Bioprospecting Studies of Actinomycete Bioactive Compound on Bla CTX-M -Extended -Spectrum Beta- Lactamase (ESBL) Producing Escherichia Coli and Klebsiella Species

DOI: https://doi.org/10.21203/rs.3.rs-774696/v1

Abstract

Forty one Extended Spectrum Beta Lactamase (ESBL) producing E. coli and Klebsiella species were analyzed for the presence of bla CTX-M genes by Uniplex Polymerase Chain Reaction (PCR) in which 15 isolates harbored bla CTX-M genes. Transconjugation studies were carried out to demonstrate the transfer of antibiotic resistance using E. coli K12J62-2 (F – rif r lac -) strain among which UTEC31 and UTK2 strains showed successful transconjugation. Sequence analysis revealed the presence of bla CTX-M-15 genes. Antibacterial activity of Streptomyces sp PUT23 was evaluated against CTX-M ESBL producing E. coli and Klebsiella sp. was determined. The ethyl acetate extract showed inhibitory activity and Reversed phase thin layer chromatography (RP-TLC) analysis revealed two fractions, EFI and EF2. Bioautogram of EF2 fraction demonstrated inhibitory activity with a minimum inhibitory concentration (MIC) value 156 μg/ml. The EF2 fraction was identified as a flavonoid upon chemical characterization. Sequencing of 16S rRNA gene and phylogenetic analysis of Streptomyces sp. strain PUT23 revealed its close relatedness to S. griseus. This study revealed the rapid spread and dominance of CTX-M producing E. coli and Klebsiella sp. in the suburban community of South Chennai, Tamil Nadu which has to be considered as a serious public health issue. There is an urgent need for newer and effective antimicrobials and bioactive compounds derived from Streptomyces species proved to be a promising and efficient resource. Further characterization and purification of EF2 fraction are needed and could be used in the formulation of new therapeutics against ESBL mediated infections.

Introduction

Infections caused by multidrug resistant bacterial pathogens are considered to be the important cause of morbidity and mortality [1]. Though antibacterial agents have been a major factor in treating bacterial infections, the phenomenon of microbial drug resistance has rendered most of the antibiotics useless, especially multidrug resistance among gram negative bacteria represents a unique and immediate threat [2].

The production of extended spectrum beta lactamases (ESBLs) is one of the vitriolic mechanisms of antimicrobial resistance (AMR). Reports on ESBL producing uropathogenic bacteria as a leading cause of morbidity and mortality are of major concern. Moreover, their ability to disseminate into the community is an emerging public health problem globally [3].

Broad spectrum antibiotics are frequently given to treat UTIs in place of a narrow spectrum antibiotic which may be adequate. Recent reports suggest that the global antibiotic consumption from the year 2000 to 2015 had increased by 65% while a 39% increase was reported on the rate of antibiotic consumption for defined daily doses (DDDs) per 1000 people [4].

The reasons for global antibiotic resistance are complex and multifactorial. They may be attributed to the indiscriminate and irresponsible use of antibiotics, mutations in bacteria, acquisition of resistance genes, overuse and misuse of antibiotics, selection pressure sustaining resistant bacteria and competition among physicians prescribing antibiotics unnecessarily to retain patients, lack of awareness among people all contribute to this global problem [5]. Metagenomic analysis has revealed the widespread prevalence of genes encoding antibiotic resistance in the environment [6].

The AWaRe classification of antibiotics [7] was introduced by the WHO as a tool for antibiotic stewardship with the aim of reducing AMR and ESBL producing pathogens are included in the Priority 1 - Critical group list [8] for which the WHO cautions appropriate use of existing antibiotics and also emphasizes the need of new antimicrobials.

Actinobacteria are widely exploited for their bioactive compounds and are excellent resources for the control of ESBL producing pathogens [9]. These groups of filamentous gram positive bacteria are recognized for their pivotal role and genetic capability in the production of useful secondary metabolites like antibiotics, antitumors etc. [10].

Among many actinobacterial genera, Streptomyces species are renowned and eulogized for their production of diverse array of antibiotics. These accounts for over two thirds of the clinically used natural antibiotics produced by Streptomyces alone and about 75% of the marketable and therapeutically useful antibiotics are derived from this genus [11]. The ability of the bioactive compounds of actinomycetes in controlling multi drug resistant pathogens is well known [12]. The problem of antimicrobial resistance (AMR) is increasing while the production of newer antibiotics is slow [13]. Hence newer potential antibiotics are needed, to curb the problem of multidrug resistance, especially from natural habitats rather than their synthetic counterparts.

This study was instigated to determine the prevalence of bla CTX−M ESBL producing E. coli and Klebsiella species in the southern semi urban regions of Chennai. This study also reported the antibacterial properties of Streptomyces sp. against the ESBL producing organisms.

Methods

Identification of bla CTX-M mediated ESBL production in E. coli and Klebsiella species by uniplex polymerase chain reaction (PCR)

In this study, 41 ESBL producing bacterial cultures [14] including 27 E. coli and 14 Klebsiella species were used for the determination of bla CTX-M genes. Plasmid DNA was isolated from the strains following the alkaline lysis method [15]. PCR amplification of bla CTX-M alleles was carried out for all ESBL positive bacterial cultures using the set of universal primers CTX-M-F-5’-ATG TGC AGY ACC AGT AAR GT - 3’ and CTX-M-R-5’-TGG GTR AAR TAR GTS ACC AGA - 3’ [16]. The strain E. coli MTCC 443 was used as negative control. The Y, R, S represent the standard nucleotide combinations where Y is C or T, R is A or G and S is C or G. This primer combination is designed to accommodate sequence variation in CTX-M type enzymes.

Demonstration of horizontal transfer of antibiotic resistant genes by transconjugation          

The isolates of E. coli and Klebsiella species that harbored bla CTX-M genes were analyzed for capability of gene transfer in the recipient strain E. coli K12 J62-2 (F - rif r lac -). Mating experiment was carried out where the isolates and the recipient were grown in Brain Heart Infusion broth for overnight and were mixed in the ratio of 1:10 to match McFarland turbidity 0.5 [17]. They were then incubated at 37°C overnight and selected on MacConkey agar supplemented with rifampicin (2.5 mg/ml) and cefotaxime (2 μg/ml). The transconjugants were subjected to antibiotic sensitivity testing against ceftazidime disc and plasmid profile analysis.

Sequencing of bla CTX-M plasmid DNA   

The ESBL positive E. coli and Klebsiella species that demonstrated transferrable resistance were subjected to DNA sequence analysis (Beckman Coulter CEQ 8000 auto analyzer). Molecular characterization of the ESBL coding gene bla CTXM-15 using the same set of primers mentioned above was analyzed from the selected strains UTEC31 and UTK2 [18].   

The sequenced nucleotide was subjected to NCBI BLAST (Basic Local Alignment Search Tool) analysis (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The nucleotide BLAST was run using megablast (high similar sequence) mode with maximum target of 50 for confirmation of the sequence. After confirming the sequence, the sequences were submitted to GenBank/NCBI to obtain the accession number through “Sequin” submission tool. Further, the Open Reading Frame (ORF) of the sequences was predicted. The ORF and the initiation codon was predicted using tool, ORF finder (https://www.ncbi.nlm.nih.gov/projects/gorf/), open reading frame finding online tool. The amino acid sequence of ESBL gene was obtained from bla CTX-M-15 gene sequence by translation of nucleotide sequence using ExPASy translation tool (https://web.expasy.org/translate/).

Phylogenetic analysis of bla CTX-M-15 gene of E. coli UTEC31 and Klebsiella sp. UTK2 strains with other related strains was carried out to predict the evolutionary relationship with similar sequences. Dendrogram was constructed with MEGA 4.0 using neighborhood joining method from 500 resamplings [19]. 

In vitro testing of Streptomyces extract against ESBL pathogens 

Description of actinobacterial strain

The actinobacterial strain PUT23, previously isolated from agricultural soil sample was obtained from the Actinobacterial Research Laboratory, Department of Microbiology, Periyar University, Salem, Tamil Nadu. Viability of the strain PUT23 was maintained on yeast extract malt extract (YEME) agar slants at 4oC as well as in 20% glycerol broth at -80oC. 

Molecular analysis and taxonomy of the potential Streptomyces sp. PUT23 

Genomic DNA was extracted from Streptomyces sp. PUT23 grown on YEME agar medium using the standard protocol [20]. The 16S rRNA gene of the strain PUT23 was amplified by PCR [21] using the following primers, 27f (5’-AGTTTGATCCTGGCTCAG-3’) and 1492r (5’- ACGGCTACCTTGTTACGACTT -3’) as forward and reverse primers, respectively.

The thermal cycling conditions included an initial denaturation of the target DNA at 94°C for 4 minutes followed by 30 cycles at 94°C for 1 minute, primer annealing at 52°C for one minute, primer extension at 72°C for one minute. The reaction mixture was then held at 72°C for 10 minutes and cooled to 4°C. The amplified product was detected by 1% agarose gel electrophoresis and was visualized by Gel Documentation System.           

Sanger’s Dideoxy Chain Terminator Sequencing was performed using DTCS Quick Start Dye Terminator Kit (Beckman Coulter) and Beckman Coulter CEQ 8000 auto analyzer. The cycle sequencing was carried out using the same primers used in PCR amplification. Sequence alignment was done using Clustal-X2 Version 2.1 and phylogenetic tree was constructed using MEGA Version 5.0 [19] and BLAST analysis of the strain was carried out to determine the evolutionary relationship of the strain with closely related strains derived from the NCBI database. The deduced 16S rRNA sequence of the strain PUT23 was submitted to GenBank/NCBI to get the accession number.

Production and extraction of the bioactive compounds

Extraction of the bioactive compound from the PUT23 strain was done through fermentation following the method from a previous study [22] with modifications. Briefly, pure cultures of actively growing Streptomyces sp. was inoculated into 100 ml of YEME broth and incubated at 30°C for 3 days. About 2% of the YMD broth culture was again inoculated in about 1 L of International Streptomyces Project 4 (ISP4) broth and incubated at 30°C for 5 days. After fermentation at 30°C for 5 days, the cell free supernatant was collected by filtration. Extraction of the crude compound from the culture filtrate was carried out by liquid-liquid extraction method with equal volumes of ethyl acetate (1:1 v/v) by vigorous shaking for 1 hour and concentrated by evaporation. The crude extract was then tested for anti-ESBL activity. 

Determination of antibacterial activity

The antibacterial activity of the ethyl acetate extract against the ESBL producing E. coli and Klebsiella species was determined by agar well diffusion method [23] with ethyl acetate (50 mg/ml) and ciprofloxacin (5 μg/ml) as controls. The plates were examined for the zones of inhibition and results were compared and graded by measuring the zone diameter. E.coli ATCC 25922 and Klebsiella pneumoniae ATCC 700603 were used as controls. Antimicrobial efficacy was graded based on the zone diameter as high activity (≥15 mm), moderate activity (10-14 mm), trace activity (5-9 mm) and no activity (≤ 4 mm) [24]. 

Purification of the bioactive compound by reversed phase thin layer chromatography (RP-TLC) 

Partial purification and characterization of the ethyl acetate extract of Streptomyces PUT23 was attempted by RP-TLC also known as Double Ascending TLC [25] using readymade silica gel coated TLC sheets (7.5 x 2.5 cm) (Silica Gel 60 F 254nm) using the mobile phase n-hexane: ethyl acetate: acetic acid in the ratio 7:2.5:0.5. The solvent ascent was fixed to 5.8 cm for calculating Rf values. The chamber saturation time for the mobile phase was 15 min at room temperature (22 ± 1°C). Double ascending TLC was performed and the plates were dried at room temperature. The spots were detected in the presence of iodine vapor. The Retardation Factor (Rf) value was calculated with values of the Rl (Rf of the Leading Front) and Rt (Rf of the Trailing Front) using the relation Rf = 0.5 (Rl + Rt).

Bioautography of purified ethyl acetate extract 

The anti-ESBL activity of the separated ethyl acetate fractions namely EF1 and EF2 in RP-TLC method was analyzed by contact or direct bioautography [26] by placing the chromatogram face down onto Mueller-Hinton agar seeded with bla CTX-M producing E. coli and Klebsiella species and incubated at 37°C for 18-24 hours. The zones of inhibition on the agar surface, corresponding to the spots in chromatographic plates were indicative of the bioactive fraction.

The active fraction which showed inhibitory activity in the bioautography was further purified by preparative TLC by scrapping the fraction with silica gel in analytical TLC and repeated extraction with methanol. The purified bioactive compound present in the methanol portion was collected by centrifugation at 10,000 rpm for 10 minutes and filtration. The obtained filtrate was concentrated at 45°C using eppendorf concentrator.

Determination of MIC of the bioactive fraction against bla CTX-M producing ESBL E. coli and Klebsiella species

The minimum inhibitory concentration (MIC) was determined for the bioactive compound using the dilutions at 5, 2.5, 1.25, 0.625, 0.312 and 0.156 mg/ml prepared in DMSO [24]. About 50 μl of the bioactive compound from each dilution with ciprofloxacin (8 µg/ml) as control were loaded in wells of Mueller-Hinton agar plates seeded with a lawn culture of bla CTX-M positive bacteria. Solvent controls of 1% DMSO and 1% ethyl acetate were also included to exclude the possibility of their antagonistic activity. MIC was determined after incubating the plates at 37°C for 18-24 hours by observing for the zones of inhibition. 

Preliminary characterization of active compound

Appearance and solubility analysis 

Colour and consistency of the bioactive fraction was determined by visual inspection. Solubility of the compound was tested by dissolving 1 mg of purified compound in the solution containing water, 2.5 M Sodium hydroxide (NaOH), 0.6 M Sodium bicarbonate (NaHCO3), 1.5 M Hydrochloric acid (HCl) and concentrated sulphuric acid (H2SO4) to resolve the functional groups present in the partially purified bioactive compound [27].

Solubility of the same was determined by dissolving 1 mg of purified compound in 10 ml of solvents such as water, methanol, acetone, chloroform, dichloromethane, diethyl ether, ethyl acetate, n-hexane, dimethyl sulfoxide.

Chemical screening of the bioactive fraction

To determine the chemical group to which the purified pigment belongs, the following qualitative biochemical reactions were performed [28]. About 10 mg/ml stock solution of the bioactive fraction was prepared using methanol for the analysis. Tests were performed to detect the presence of terpenoids, diterpenes, alkaloids, carotenoids, flavonoids, antroquinones and glycosides. 

Results And Discussion

Isolation of plasmid DNA from ESBL positive E. coli and Klebsiella species     

Plasmid profile analysis of ESBL positive isolates revealed the presence of plasmids in all 27 E. coli and 14 Klebsiella sp. and few isolates harbored multiple plasmids ranging from 2 to 5 numbers. This finding is in full accordance with earlier studies reporting multiple plasmids among ESBL producing bacteria. [29], [30]. Among E. coli isolates, strains UTEC22, -24, -45, -48 harbored 5 plasmids ranging between 6000 bp and >1 kb and UTEC4, -5 ,-29, -31, -40, -53, -57 demonstrated 4 plasmids from 3000 bp to >1 kb. Eight isolates showed three plasmids and three isolates harbored two plasmids while the remaining isolates showed single plasmid.  

Plasmid profile of Klebsiella species demonstrated the presence of 4 plasmids among five isolates namely UTK12, -21, -22, -36, -38 and three plasmids among the isolates UTK1, -2, -15, -20, and -30. Three isolates namely UTK3, -16, -29 harbored two plasmids while UTK33 showed a single plasmid. The plasmids were in the range between 4000 bp and >1 kb (Table 1 and Fig. 1).  

Identification of bla CTX-M mediated ESBL production in E. coli and Klebsiella species by uniplex polymerase chain reaction (PCR)

The CTX-M genotypes have gained clinical and epidemiological importance in the context of their ability to disseminate and causing outbreaks [31]. In India, the bla CTX-M-15 genotype is reported to be found exclusively [32].  Hence the bla CTX-M gene mediated ESBL production among the isolates was determined by using uniplex PCR. The overall prevalence of bla CTX-M genes in the isolates was 36.58% where 9 out of 27 E. coli (33.33%) and 6 out of 14 Klebsiella sp. (42.85%) carried the bla CTX-M genes. The size of the amplicons ranged between 500-600 bp (Fig. 2). 

The present study had identified 42.85% prevalence of CTX-M ESBLs and is in full accordance with previous report [33]. An earlier Chennai-based study [34] revealed CTX-M type ESBLs to be prevalent in 75% of the isolates followed by TEM enzymes (73%) and SHV ESBLs (42%), while another recent study reported 88% prevalence rate in Chennai [35]. 

This variation could be related to the shortening of the boundaries between hospitals and the community, accelerated transfer of the antibiotic resistant genes by efficient mobile elements, clonal expansion of the isolates and selective advantage for survival of the resistant isolates ideal for dissemination [32], [36].  

Demonstration of horizontal transfer of antibiotic resistant genes by transconjugation

In the transconjugation analysis, 2 out of 15 donor strains (13.33%), namely, UTEC31 and UTK2 showed successful transconjugation in the recipient strain of E. coli K12J62-2 (F - rif r lac -). The recipient demonstrated acquired antibiotic resistance against ceftazidime and the acquisition of plasmids (Fig. 3). The rate of transferability was lower in this study when compared to other reports [37], [38]. 

It is well known that conjugative plasmids are major tools for intra- and inter- species and also inter-generic gene transfers. ESBLs encoded on plasmids isolated from clinically resistant uropathogenic bacteria are constitutively expressed. This is an important observation because plasmid mediated ESBLs possibly inhabit environments in which antibiotics are found in high concentrations [39]. It was proposed that only compatible plasmids could be rescued in transconjugation [40]. However, bla CTX-M genes are reported to be linked to plasmids of incompatibility groups which include IncF, IncN, IncN2, IncI1, IncHI2, IncL/M, IncA/C, IncK, IncX4, IncU and RCR [32]. 

Determination of transferable resistance in this study emulates the dissemination of resistant genes in the environment and will be of clinical and epidemiological significance for two reasons. Firstly, the isolates belonged to community settings and hence possess the vitriolic potential to disseminate within community. Secondly, they are problematic because of conferring resistance to various antibiotics providing a survival advantage under pressure of exposure to various antibiotics. This makes the treatment options not only limited but also difficult.

Sequencing of bla CTX-M plasmid DNA of ESBL positive E. coli and Klebsiella species Molecular characterization of ESBL coding gene

The two isolates UTEC31 and UTK2 which showed successful transconjugation were subjected to sequencing of bla CTX-M gene. Strains UTEC31 and UTK2 showed the amplified DNA product of bla CTX-M-15 genes of 500 and 600 bp. 

Sequencing of plasmid DNA revealed the nucleotide results averaging 543 nucleotides for E. coli UTEC31 (GenBank Accession No. KJ746672). For Klebsiella sp. UTK2, it was about 568 nucleotides (GenBank Accession No. KJ746673). The BLAST results revealed that the bla CTX-M-15 sequence obtained from E. coli demonstrated 100% identity with bla CTX-M-15 partial sequence of E. coli (Genbank accession KF723004, KF723003 etc.) and the bla CTX-M-15 sequence obtained from Klebsiella sp. paired 100% with bla CTX-M-15 partial sequence of Klebsiella species (Genbank accession JQ686199, JQ686198 etc.)  under 100% query coverage. 

The ORF finder online tool predicted different open reading frames but the vast size reading frame was considered as beta-lactamase ORF. The ORF consisted of 543 base pairs corresponding to 179 amino acids in E. coli and 568 base pairs in size coding for 156 amino acids in Klebsiella sp. In both the cases AUG was the initiation codon for methionine. Since there was no termination codon in this frame for both sequences, the sequence might be a partial sequence of bla CTX-M-15 gene. In order to find out the amino acid sequences, the ORF sequences were subjected to amino acid translation through ExPAsy online tool. The number of amino acid sequences consisted with the results of ORF finding results. 

CTX-M-15 is included under the CTX-M-3 cluster based on its amino acid identity and phylogeny. It differs from other members of CTX-M-3 groups by a single amino acid substitution, D240G, where aspartic acid is substituted with glycine at
 position 240 [41]. This mutation in the gene is responsible for its increased hydrolytic activity against antibiotics such as ceftazidime by the isolates [42].  

Phylogenetic analysis of bla CTX-M-15 gene of E. coli strain UTEC31 using neighborhood joining method with a boot strap value of 500 showed similarity with bla CTX-M-15 genes of Escherichia coli ESBL370B15, Escherichia coli ESBL490B15, Escherichia coli ESBL360 strains. Additionally, this gene also showed similarity with bla CTX-M-15 genes of Escherichia coli strain C21, E. coli  E5, E. coli  E12, E. coli  E11 strains. Similarly, phylogenetic analysis of bla CTX-M-15 of Klebsiella sp. UTK2 based on the neighborhood joining method with a boot strap value of 500 revealed that the sequence showed similarity with bla CTX-M-15 gene of K. pneumoniae KP34C. Additionally this gene of Klebsiella sp. UTK2 also showed similarity with bla CTX-M-15 genes of K. neumoniae ST15, K. pneumoniae KP9, K. pneumoniae L4, K. pneumoniae 639 and K. pneumoniae 51  (Fig. 4 and Fig. 5).

Molecular analysis and taxonomy of the potential Streptomyces sp. PUT23 strain 

The amplicon size of the 16S rRNA gene of Streptomyces sp. strain PUT23 was around 1000 base pairs and BLAST analysis showed 100% identity to 16S rRNA sequences of Streptomyces griseus strains confirming the strain PUT23 to belong to the genus Streptomyces. The sequence was submitted to GenBank with accession number KU356755. Based on the 16S rRNA sequence, the BLAST analysis further revealed the phylogenetic relatedness of the test strain PUT23 to its closely related strains of Streptomyces species obtained from the NCBI database (Fig. 6). 

Determination of antibacterial activity of the bioactive compound by agar well diffusion method

Approximately, 1.94 g of crude extract was obtained in solvent extraction with ethyl acetate. Testing for anti-ESBL activity of the extract showed an inhibition zone between 13 - 17 mm (Table 2) and the result is consistent with other studies [11], [21]. 

Purification of the bioactive compound by reversed phase thin layer chromatography (RP-TLC) 

The RP-TLC analysis of the ethyl acetate extract resulted in the separation of 2 fractions, namely EF1 and EF2 (Rf values - 0.58 and 0.73, respectively). Double ascending TLC or Reversed Phase TLC offers added advantage in organizing hydrocarbon ligands on the silica surfaces, interaction of solvent into the bonded layers and aid in separation of pharmaceuticals like surface active pharmaceutical molecules [25].

Bioautography of purified ethyl acetate extract    

In bioautography, the second fraction, EF2, (Rf value - 0.73) showed activity against the bla CTX-M positive uropathogens tested (Fig. 7). Fraction EF1 did not show any activity against the test organisms. This technique is simple, easy to perform, inexpensive and is a useful means for the screening of compounds from natural source using developed TLC. Prediction of results is made easy indicated by the development of zones of inhibition on the agar surface near the spots in the chromatogram relative to the bioactive fractions [43]. In the preparative TLC, 1 gm of ethyl acetate extract yielded 62 mg of fraction EF2.

Determination of MIC of the bioactive fraction against bla CTX-M ESBL uropathogens.

The MIC of the ethyl acetate extract of bioactive component was found to be 156 µg/ml against bla CTX-M-15 producing E. coli and Klebsiella sp. which was found to increase with increasing concentrations (Fig. 8). Thus a concentration <156 μg/ml may also be inhibitory to ESBL producing pathogens. This is higher than the findings of a previous study reporting the MIC to be as low as 25 μg/ml against K. pneumoniae [44]. 

Determination of the functional group of bioactive fraction by chemical screening

The bioactive compound EF2 was brown powdery and was insoluble in water, 2.5 M NaOH and 0.6 M NaHCO3 but soluble in 1.5 M HCl and concentrated sulphuric acid. The original brown colour of the compound changed to red colour upon the addition of 1.5 M HCl and concentrated sulphuric acid. This indicated that the compound EF2 might contain amine, ester, alkene and/or alcohol as functional groups. It was soluble in methanol, DMSO, less soluble in n-hexane and insoluble in water.  

Chemical screening of bioactive fraction

In the various screening tests performed for the detection of chemical group, compound EF2 was found to belong to flavonoid class (Table 3). Some of the classes of flavonoids that possess antimicrobial activity include Flavones, Isoflavones, Flavonols and their glycosides, Flavan-3-ols, Flavanones, Flavans etc., [45]. The anti-ESBL activity of the ethyl acetate extract is ascribed to the presence of flavonoids as evident in the bioautography and this finding is supported by other reports [46], [47].

The inhibitory activity of the extract could be attributed to the presence of flavonoid group which has ability to complex with bacterial cell wall, extracellular and soluble proteins and probably causing membrane disruption [48]. Flavonoids conjugated with nanoparticles have been proved to be a promising alternative for antibiotics [49].

Reports on ESBL prevalence from southern suburban regions of Chennai are scarce. This study revealed the rapid emergence and dominance of CTX-M producing E. coli and Klebsiella sp. in the suburban community of South Chennai, Tamil Nadu which has to be considered as a serious public health issue. Hence the findings in this work are important due to the fact that more residential area and industrial set-ups are being laid in the region. The study had also highlighted the inhibitory activity of the flavonoid produced by Streptomyces PUT23 strain against ESBL pathogens and its potential to be developed into antimicrobial agent, especially in the biocontrol of multidrug resistant bacteria. To put in the words of Baltz, (2008) [50], we are in the early stages of a renaissance in the antibiotic discovery from actinomycetes.   

Declarations

Ethical Approval: Ref: VISTAS-SPS/IEC/III/2018/09

Consent to Participate: Not Applicable

Consent to Publish: All authors have consented to publish this work.

Authors Contributions: GG, KK and RB contributed equally in designing the study. GG carried out the experiments. KK contributed in data analysis and manuscript preparation. RB supervised the entire study and contributed in manuscript preparation. 

Funding: Not applicable. There was no funding received for this work.

Competing Interest: The authors declare that they have no competing interest.

Availability of data and materials: Available.

References

  1. Colomb-Cotinat, M., Lacoste, J., Brun-Buisson, C., Jarlier, V., Coignard, B. and Vaux, S. (2016). Estimating the morbidity and mortality associated with infections due to multidrug-resistant bacteria (MDRB), France, 2012. Antimicrob. Resist. Infect. Control. 5, 56.https://doi.org/10.1186/s13756-016-0154-z
  2. Lautenbach, E. and Perencevich, E.N. (2014). Addressing the emergence and impact of multidrug-resistant gram-negative organisms: A critical focus for the next decade. Infect. Cont. Hosp. Epidemiol. 35, 333-335. https://doi.org/10.1086/675592
  3. Hassuna, N.A., Khairalla, A.S., Farahat, E.M., Hammad, A.M. and Abdel-Fattah, M. (2020). Molecular characterization of extended-spectrum β-lactamase-producing E. coli recovered from community-acquired urinary tract infections in Upper Egypt. Scientific Reports. 10, 2772. https://doi.org/10.1038/s41598-020-59772-z
  4. Sriram, A., Kalanxhi, E., Kapoor, G., Craig, J., Balasubramaniam, R., Brar, S., Criscuolo, N., Hamilton, A., Klein, E., Tseng, K., Boeckel, T.V. and Laxminarayan, R. (2021). State of the world’s antibiotics 2021: A global analysis of antimicrobial resistance and its drivers. Center for Disease Dynamics, Economics and Policy, Washington DC. Available from https://cddep.org/blog/posts/the-state-of-the-worlds-antibiotics-report-in-2021/ Accessed August 14, 2021.
  5. Laxminarayan, R., Duse, A., Wattal, C., Zaidi, A.K.M., Wertheim, H.F.L., Sumpradit, N., Vlieghe, E., Hara, G.L., Gould, I.M., Goossens, H., Greko, C., So, A.D., Bigdeli, M., Tomson, G., Woodhouse, W., Ombaka, E., Peralta, A.Q., Qamar, F.N., Mir, F., Kariuki, S., Bhutta, Z.A., Coates, A., Bergstrom, R., Wright, G.D., Brown, E.D. and Cars, O. (2013). Antibiotic resistance-the need for global solutions. Lancet Infect. Dis. 13, 1057-1098. https://doi.org/10.1016/s1473-3099(13)70318-9
  6. Martinez, J.L, Coque, T.M. and Baquero, F. (2015). What is a resistance gene? Ranking risk in resistomes. Nat. Rev. Microbiol. 13, 116-123. https://doi.org/10.1038/nrmicro3399
  7. WHO 2019. WHO AWaRe classification database of antibiotics for evaluation and monitoring of use. Available from: https://www.who.int/publications/i/item/WHOEMPIAU2019.11. Accessed August 1, 2021.
  8. WHO 2017. WHO publishes list of bacteria for which new antibiotics are urgently needed. Available from: https://www.who.int/news/item/27-02-2017-who-publishes-list-of-bacteria- for-which-new-antibiotics-are-urgently-needed. Accessed August 1, 2021.
  9. Aruna, S., Ramya, S. and Balaguruathan, R. (2013). Prevalence of ESBL pathogens in Salem hospitals and its control. Adv. Appl. Sci. Res. 4, 277-284.
  10. Pazhanimurugan, R., Radhakrishnan, M., Shanmugasundaram, T., Gopikrishnan, V. and Balagurunathan, R. (2016). Terpenoid bioactive compound from Streptomyces rochei (M32): taxonomy, fermentation and biological activities. World J. Microbiol. Biotechnol. 32, 161. https://doi.org/10.1007/s11274-016-2121-5
  11. Khadayat, K., Sherpa, D.D., Malla, K.P., Shrestha, S., Rana, N., Marasini, B.P., Khanal, S., Rayamajhee, B., Bhattarai, B.R. and Parajuli, N. (2020). Molecular identification and antimicrobial potential of Streptomyces species from Nepalese soil. Int. J. Microbiol. Article ID 8817467. https://doi.org/10.1155/2020/8817467
  12. De Simeis, D. and Serra, S. (2021). Actinomycests: A never-ending source of bioactive compounds - an overview on antibiotics production. Antibiotics. 10, 483. https://doi.org/10.3390/antibiotics10050483
  13. Jagannathan, S.V., Manemann, E.M., Rowe, S.E., Callender, M.C. and Soto, W. (2021). Marine Actinomycetes, new sources of biotechnological products. Mar. Drugs. 19, 365. https://doi.org/10.3390/md19070365
  14. Gururajan, G., Kaliyaperumal, A.K. and Ramasamy, B. (2011). Prevalence of extended spectrum beta lactamases in uropathogenic Escherichia coli and Klebsiella species in a Chennai suburban tertiary care hospital and its antibiogram pattern. Res. J. Microbiol. 6, 796- 804. https://dx.doi.org/10.3923/jm.2011.796.804
  15. Joseph, S. and David, W.R. (2001) Molecular Cloning: a laboratory manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  16. Shahid, M., Singh, A., Sobia, F., Rashid, M., Malik, A., Shukla, I. and Khan, H.M. (2011). bla CTX-M, blaTEM and blaSHV in Enterobacteriaceae from North-Indian tertiary hospital: high occurrence of combination genes. Asian Pacific J. Trop. Med. 4, 101-105. https://doi.org/10.1016/s1995-7645(11)60046-1
  17. Subha, A., Devi, V.R. and Ananthan, S. (2003). AmpC β-lactamase producing multidrug resistant strains of Klebsiella spp. and Escherichia coli isolated from children under five in Chennai. Indian J. Med. Res. 117, 13-18.
  18. Sanger, F., Nicklen, S. and Coulson, R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA. 74, 5463-5467. https://doi.org/10.1073/pnas.74.12.5463
  19. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S. (2011). MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance and maximum parsimony methods. Mol. Biol. Evol. 28, 2731-2739. https://doi.org/10.1093/molbev/msr121
  20. Mehling, A., Wehmeier, U.F. and Piepersberg, W. (1995). Nucleotide sequences of streptomycete 16S ribosomal DNA: towards a specific identification system for streptomycetes using PCR. Microbiology. 141, 2139-2147. https://doi.org/10.1099/13500872-141-9-2139
  21. Balachandran, C., Duraipandiyan, V., Arun, Y., Sangeetha, B., Emi, N., Al-Dhabi, NA., Ignacimuthu, S., Inaguma, Y., Okamoto, A. and Perumal, P.T. (2016). Isolation and characterization of 2-hydroxy-9.10-anthraquinone from Streptomyces olivochromogenes (ERINLG-261) with antimicrobial and antiproliferative properties. Brazilian J. Pharmacog. 26, 285-295. http://dx.doi.org/10.1016/j.bjp.2015.12.003
  22. Ahmad, M.S., El-Gendy, A.O., Ahmed, R.R., Hassan, H.M., El-Kabbany, H.M. and Merdash, A.G. (2017). Exploring the antimicrobial and antitumor potentials of Streptomyces sp. AGM12-1 isolated from Egyptian soil. Front. Microbiol. 8, 438. https://doi.org/10.3389/fmicb.2017.00438
  23. Nathan, P., Law, E.J., Murphy, D.F. and MacMillan, B.G. (1978). A laboratory method for the selection of topical antimicrobial agents to treat infected burn wounds. Burns. 4, 177-178. https://doi.org/10.1016/S0305-4179(78)80006-0
  24. Girija, S.A.S., Priyadharshini, V.J., Suba, P.K., Hariprasad, P. and Raguraman, R. (2012). Antibacterial effect of squid ink on ESBL producing strains of Escherichia coli and Klebsiella pneumoniae. Indian J. Geo-Mar. Sci. 41, 338-343. http://nopr.niscair.res.in/handle/123456789/14554
  25. Mohammad, A., Sharma, S. and Bhawani, S.A. (2009). Reversed Phase Thin Layer Chromatography of five co-administered drugs with surfactant modified solvent systems. Indian J. Chem. Tech. 16, 344-350. http://nopr.niscair.res.in/handle/123456789/5916
  26. Rahalison, L., Hamburger, M., Monod, M., Frenk, E. and Hostettmann, K. (1994). Antifungal tests in phytochemical investigations: comparison of bioautographic methods using phytopathogenic and human pathogenic fungi. Planta Med. 60, 41-44. https://doi.org/10.1055/s-2006-959405
  27. Mohrig, J.R. Hammond, C.N. Schatz, P.F. and Marrill, T.C. (2003). Techniques in Organic Chemistry, W. H. Freeman and Company.
  28. Harborne, J.B. (1998). Phytochemical methods: A guide to modern techniques of plant analysis. Chapman and Hall, Ltd.
  29. Hassan, W.M., Hashim, A. and Domany, R.A.A. (2012). Plasmid mediated quinolone resistance determinants qnr, aac(6’)-Ib-cr and qep in ESBL-producing Escherichia coli clinical isolates from Egypt. Indian J. Med. Microbiol. 30, 442-447. https://doi.org/10.4103/0255-0857.103766
  30. Mahmud, Z.H., Kabir, M.H., Ali, S., Moniruzzaman, M., Imran, K.M., Nafiz, T.N., Islam, M.S., Hussain, A., Hakim, S.A.I., Worth, M., Ahmed, D., Johnston, D. and Ahmed, N. (2020). Extended –spectrum beta-lactamase-producing Escherichia coli in drinking water samples from a forcible displaced, densely populated community setting in Bangladesh. Front. Public Health. 8, 228. https://doi.org/10.3389/fpubh.2020.00228
  31. Dhillon, R.H-P. and Clark, J. (2012). ESBLs: A clear and present danger? Crit. Care Res. Pract. 625170. https://doi.org/10.1155/2012/625170
  32. Brolund, A. (2014). Overview of ESBL-producing Enterobacteriaceae from a Nordic perspective. Infect. Ecol. Epidemiol. 4, 24555. https://dx.doi.org/10.3402%2Fiee.v4.24555
  33. Priyadharsini, R.I., Kavitha, A., Rajan, R., Mathavi, S. and Rajesh, K.R. (2011). Prevalence of blaCTX-M extended spectrum beta lactamase gene in enterobacteriaceae from critical care patients. J. Lab. Physicians. 3, 80-83. https://doi.org/10.4103/0974-2727.86838
  34. Kamatchi, C., Magesh, H., Sekhar, U. and Vaidyanathan, R. (2009). Identification of clonal clusters of Klebsiella pneumoniae isolates from Chennai by extended spectrum beta lactamase genotyping and antibiotic resistance phenotyping analysis. Am. J. Infect. Dis. 5, 74-82. https://doi.org/10.3844/ajidsp.2009.74.82
  35. Rohit, A., Deekshit, V.K., Balaraj, M., Alandur, V.S., Abraham, G., Karunasagar, I. and Karunasagar, I. (2019). CTX-M type extended-spectrum β-lactamase in Escherichia coli isolated from extra-intestinal infections in a tertiary care hospital in south India. Indian J. Med. Res. 149, 281-284. https://doi.org/10.4103/ijmr.ijmr_2099_17
  36. Shaikh, S., Fatima, J., Shakil, S., Rizvi, S.M.D. and Kamal, M.A. (2015). Antibiotic resistance and extended spectrum beta-lactamases: Types, epidemiology and treatment. Saudi J. Biol. Sci. 22, 90-101. https://doi.org/10.1016/j.sjbs.2014.08.002
  37. Bedenic, B., Vranes, J., Bosnjal, Z., Marijan, T., Mlinaric-Decpina, A., Kukovec, T., Kneczevic, J., Anusic, M., Beader, N., Barl, P., Leskovar, V. and Kalenic, S. (2010). Emergence of CTX-M group1extended-spectrum β-lactamase-producing Klebsiella pneumoniae strains in the community. Med. Glas. 7, 32-39. http://dx.doi.org/10.1155/2014/841951
  38. Li, Q., Chang, W., Zhang, H., Hu, D. and Wang, X. (2019). The role of plasmids in the multiple antibiotic resistance transfer in ESBLs-producing Escherichia coli isolated from wastewater treatment plants. Front. Microbiol. 10, 633. https://dx.doi.org/10.3389%2Ffmicb.2019.00633
  39. Wright, G.D. (2007). The antibiotic resistome: the nexus of chemical and genetic diversity. Nat. Rev. Microbiol. 5, 175-186. https://doi.org/10.1038/nrmicro1614
  40. Novick, R.P., Clowes, R.C., Cohen, S.N., Curtiss III, R., Datta, N. and Falkow, S. (1976). Uniform nomenclature for bacterial plasmids: a proposal. Bacteriol. Rev. 40, 168-189.
  41. Zhao, W.H. and Hu, Z.Q. (2013). Epidemiology and genetics of CTX-M extended-spectrum β- lactamases in gram-negative bacteria. Crit. Rev. Microbiol. 39, 79-101. https://doi.org/10.3109/1040841x.2012.691460
  42. Karim, A., Poirel, L., Nagarajan, S. and Nordmann, P. (2001). Plasmid-mediated extended- spectrum beta-lactamase (CTX-M-3 like) from India and gene association with insertion sequence ISEcp1. FEMS Microbiol. Lett. 201, 237-241. https://doi.org/10.1111/j.1574-6968.2001.tb10762.x
  43. Dewanjee, S., Gangopadhyay, M., Bhattacharya, N., Khanra, R. and Dua, T.K. (2015). Bioautography and its scope in the field of natural product chemistry. J. Pharm. Anal. 5, 75- 84. https://doi.org/10.1016/j.jpha.2014.06.002
  44. Rajaram, S.K., Ahmad, P., Keerthana, S.S.S., Cressida, P.J., Moorthy, I.G. and Suresh, R.S.S. (2020). Extraction and purification of an antimicrobial bioactive element from lichen associated Streptomyces olivaceus LEP7 against wound inhabiting microbial pathogens. J. King Saud Univ. Sci. 32, 2009-2015. https://doi.org/10.1016/j.jksus.2020.01.039
  45. Cushnie, T. and Lamb, A.J. (2005). Antimicrobial activity of flavonoids. Int. J. Antimicrob. Agents. 26, 343-356. https://doi.org/10.1016/j.ijantimicag.2005.09.002
  46. Orhan, D.D., Ozcelik, B., Ozgen, S. and Ergun, F. (2010). Antibacterial, antifungal, and antiviral activities of some flavonoids. Microbiol. Res. 165, 496-504. https://doi.org/10.1016/j.micres.2009.09.002
  47. Woznicka, E., Kuzniar, A., Nowak, D., Nykiel, E., Kopacz, M., Gruszecka, J. and Golec, K. (2013). Comparative study on the antibacterial activity of some flavonoids and their sulfonic derivatives. Acta Pol. Pharm. 70, 567-57.
  48. Cowan, M.M. (1999). Plant products as antimicrobial agents. Clin. Microbiol. Rev.12, 564- 582. https://doi.org/10.1128/cmr.12.4.564
  49. Das, S., Pramanik, T., Jethwa, M. and Roy, P. (2021). Flavonoid-decorated nano-gold for antimicrobial therapy against gram-negative bacteria Escherichia coli. Appl. Biochem. Biotechnol. 193, 1727-1743. https://doi.org/10.1007/s12010-021-03543-7
  50. Baltz, R.H. (2008). Renaissance in antibacterial discovery from actinomycetes. Curr. Opi. Pharmacol. 8, 557-563. https://doi.org/10.1016/j.coph.2008.04.008

Tables

Table 1. Plasmid profile of ESBL positive isolates

ESBL producing Isolates

No. of Plasmids

One

Two

Three

Four

Five

E. coli (n=27)

5

3

8

7

4

Klebsiella  sp. (n=14)

1

3

5

5

0

 

Table 2. Anti-ESBL activity of Streptomyces bioactive compound

S.No

bla CTX –M positive isolates

Diameter of zones of inhibition (mm) 

Crude Extract

CF

1.

UTEC3

9 mm

27 mm

2.

UTEC4

10 mm

9 mm

3.

UTEC20

9 mm

NP

4.

UTEC22

11 mm

NP

5.

UTEC29

9 mm

9 mm

6.

UTEC31

NP

NP

7.

UTEC40

10 mm

NP

8.

UTEC48

9 mm

NP

9.

UTEC53

10 mm

9 mm

10.

UTK2

17 mm

13 mm

11.

UTK12

13 mm

8 mm

12.

UTK15

12 mm

8 mm

13.

UTK21

11 mm

9 mm

14.

UTK30

13 mm

8 mm

15.

UTK36

9 mm

7 mm

16.

E.coli ATCC 25922

16 mm

18 mm

17.

K.pneumoniae ATCC 700603

11 mm

10 mm

CF- Ciprofloxacin. NP-Not Predictable

 

Table 3.  Chemical screening of the bioactive compound EF2

Biochemical analysis for

Observation

Result

Terpenoids

No reddish brown colour at the interface

Negative

Diterpenes

Copper acetate test

 

No emerald green colour

 

Negative

Alkaloids

Dragendorff’s test

Wagner’s test

 

No red precipitate

No brownish/red precipitate

 

Negative

Negative

Carotenoids

No blue colour ring at the interface

Negative

Flavonoids

Alkaline reagent test

 

 

Lead acetate test

 

Development of yellow colour change upon the addition of 20% NaOH and disappearance of colour upon addition of acid.

Yellow colour precipitate

 

Positive

 

 

Positive

Anthraquinones

No rose- pink colour

Negative

Glycosides

Modified Borntrager’s test

 

No red-pink colour

 

Negative