Animals and treatments
Adopting virgin adult wild-type female mice weighing 35-45 g (confirm they are in estrus) were used for this study. Mice were conducted on a controlled temperature (20-25℃) and humidity (60-65%) environment with a 12 h light/dark cycle, and fed with basal diet and pure water.
The experimental mice were divided into four experimental groups to study RAF1 biological regulating functions induced by FSH. Treatment groups of FSH were given single dose of FSH(10 IU/mouse)and PBS was injected as control by intraperitoneal injection (IP). RAF inhibitor RAF709 were injected to the treatment groups at 30 mg/kg [39] and corn oil was injected for the controls as the followings: (i) FSH group (FSH + corn oil, n = 4), (ii) FSH-RAF709 group (FSH + RAF709, n = 4), (iii) Control group (PBS + corn oil, n = 4), (iv) RAF709 group (PBS + RAF709, n = 4).
Reagents and antibodies
All reagents and antibodies were commercially available. RAF709 (HY-100510, MCE);Anti-Raf1 (ab137435, Abcam); GAPDH (1:2000;Am4300,Ambion,,USA);CYP19A1 antibody (1;2000;BA3704, Boster); P-ERK antibody (1:1000; CST, MA, USA); Goat anti-Rabbit IgG (1:5,000, ZB-2301; Zhongshan, Beijing, China); ECL Western Blotting substrate (32209; Thermo Scientific, Waltham, MA); DMEM/F12 (D2906;Sigma);FBS(Gibco);streptomycin (Sigma), corn oil (Sigma).
Isolation and culture of primary ovarian granulosa cells
Normal bred mice were given IP injection of 5 IU PMSG for 48 hours and GCs were isolated and collected by follicle puncture as previous articles described [40] . The primary ovarian GCs were incubated in DMEM/F12 containing 10% fetal bovine serum. Culturing GCs in a 5% CO2 incubator with saturated humidity and a constant temperature of 37°C supplemented by100 U/mL penicillin and 100 mg/mL streptomycin. The released cells were collected and seeded in a 6-well plate at a density of 1 × 106 cells. The cell passaging was conducted after primary GCs confluence reached 60%~70% and the culture medium was changed every two days. Under starvation GCs were used medium without FBS following the removal of the culture medium, after starvation the cells were treated with FSH or RAF709.
We divided experiment into four groups according to the treatment methods, (i) a FSH group (FSH + DMSO, n = 3) untreated GCs in the presence of induced by FSH, (ii) a FSH-RAF709 group (FSH + RAF709, n = 3) GCs were pre-treated with inhibitor before induced by FSH, (iii) a control group (PBS + DMSO, n = 3) GCs plated in normal medium without FSH induction, (iv) a RAF709 group (PBS + RAF709, n = 3) GCs were pre-treated with inhibitor in normal medium without FSH induction.
RNA extraction and Real-time quantitative PCR (RT-qPCR) analysis
The ovary samples was dissected and extracted by liquid nitrogen grinding. Total RNA was extracted from the tissue and Trizol reagent (9109, TaKaRa Biotechnology, Dalian, China) can be directly used for GCs RNA extraction and method was provided by the manufacturer. After quantified by spectrophotometry, the purified total RNA (1 μg) was used as a template for cDNA synthesis. In the 0.5 ml centrifuge tube, add the sample RNA, supplement the appropriate amount of DEPC H2O to make the total volume up to 6 microliters, add 2 Oligo (dT) in the tube, and gently mix and centrifuge, 72 ℃ heating for 5 min and immediately insert the centrifuge tube into the ice bath for at least 5 min. Then add the mixture of the following reagents: MLV, dNTP, RNA safe (Promega),42 ℃ incubation an hour. Primers were designed as follows. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was assayed as an internal control. RT-qPCR was performed using a standard Takara SYBR Premix Ex Taq protocol on an Applied Biosystems 7500 Real-Time PCR system (Applied Biosystems). Each sample was assayed at least three times in duplicate. GAPDH expression levels were used for data normalization. The relative abundance of genes was determined using the ABI PRISM 7500 equipped software (Applied Biosystems). The relative product levels were quantified using the 2-△△Ct method. The primers for RT-qPCR analyses were as follows:
Raf-1.
Forward primer-GCTAATTGACATTGCCCGACA
Reverse primer- TTCAACCTGCTGAGAACCAC
Gapdh.
Forward primer- GGTTGTCTCCTGCGACTTCA
Reverse primer- GGGTGGTCCAGGGTTTCTTA
Western blotting (WB)
Ovaries were lysed with RIPA buffer (C1053, Applygen, Beijing, China) containing 1 mM phenylmethanesulfonyl fluoride (PMSF; 78830, Sigma). The protein concentration of each sample was quantitated by the BCA assay reagent (HX18651, Huaxingbio, Beijing, China). Equal amounts of proteins were prepared 30 ng and loading buffer size was calculated. Samples were electrophoresed on a SDS-PAGE, 5% stacking gel at 80V 30min and 12% separating gel at 120V 45min, polyvinylidene fluoride (PVDF) membrane (IPVH00010, Millipore, Billerica, MA, USA). The membrane was soaked in methanol and the target protein were transferred to a PVDF membrane 250 mA, 1.5 h, adjust the galvanometer to constant current (mA). Dissolving nonfat dried milk 5% (wt/vol) in Tris-buffered saline (TBS) and blocked the membranes for 2 h at RT, then incubated with RAF1 antibody (1:2,000; ab137435,Abcam), CYP19A1 antibody (1:1000; Cell Signaling Technologies), P-ERK antibody (1:1000; Cell Signaling Technologies), and internal control GAPDH (1:2,000,Ambion)overnight at 4°C. Washed the membrane by TBST (0.1% Tween-20 in TBS) every ten minutes and incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG (1:5,000, ZB-2301; Zhongshan) for 1 h at room temperature. After 30 min TBST washed, the membrane was treated by ECL Western Blotting substrate (32209; Thermo Scientific, Waltham, MA) at room temperature, from 30 sec to 20 min. to detect the signal of protein.
Immunohistochemistry
Using graded ethanol for ovaries tissue paraffin section dewaxing and soaked the section in 3% H2O2 (vol/vol) for 20 min to eliminate endogenous peroxidase activity. Then, microwaving samples in 0.01 M sodium citrate buffer on high power for 15 min and washed with PBS. Add 10% normal goat serum for 1 h at RT to eliminate background non-specific coloring. The sections were incubated with RAF1 antibody (1:150; HY-100510, Abcam) overnight at 4°C. Wash the slides with PBS for 3 times, and biotinylated goat anti-rabbit IgG (1:200; 11-065-14, Jackson) was incubated for 2 h at 37℃. HRP-conjugated streptavidin (1:200; 016-030-084, Jackson) was used for incubating at RT. The diaminobenzidine (DAB) was added for color rendering,the color development degree is controlled under the microscope, the appearance of brown staining was considered a positive reaction [41]
Immunofluorescence
When GCs grew on the glass slide and fuse to 95-100%, they are removed from the incubator and fixed in 4% paraformaldehyde for 25 min. The cells were washed with PBS for 10 minutes and permeabilized with 0.1% Triton X-100 (Sigma), and then blocked using 10% normal goat serum in TBS for 1 h at room temperature. The cells were incubated with RAF1 antibodies (1:200, diluted with 1% TBS) and put it in a wet box overnight at 4 °C. The slides of the cells were washed twice for 5 min each time by PBS, followed by incubation with the FITC-labeled goat anti-rabbit IgG (GAR-FITC, ZF-0311, Zhongshan) for 60 min. The nuclei were dyed with 4,6-diamidino-2-phenylindole (DAPI, 1:1,000, D8417; Sigma) for 15 min. Nonimmune rabbit IgG was used as a negative control. Washed the glass slide with PBS for three times to remove the excess DAPI. Drop the sealant on a clean slide and attach the cell surface of the slide to the sealant.
Radioimmunoassay (RIA)
In experiments in which RAF1 was inhibited, blood samples were collected and centrifuged and primary ovarian granulosa cells culture supernatant fluid was collected for E2 determination. The concentrations of E2 in media were measured using RIA reagents provided by the Beijing North Institute Biological Technology (Beijing, China).
Statistical analysis
All data were analyzed by GraphPad Prism 6 Software (GraphPad Software Inc., San Diego, CA, USA). Data were presented as means ± SEM. One-way analysis of variance (ANOVA) and Duncan’s tests were used to analyze the main effects of treatments. P < 0.05 was considered as significant differences between treatments group were exist.