Bacterial strains, culture media and growth conditions
S. aureus ATCC 25923 was used as a reference biofilm producer strain in all of the experiments. Besides, two S. aureus strains isolated from tracheal tube samples of two patients (45 and 63 years old) admitted to the ICU of a hospital in Hamedan (west of Iran) were also included in the present study. These bacterial isolates were identified by culture characteristics and biochemical tests and their identity was also confirmed by a species-specific PCR assay which investigated femA gene of S. aureus [26]. Meanwhile, S. epidermidis ATCC 12228 was used as a non-biofilm producer control in the assays. All culture media were obtained from Merck (Darmstadt, Germany) and the bacteria were cultured under aerobic conditions at 37°C for 24 h.
Microtiter Plate Assay
All S. aureus isolates were examined for the ability of biofilm formation using a previously described microtiter plate assay [18]. Briefly, 50 µl of an overnight culture of each isolate was added into 96-well microplates (SPL, Korea) containing 50 µl of each of the Nutrient broth (NB), Tryptic Soy broth (TSB), Mueller-Hinton broth (MHB), and Brain-heart infusion broth (BHIB) media supplemented with 0.25%, 0.5%, 1% and 2% glucose (Merck, Germany). NB, TSB, MHB and BHIB media without glucose were also used as control group. The microplates were aerobically incubated at 37°C for 24 hours. The supernatants were then discarded and microplates were washed twice with phosphate-buffered saline (PBS). The plates were left to dry for an overnight and stained with 200 µl of 0.1% Safranin dye for 15 min followed by three times washing with 300 µl of PBS and air-dried for an overnight. Afterwards, 100 µl of ethanol-acetic acid (95:5 V/V) was added to each well to dissolve bounded Safranin in adherent bacterial cells. Finally, optical density values were measured at 490 nm by a plate reader. The experiment was performed in triplicates. The biofilm-producer S. aureus ATCC 25923 and the biofilm non-producer S. epidermidis ATCC 12228 were used as control strains [27].
Slime Assay
Congo red tube test was performed to evaluate the ability of slime production in different media supplemented with various glucose concentrations. To do this, a single colony from an overnight culture was inoculated into 10 ml of each of NB, TSB, MHB and BHIB media contained 0.04% Congo red dye and supplemented with 0.25, 0.5, 1 and 2% glucose. NB, TSB, MHB and BHIB media without glucose were used as control group. The culture tubes were incubated on a shaker (100 rpm) at 37°C for 24 hours. The cultured media were then categorized into three groups based on their colors: black, weak black and red. As exopolysaccharides directly react with Congo red and produce black color, the level of black color is considered as the amount of exopolysaccharides or polysaccharide intercellular adhesins (PIA) [28].Therefore, the black and red media were considered to be related to normal slime producing and non-slime producing isolates, respectively.
Rna Extraction And Cdna Synthesis
To evaluate transcription of icaA gene, the presence of its encoding DNA was first investigated in S. aureus isolates and the reference strain by a PCR assay using previously introduced primers [29]. The sequence of forward primer was 5′-TATTCAATTTACAGTCGCAC-3′ and of reverse primer was 5′-GATTCTCTCCCTCTCTGCCA-3′. These primers amplify a 407 bp DNA fragment of icaAD gene based on a published sequence (AF086783). A PCR product was sequenced to confirm PCR specificity. For removing DNA contamination, the extracted RNA was treated with RNase-free DNase I (Thermo Scientific, USA). The quality and quantity of the extracted RNA were determined by agarose gel electrophoresis and confirmed by measuring the absorbance at 260 nm using a Nanodrop spectrophotometer ND-1000 (Thermo Fisher Scientific, Wilmington, DE, USA). Extracted RNAs were stored at -70°C for next experiments. Then, the purified RNA was converted to cDNA according to the manufacturer's instructions (cDNA Synthesis Kit, Takara, Japan), and stored at -20°C to use as the template for real time RT-PCR.
Relative Quantitative Real-time Rt-pcr
SYBR Green real-time PCR Master Mix (Amplicon, Denmark) was used for real-time RT-PCR, according to the manufacturer’s instructions. The primers (Takapouzist, Iran) used are listed in Table 1. The reactions were conducted in a Corbett Life Science Rotor-Gene 6000 Cycler (Qiagen, Germany) and 16S rRNA housekeeping gene was considered as an internal control to normalize the expression levels of icaA. The amplification proceeded as follows: denaturation at 95°C for 10 min and then 40 cycles including denaturation at 95°C for 30 sec, annealing at 53°C (for icaA) and 59°C (for 16S rRNA) for 30 sec, and 72°C for 30 sec. A negative control was included in each run. All the samples were analyzed in triplicate and finally, relative gene expression was calculated using the 2−ΔΔCT method [30].
Table I. Primers used for the quantitative real-time RT-PCR assay.
Genes | Sequence (5ʹ-3ʹ) | Annealing temperature | Reference |
icaA | GGAAGTTCTGATAATACTGCTG | 53°C | [31] |
GATGCTTGTTTGATTCCCTC |
16S rRNA | AGCCGACCTGAGAGGGTGA | 59°C | [32] |
TCTGGACCGTGTCTCAGTTCC |
Statistical Analysis
One-way ANOVA was carried out to compare OD values obtained from three independent experiments using SPSS software. The mean difference was considered significant at P < 0.05.