with 5% CO2 at 37 °C [27].
Transfection of FGF21 siRNA and FGF21 recombinant protein treatment
To study the effects of FGF21 on proliferation and hormone synthesis in GCs, transfection experiments were performed at a cell density of 40% to 50%. All the transfection procedures were performed with X-treme-GENE siRNA Transfection Reagent (Roche) in accordance with the manufacturer’s instructions. In addition, GCs were treated with different FGF21 recombinant protein concentrations (0.1, 1 and 10 ng/mL). After transfection and recombinant protein exposure for 24 h, the culture supernatants and cells were collected for subsequent experiments.
Total RNA extraction, RNA reverse transcription and RT-qPCR
Total RNAs from different cells were extracted using Trizol (TaKaRa, Otsu, Japan), and the concentrations were measured using a NanoDrop 2000 (Thermo, Waltham, MA, USA). Total RNA (500 ng) was reverse transcribed to cDNA using a reverse transcription kit (TaKaRa). Quantitative real-time (RT) -qPCR was performed on a StepOne Real-Time PCR Machine (ABI, Carlsbad, CA, USA). The relative level of mRNA was standardized to β-actin and calculated using the 2-∆∆Ct method. Primer sequences used for RT-qPCR are listed in Table 1.
Table 1
RT-qPCR primer sequences used in the study (Sus scrofa).
Gene Name
|
Forward (5’-3’)
|
Reverse (5’-3’)
|
FGF21
|
CCTGAAGCCAGGGGTCATTC
|
CGATCCGTACAGTCTCCCGT
|
StAR
|
CGTTTAAGCTGTGTGCTGGG
|
TCCATGACCCTGAGGTTGGA
|
3β-HSD
|
TCTTGTCTGCTTCTCGCCAC
|
CAACTGAGACTTGGGTGCCA
|
CYP11A1
|
GGGCAACCCATTTCCTACCA
|
CGAGCACTGGTGGTACAGAC
|
CYP19A1
|
TCCGCAATGACTTGGGCTAC
|
GCCTTTTCGTCCAGTGGGAT
|
Cyclin B
|
AATCCCTTCTTGTGGTTA
|
CTTAGATGTGGCATACTTG
|
Cyclin D
|
TACACCGACAACTCCATCCG
|
GAGGGCGGGTTGGAAATGAA
|
Cyclin E
|
AGAAGGAAAGGGATGCGAAGG
|
CCAAGGCTGATTGCCACACT
|
p21
|
ACGTCTCAGGAGGACCATGT
|
AGAAGATCAGCCGGCGTTTG
|
β-actin
|
GGACTTCGAGCAGGAGATGG
|
AGGAAGGAGGGCTGGAAGAG
|
SR-BI
|
GCTGTTCATCCCCATCGTCT
|
GGCCTGAATGGCCTCCTTAT
|
SREBP2
|
CTCACCTTCCTGTGCCTCTC
|
CCAGAAGGTGACTGAGGAGC
|
Western blotting
The GCs were washed three times with PBS (pH=7.4), and then, 120 μL RIPA (Beyotime, Shanghai, China) supplemented with protease inhibitors (Pierce, Rockford, IL, USA) was added to each well of the 6-well plate. Afterward, samples were lysed on ice for 20 min, collected and centrifuged at 12,000 ×g for 10 min at 4°C. A BCA protein assay kit (Cwbio, Beijing, China) was used to determine protein concentrations. A 1/4 volume of 5× loading buffer (Cwbio, Beijing, China) was added to an aliquot of the supernatant, and a 20-μg protein sample was separated on a 10% SDS-polyacrylamide gel. After electrophoresis, the samples were transferred to the polyvinylidene fluoride (PVDF) membranes (CST, Boston, MA, USA), which were blocked with 5% skimmed milk powder for 2 h. The membranes were then incubated at 4°C overnight with primary antibodies (1:1000) against StAR, CYP11A1, CYP19A1, 3β-HSD, β-actin, SR-BI, SREBP2 and p21 (Abcam, Cambridge, UK), as well as against Cyclin B, Cyclin D, Cyclin E and FGF21(Santa Cruz, CA, USA). The membranes were placed in secondary antibody (Boster, Wuhan, China) solutions and incubated at 4°C for 2 h. Finally, the signals were detected using a gel imaging system (Bio-Rad, CA, USA), and the intensity levels of the bands were measured using Image J software. All the experiments were repeated at least three times and mean values were derived.
Measurement of estradiol and progesterone in the culture medium
The collected supernatant was centrifuged at 4°C for 10 min, and then, porcine estradiol and progesterone enzyme-linked immunoassays (ELISAs) were performed in accordance with the kit’s instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).
EdU imaging assay
GCs were seeded in 96-well plates at a concentration of per 2×103 concentration per well. After treating the cells with FGF21 siRNA (si-FGF21) and recombinant protein (rFGF21) for 24 h, they were incubated with 50 μM EdU (RiboBio, Guangzhou, China) for 2 h. The cells were washed twice with PBS, fixed in 4% paraformaldehyde for 30 min, neutralized with 2 mg/mL glycine for 5 min and permeabilized with 0.5% TritonX-100 for 10 min. Afterward, 100 μL of 1X Apollo® staining reaction solution was added to each well, and the plates were protected from light at room temperature while on a shaker for 30 min. The reaction solutions were discarded after staining. Then, 100 µL of penetrant (0.5% TritonX-100 in PBS) was added to each well, and the samples were washed twice on a shaker for 10 min each time.Then, the penetrant was discarded. Finally, 100 µL 1X Hoechst 33342 was added to each well to stain the nuclei. The stained cells were observed using a Nikon TE2000 microscope (Nikon, Tokyo, Japan) and the data were analyzed using Image J software.
Cell counting kit 8(CCK8) analysis
GCs were seeded in 96-well plates at a 2×103 concentration per well. After treating the cells with FGF21 siRNA and rFGF21 for 24 h, 10 µL CCK8 reagent was added to each well and incubated for 3 h at 37°C. Absorbance was measured at 450 nm using Vector 5 (Waltham, MA, USA).
Flow cytometry
GCs were seeded in 6-well plates at a 4×105 concentration per well. The cells were treated with si-FGF21 and rFGF21 for 24 h, and then, cells were digested with 0.25% trypsin and collected in 10 mL centrifuge tubes. The tubes were centrifuged at 1,200×g for 10 min, and the supernatants were discarded. The cells were resuspended in 70% cold ethanol and placed overnight at 4°C. The cells were washed twice and stained with 50 mg/mL propidium iodide (PI) for 30 min. Finally, the cell cycles of the porcine GCs were analyzed using flow cytometry (Becton Dickinson, Franklin Lakes, NJ, USA).
Statistical analysis
Each experiment was conducted at least three times and data for continuous variables are presented as mean values with standard errors of the mean (SEM). Statistical comparisons of mean values between groups were performed using t-test and multiple comparisons were performed using a one-way analysis of variance (ANOVA). Differences were considered to be statistically significant at a P-value was < 0.05.