Animal TBI model and experimental grouping
All experimental procedures were conducted following the existing rules of Huazhong University of Science and Technology and the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. Male adult mice (C57BL/10ScNJ; age: 10-12 weeks; weight: 20–22 g) were obtained from Huazhong Keji Co. All animals were housed in a controlled environment (temperature: 22±3°C, under a 12 h light/dark cycle) and were provided standard rodent nutrition and water. The mouse model of TBI was induced according to previous reports [14]. Anaesthesia was surgically induced with chloral hydrate (400 mg/kg body weight) administered intraperitoneally (i.p.), and then the mice were subjected to a unilateral, moderately controlled cortical impact (CCI) of 2.0 mm depth at 3.5 m/s and 500 ms dwell time using the TBI 0310, a pneumatic impacting device (Precision Systems & Instrumentation, Fairfax Station, VA) with a hard stop Bimba cylinder (Bimba Manufacturing, Monee, IL). The size of the bevelled impactor was 5 mm. All craniotomies were placed midway between the bregma and lambda sutures in the left hemisphere of the brain. A total of 100 animals were randomly divided into 4 groups: sham group (n = 20); sham + miR-873a-5p agomir group (n = 20); TBI group (n = 30); and TBI + miR-873a-5p agomir group (n = 30). All investigators were blinded to the treatment groups during animal surgery, data collection, and analysis.
Primary microglia and astrocyte culture
Primary microglia and astrocytes were obtained and purified from C57BL/6 mice on postnatal days 1 to 2 as previously described [14]. Briefly, the cerebral cortex was collected and cut into 1 mm3 pieces. After digestion with 0.25% trypsin and DNase for 10 min, the cell suspensions were passed through a 70-mm nylon mesh, and the digestion was ended with DMEM supplemented with 10% FBS and 1% penicillin/streptomycin. These cells were collected by centrifugation and seeded into a culture flask. Microglia within the astrocyte monolayer were removed by shaking at 220 rpm for 40 min after 10 days and were then re-cultured in 6- or 24-well plates. The remaining mixed glial cells in the flask were shaken at 220 rpm for 18 h continuously to remove oligodendroglia, and then the remaining cells in the flask were astrocytes with over 90% purity. Astrocytes and microglia were cultured at 37 °C in a 5% CO2 atmosphere for subsequent experiment.
Clinical specimen collection and ethics statement
The present study was conducted in accordance with the Declaration of Helsinki and was approved by the Research Ethics Board of Tongji Hospital. Written informed consent was obtained from all individuals who were included in the study. TBI patients were diagnosed according to the World Health Organization criteria. The clinical specimens of damaged brain tissue were taken from 15 patients who were operated on in the neurosurgical emergency department of Tongji Hospital. These tissues were either necrotic brain tissue or severe oedema around the lesion that needed to be removed.
Cell transfection of the miR-873a-5p mimic and intracerebroventricular infusion (ICV)
The miR-873a-5p mimic, NC mimic, and agomir were purchased from RiboBio (China). They were dissolved and diluted according to the instructions provided by the manufacturer. The microglia were transfected with 100 nM aliquots of either the miR-873a-5p mimic or NC mimic using RiboFECT™ CP (RiboBio, China) per the manufacturer’s protocol. After dissolving and mixing the miR-873a-5p agomir, it was allowed to stand for 15 minutes at room temperature and was then used for lateral ventricle injection. A Hamilton syringe (Gaoge, China) was inserted at 0.5 mm posterior and 1.0 mm lateral to the bregma and 3.0 mm ventral to the skull under the guidance of a stereotaxic instrument (RWD Life Science). The miR-873a-5p antagomir and NC antagomir were infused into the lateral ventricle 20 min after CCI.
Brain extracts
Brain extracts (Ext) were made as previously described [15]. Briefly, TBI was induced in C57BL/6 mice, and after 1 d the cortices was collected before they were surgically induced with chloral hydrate (400 mg/kg body weight) for anaesthesia. A total of 4 ml complete medium per cortex were added into glass tubes, and the supernatant was collected after each cortex was ground fully with a glass grinding rod and centrifuged at 1000 rpm for 10 min. Then, 1 ml of the supernatant was aliquoted in 1.5 ml EP tubes and kept at -80°C for usage.
Astrocyte-derived Exosome Isolation and Transmission Electron Microscopy Analysis
The astrocyte-derived exosome isolation procedures were performed at 4°C as described in the literature [16]. Briefly, supernatants collected from cultured astrocytes were first filtered through a 0.2 μm filter to remove the large debris and dead cells. Small-cell debris was removed by centrifugation at 10,000 g for 30 minutes, and then the supernatants were recentrifuged at 100,000 g for 3 h. The supernatants generated at this step were stored at 4°C for future use as exosome-free controls (the average storage time was no more than 1 week). The pellets were resuspended in 30–50 μl of PBS and stored at -80°C for other usage. For the transmission electron microscopy (TEM) morphology investigation, the pellets obtained as described above were subjected to uranyl acetate negative staining on For-mvar carbon-coated 400 mesh copper electron microscopy grids (FCF400-Cu, Electron Microscopy Sciences, Hatfield, PA). Twenty microliters of sample was applied to the grid and incubated for 5 minutes at room temperature, and then the excess solution on the grid was wicked off and dried for 30 minutes with filter papers. An equal part of 10% uranyl acetate was added to the grid for negative staining for 5 minutes. The preparations obtained were examined at 70 kV with a Philips 208 electron microscope (Philips, Bothell, WA) with an AMT digital imaging system (Advanced Microscopy Techniques Corp., Woburn, MA). Protein concentrations of exosome preparations were determined using the BSA assay. For neural cell treatment with astrocyte exosomes, we diluted the collected exosome-enriched fractions of the stored supernatant as noted above, and the supernatant without exosomes was used as a control. These media were then added to the cultured neural cells.
miRNA microarray analysis
The miRNA microarray analysis was performed by GeneChem (Shanghai, China). The samples of exosomes derived from astrocytes were divided into 2 groups: the Ext group and CON group, which were with or without exposure to brain extracts, respectively. The quality and integrity of the RNA extracted from the exosomes were evaluated first. Next, 200 ng of total RNA was labelled with the GeneChip 39 IVT Express Kit (Thermo Fisher Scientific) and hybridized to the GeneChip miRNA 3.0 Array (Thermo Fisher Scientific), which covered 1188 mature mouse miRNAs and 889 pre-miRNAs. RNA molecules were then polyadenylated, followed by a ligation step with a biotin-labelled DNA molecule attached. The labelled RNA was finally washed and stained in the GeneChip Fluidics Station 450 and scanned in the GeneChip Scanner 3000 (Thermo Fisher Scientific).
Western blot analysis
Protein concentrations were determined by using a BSA kit, and then the protein samples were diluted with 5x sample buffer solution, separated by electrophoresis in a 12% separation gel for 90 min, and blocked with 1x PBS containing 5% (w/v) non-fat dried milk (PM) for 1 h at room temperature. Then, the cells were incubated with primary antibodies (iNOS: 1:1000, HMGB1: 1:1000, IL-1β: 1:1000, Arg1: 1:1000, CD9: 1:1000, CD63: 1:1000, p-NK-κB: 1:1000, NK-κB: 1:1000, IL-4: 1:1000, IL-10: 1:1000, Abcam, USA; MyD88: 1:1000, p-ERK: 1:1000, and ERK: 1:1000, Cell Signaling Technology, Beverly, MA, USA) at 4 °C overnight. Membranes were then washed and incubated with HRP-conjugated anti-rabbit or mouse antibody (1:1000, Earth-Ox Life Sciences, Millbrae, CA) for 1 h at room temperature and then exposed and photographed on a Gene Gnome exposure instrument. Finally, the expression of the proteins was standardized for densitometric analysis to β-Actin levels.
Modified neurological severity score (mNSS) test
To evaluate the neurological functional outcomes, the mNSS was performed. The tests were carried out before CCI and at days 1, 3, 7 and 14 after CCI. The scale was graded from 0 to 18 (normal score: 0; maximal deficit score: 18). The mNSS comprises the motor (muscle status and abnormal movement), sensory (visual, tactile, and proprioceptive), and reflex reactions and balance tests. One point is awarded if the mice are unable to perform the test or lack an expected reaction; thus, the higher the score, the more severe the injury.
Measurement of the brain water content
Brain oedema was evaluated by measuring brain tissue water content using the wet-dry weight method as described previously [17]. Animals were sacrificed 7 days after TBI, and the left brain cortical tissue was collected. The brains were harvested, and the pons and olfactory bulbs were removed. The tissue was positioned directly over the injury site, covering the contusion and the penumbra. The fresh tissue was weighed to record the wet weight, dried for 72 h at 80°C, and then weighed again to record the dry weight. The brain water content was calculated using the formula: [(wet weight-dry weight)/wet weight]×100%.
Quantitative real-time PCR
Total RNA was isolated from microglia or tissue using TRIzol (Invitrogen, Carlsbad, CA, USA) before being washed with PBS and reverse-transcribed to cDNA with the PrimeScriptTM RT Reagent Kit (Thermo, USA) according to the datasheet from manufacturer. Gene products were then amplified by quantitative real-time PCR on an ABI-Prism 7500 Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA) using SYBR Premix Ex Taq TM II (Takara). The relative level of miR-873a-5p (MQP-0101, RiboBio, China) was normalized to the expression of control U6 snRNA (MQP-0201, RiboBio, China). Other mRNAs were normalized to the internal standard GAPDH. The primers are as follows. Data were analysed using the 2−ΔΔCt method.
Name
|
Primer sequence
|
IL-1β
|
Forward, AGAACCAAGCAACGACAAAATAC
|
Reverse, GTATTGCTTGGGATCCACACTC
|
IL-6
|
Forward, GGAGCCCACCAAGAACGATA
|
Reverse, CAGGTCTGTTGGGAGTGGTA
|
TNF-α
|
Forward, GGATTATGGCTCAGGGTCCA
|
Reverse, ACATTCGAGGCTCCAGTGAA
|
iNOS
|
Forward, CATTCAGATCCCGAAACGCT
|
Reverse, TGTAGGACAATCCACAACTCGC
|
IL-4
|
Forward, GTAGGGCTTCCAAGGTGCTTC
|
Reverse, CATGATGCTCTTTAGGCTTTCCAG
|
IL-10
|
Forward, ACCTGGTAGAAGTGATGCCC
|
Reverse, ACACCTTGGTCTTGGAGCTT
|
Arg1
|
Forward, GCATATCTGCCAAAGACATCGT
|
Reverse, TCTTCCATCACCTTGCCAATC
|
CD32
|
Forward, TGTCACTGGGATTGCTGTCG
|
Reverse, CCCCAGAGGGCTGTCTGTAC
|
CD206
|
Forward, CGTTTCGGTGGACTGTGGA
|
Reverse, GTTGTGGGCTCTGGTGGG
|
GAPDH
|
Forward, TGAAGGGTGGAGCCAAAAG
|
Reverse, AGTCTTCTGGGTGGCAGTGAT
|
Immunofluorescence staining
Cells or tissues were incubated with GFAP, Iba1, CD9, Arg1, or iNOS antibodies (Abcam, USA) overnight at 4 °C and then incubated with conjugated secondary antibody for 1 h at room temperature in the dark. After several washes with PBS, the slides were incubated with DAPI for 3 min and then mounted in glycerol. After mounting, immunofluorescent signalling was observed with an Olympus Fluoview laser scanning confocal microscope (Olympus, Tokyo, Japan), and the percentages of positive cells were counted in a blinded manner using ImageJ.
Statistical analyses
All data are expressed as the mean±standard deviation. The programmes GraphPad and InStat were used for statistical analyses. One-way ANOVA followed by Newman–Keul’s post hoc test was used for multiple comparisons. A nonpaired t-test was used when two groups were compared. Two-way ANOVA was used to compare the NDs between the three groups at different time points.