Materials and reagents
L-theanine (CAS: 3081-61-6, 98% purity) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Donkey anti-Rabbit IgG H&L (Alexa Fluor 488) (#ab150075; 1:500) was obtained from Abcam (Cambridge, UK). DAPI were purchased from Invitrogen (Carlsbad, CA, USA).
Primary antibodies against ACC1 (#3676), FASN (#3180), p-AMPK (#2535), AMPKα (#5831) were purchased from Cell Signaling Technology (Beverly, MA, USA). Antibody against p-CaMKKβ (#AF4487), CaMKKβ (#DF4793) were purchased from Affinity Biosciences (OH, USA). Antibody against SREBP-1c (#A15586), phospho-mTOR (#AP0094), mTOR (#A2445), HRP Goat Anti-Rabbit IgG (#AS014), and HRP Goat Anti-Mouse IgG (#AS003) was purchased from ABclonal (Wuhan, Hubei, China). Antibodies against PPARα (#15540-1-AP), CPT1A (#15184-1-AP), SREBP-1c (#14088-1-AP) was purchased from Proteintech (Chicago, IL, USA). Antibodies recognizing GAPDH (#AP0063), Lamin B (#AP6001), and β-ACTIN (#AP0060;) were purchased from Bioworld Technology (Minneapolis, MN, USA). Donkey anti-Rabbit IgG H&L (Alexa Fluor 488) (#ab150075) was obtained from Abcam (Cambridge, UK). DAPI were purchased from Invitrogen (Carlsbad, CA, USA).
Animals and treatments
Male C57BL/6J mice weighing 20 to 22 g (6 weeks old) were procured from the Beijing Vital River Laboratory Animal Technology Co. (Beijing, China; SCXK 2019-0001). All animals were kept under standard conditions with a controlled temperature and a 12-h light/dark cycle with water and food ad libitum. After an acclimatization period of 1 week, all mice were randomly divided into 3 groups (n = 8 per group). The normal control diet (NCD) group, the high-fat diet (HFD) group (60% fat, D12492; Research Diets, New Brunswick, NJ, USA), and the L-theanine group (fed with HFD supplement with 300 mg/kg L-theanine). The NCD, HFD, and L-theanine group were fed for 16 weeks and in the meanwhile treated with saline or 300 mg/kg L-theanine by gavage once daily for 16 weeks. Food intake and body weight was recorded weekly. At the end of the experiment, all mice were fasted for 16 h before sacrifice, then blood samples, liver and visceral adipose tissues were harvested, weighed, and stored at -80°C, Additional sections of liver and visceral adipose tissues were prepared for histological analyses.
All treatments of mice in this study were in strict agreement with the “Guide for the Care and Use of Laboratory Animals”. All the experimental procedures were approved by the Animal Ethics Committee of Nanjing Normal University.
Biochemical analysis
The blood samples were collected from orbital vascular plexus and centrifuged at 3000 rpm for 10 min, then serum was collected for biochemical analysis. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), HDL cholesterol (HDL-C), LDL cholesterol (LDL-C), total triglycerides (TG) and total cholesterol (TC), were detected using commercial assay kits according to the manufacturer's instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).
TG and TC contents in mouse liver and hepatocytes were also measured using commercial kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s protocol.
Oil Red O staining
Liver tissues were fixed with 4% polyformaldehyde and embedded in tissue freezing medium (Leica). The liver sections (8 µm) and treated hepatocytes were immersed in Oil Red O working solution (Sigma-Aldrich) for 20–30 min at room temperature, then washed with 60% isopropanol to remove unbound dye and counterstained with hematoxylin. Finally, images were captured by using a light microscope (Nikon, Japan).
Histology and Immunohistochemistry
Liver and adipose tissues were fixed in 4% paraformaldehyde and embedded in paraffin. Sections (4 µm) were deparaffinized with xylene and rehydrated in graded ethanol, stained with hematoxylin and eosin (H&E). The images were taken using a microscope (Nikon, Japan), and the NAFLD score was evaluated as previously described [20].
For immunohistochemistry, paraffin sections of liver were deparaffinized and rehydrated, treated for antigen retrieval, and endogenous peroxidase was quenched with 3% hydrogen peroxide. After blocking nonspecific antigen, the slides were then incubated with primary antibody overnight at 4°C, followed by biotinylated secondary antibody and third antibody coupled with SABC (BosterTech, China). The DAB kit was used to produce a brown stain, and counterstained with hematoxylin. Images were acquired by using a light microscope (Nikon, Japan).
Cell culture and treatments
The HepG2 and AML12 cells were purchased from Cell Bank of the Chinese Academic of Sciences (CBCAS), Shanghai, China. HepG2 cells were cultured in EMEM (Wisent, Canada), supplemented with 10% fetal bovine serum (Wisent, Canada), 100 U/mL penicillin and 100 µg/mL streptomycin (Wisent). AML12 cells were cultured in DMEM/F12 (Wisent, Canada) supplemented with 10% fetal bovine serum, 100 U/mL penicillin, 100 µg/mL streptomycin, ITS supplement and 40ng/mL dexamethasone. All cells were cultured in humidified atmosphere containing 5% CO2 at 37°C (Thermo Fisher Scientific).
20 mM OA solution were obtained by dissolving OA in 0.1 M NaOH at 75°C in a water bath, then added to 20% BSA, filtered using 0.22 µm filter, a final stock solution of 10 mM OA were prepared. The 10% BSA solution were added as control.
Cell viability assay
Cell viability was determined using cell counting kit-8 (CCK-8). according to the manufacturer's instructions (Vazyme, Nanjing, China).
Immunofluorescence microscopy
HepG2 cells grown on coverslips were pretreated with or without L-theanine for 2 hours, after co-incubated with 500 µM oleic acid (OA) for 24 h, The cells were washed with PBS and fixed with 4% formaldehyde for 15 min at room temperature, then cells were permeabilized in 0.2% TritonX-100 for 20 min followed by blocking with 5% BSA for 30 min. After that, the cells were incubated anti-SREBP-1c antibody (1:100) overnight at 4°C and incubated with Donkey anti-Rabbit IgG H&L (Alexa Fluor 488) secondary antibody for 1 hour. Cell nuclei were stained with DAPI for 5 min. Images were captured by the Nikon A1 microscope (Tokyo, Japan).
Real-time PCR
Total RNA from livers was extracted using RNA Isolation Kit (Omega Bio-tek, America) and then was reversely transcribed to cDNA using PrimeScript RT reagent kit (TaKaRa, Shiga, Japan). Quantitative polymerase chain reaction (qPCR) was carried out on ABI StepOnePlus real-time PCR system (Applied Biosystems, USA) using SYBR Premix Ex Taq (TransGen Biotech, China). The results were analysed using the 2−ΔΔCtmethod. Values were normalized to β‐actin. The sequences of primers were listed in the Table 1.
Table 1
Primers for Real-Time PCR detection
Gene | Sequence 5’→3’ |
Mouse Srebf1 | F: CAAGGCCATCGACTACATCCG R: CACCACTTCGGGTTTCATGC |
Mouse Fasn | F: CCGGAGTCGCTTGAGTATATTG R: TTGTGGAAGTGCAGGTTAGG |
Mouse Acc1 | F: CTTCCTGACAAACGAGTCTGG R: CTGCCGAAACATCTCTGGGA |
Mouse Pparγ | F: CTCCAAGAATACCAAAGTGCGA R: GCCTGATGCTTTATCCCCACA |
Mouse Pparα | F: AGAACCTGAGGAAGCCGTTC R: TTAAGCACGTGCACAATCCC |
Mouse Cpt1a | F: TGACGGCTATGGTGTTTCCT R: TTTTGGAATTGGCGGTGAGG |
Mouse Actb | F: GTGACGTTGACATCCGTAAAGA R: GCCGGACTCATCGTACTCC |
Preparation of Cytoplasmic and Nuclear Extracts
Nuclear and cytoplasmic extracts were lysed with NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, Rockford, IL, USA) according to the manufacturer’s instructions.
Immunoblotting
Liver samples or cells were lysed in RIPA lysis buffers (Beyotime, China) supplemented with protease inhibitor cocktail and phosphatase inhibitors. A total of 20–50 µg lysates were loaded onto SDS-PAGE gels and transferred to a PVDF membrane (Millipore, China). After blocking with TBS/T (0.1% Tween-20) containing 5% nonfat
dry milk for 1 hour at room temperature, the membranes were incubated with primary antibody at 4°C overnight followed by HRP-conjugated secondary antibody. Immunoreactive proteins were visualized using the ECL immunoblotting system from Tanon (Shanghai, China).
Statistical analysis
All data were analyzed using GraphPad Prism 6.0 (GraphPad Software, San Diego, CA). All experimental results are presented as mean ± SEM. Statistical analysis between two groups were determined using the two-tailed Student’s t test. One-way ANOVA followed by the Tukey multiple comparisons test was used for comparison between multiple groups. A P value of less than 0.05 was considered to be statistically significant.