DOI: https://doi.org/10.21203/rs.3.rs-867651/v1
Perilla is an annual herb with a unique aroma and taste and has been cultivated in Korea for hundreds of years. Owing to the highly edible and medicinal value of Perilla plants, it has been widely cultivated in many Asian and European countries. Recently, several viruses have been reported to cause diseases in Perilla in Korea, including turnip mosaic virus (TuMV) which is known as a brassica pathogen due to its significant damage to brassica crops. In this study, we determined the complete genome sequences of two new TuMV isolates originating from Perilla in Korea. Full-length infectious cDNA clones of these two isolates were constructed and their infectivity was tested by agroinfiltration on Nicotiana benthamiana and sap inoculation on Chinese cabbage and radish. In addition, we analyzed the phylogenetic relationship of six new Korean TuMV isolates and determined their respective affiliation with the four major groups. We also conducted recombination analysis for isolates recently occurring in Korean using RDP4 software, which provided new insight into the evolutionary relationships among Korean isolates of TuMV.
Perilla (Perilla frutescens Britton), belonging to the family Lamiaceae that is composed of 236 genera and more than 7000 species, is an annual herb with a unique aroma and taste, and has been cultivated in Korea for hundreds of years [1–3]. Perilla is also cultivated in many other countries, such as China, Japan and Vietnam. Futhermore, because of its increasing economic significance, some western countries including Europe, the United States and Russia are growing Perilla [4]. Perilla is a very common and popular leafy vegetable in South Korea, which is usually eaten as a kind of salted vegetable or consumed with barbecued meats [2]. Due to its high edible value, it was reported to be grown widely in South Korea, including Kangwan, Jeollabuk, Gyeongsangbuk, Kyonggi, Jeollanam, Chungchongbuk, Chungcheongnam and Gyeongsangnam province [3, 5].
In addition to its edible value, Perilla has been reported to have the potential to be a medical resource [6–9]. For example, a new substance Pf-gp6 extracted from Perilla was proved to inhibit the replication of HIV-1 [7]. The leaf extract of Perilla was reported to impede SARS-CoV-2 by direct virus inactivation [6]. In brief, Perilla is a very popular plant with high economic value.
In Korea, some pathogens have been found to infect Perilla, resulting in different diseases. Ramularia coleosporii was reported to induce leaf spot on Perilla [10] and Corynespora cassiicola caused stem blight in Perilla [11]. Recently, diseases resulting from plant viruses have been reported in Korea. In Yeongcheon city, Cucumber green mottle mosaic virus (CGMMV) caused mosaic and malformation on Perilla leaves [12]. In addition, turnip mosaic virus (TuMV) was first found to infect Perilla plant in in the Korea in 2020, inducing mild mosaic and yellowing symptoms [13].
TuMV is known as a brassica pathogen due to its significant damage to brassica crops [14]. Recent research has indicated that TuMV spread from the west to the east across Eurasia from approximately the 17th century CE [15]. In recent years, TuMV has been found continuously to cause diseases in Brassicaceae plants in South Korea, such as Chinese cabbage (Brassica rapa var. pekinensis) and radish (Raphanus sativus) [16, 17].
Investigation of the molecular evolutionary history of TuMV is beneficial for us to study the biological properties of the population of TuMV [18]. Variation in the genomes of viruses results from mutation, recombination, adaptation and selection [18–21]. Recombination is one of the main forces that accelerate the adaptation and variability, usually resulting in the emergence of mutants and virus isolates able to overcome resistance [21]. As the development of programs that are utilized to detect recombination based on sequence comparison advances, more and more recombination events in plant RNA viruses have been reported [14, 18, 19].
In this research, the complete genomes of two new TuMV isolates were characterized, full-length infectious cDNA clones of these two isolates were constructed and their infectivity was tested by agroinfiltration on Nicotiana benthamiana and sap inoculation on Chinese cabbage cv. CR Victory and radish cv. Iljin. Moreover, we investigated the affiliation of six newly collected isolates from Korea by phylogenetic analysis. We found for the first time that recombination events have occurred in Korean TuMV isolates, which helped us better understand the evolutionary relationship among Korean isolates of TuMV.
Sample collection and plant material
A P. frutescens plant sample with typical TuMV-like symptoms including mosaic and chlorosis was observed in Chuncheon city, South Korea (sample collected by Professor Jin-Sung Hong, Kangwon National University). The N. benthamiana, and Chinese cabbage and radish plants used in this study were incubated in 25oC ± 2oC with 16 hours of light and 8 hours of dark. All the soil used was sterilized before use.
RNA extraction, cDNA synthesis and PCR detection
For virus detection, total RNAs of plant tissues were extracted using TRIzol® Reagent (Life Technologies, Carlsbad, CA, USA), and then the extracted samples were preserved at -70oC. The cDNAs were produced using LeGene Express 1st Strand cDNA Synthesis System with an oligo dT primer. Then detection was conducted by PCR using TuMV-CP-forward primer (5’-TCT CAA TGG TTT AAT GGT CTG G-3’) and reverse primer (5’-AAC CCC TTA ACG CCA AGT AAG-3’) [22].
Construction of full-length clones of TuMV
To obtain infectious clones, we performed full-length PCR. The PCR mixture of 50 μl was composed of 2 μl of the template cDNA, 25 μl of 2 x PCR buffer for KOD FX Neo, 10 pmol of forward primer containing ApaI site and T7 RNA polymerase promoter sequence (5’-GAG GGG CCC TAA TAC GAC TCA CTA TAG GAA AAA TAT AAA AAC TCA ACA CAA CAT ACA CAA AAC G), 0.4mM dNTPs, 10 pmol of reverse primer containing XmaI site (5’-GAG CCC GGG TTT TTT TTT TTT TTT TTT TTT TTT TTT TTT GTC CCT TGC ATC CTA TCA AAT G)[17], 1 μl of Taq polymerase (KOD FX Neo, Toyobo, Osaka, Japan). A cDNA template of TuMV that has been successfully amplified before was used as a positive control. Conditions of full-length PCR were 94 °C for 2 min followed by 5 cycles of 10 s at 98 °C, 30 s for annealing at 59 °C, 6 min for extension at 68°C, and then by 30 cycles of 10s at 98 °C, 30s at 65°C, 6 min at 68°C, and finally incubation at 4 °C. Analysis of full-length PCR products was conducted by 0.8% agarose gel electrophoresis with dye incorporated in the gel. The PCR product was digested by ApaI and XmaI and subsequently cloned into the binary vector pJY which was digested by the same enzymes [23, 24]. The recombinants were screened by colony PCR and double enzyme digestion. Then the recombinant plasmids were transformed into E.coli competent cell (DH5a).
Agrobacterium infiltration and sap inoculation
The recombinant plasmids were transformed into Agrobacterium tumefaciens GV2260. The colonies of each clone were incubated on LB plates supplemented with Kanamycin and Rifamycin and then the Agrobacterium cells collected from fresh plates were diluted to approximately OD600 = 0.6 in infiltration buffer (10 mM MES, 10 mM MgCl2, and 150 μM acetosyringone). N. benthamiana plants inoculated with constructed clones were incubated in a growth chamber at 24-26oC (16/8h, light/dark cycle) [17]. Leaves of the infiltrated N. benthamiana plants with symptoms were used to inoculate Chinese cabbage cv. CR Victory and radish cv. Iljin as described previously [17].
Sequencing of TuMV infectious cDNA clones
After the infectivity of each full-length cDNA clone was assessed by agroinfiltration, the full-length clones that have infectivity were sequenced by BIONEER CORPORATION (Daejeon, South Korea). Sequencing was initiated from each terminus using vector specific primers, and continued using primers designed from the obtained sequences (Table 1). The complete genome sequences were compared and assembled in DNAMAN software (Version 5.2, Lynnon BioSoft).
Construction of phylogenetic tree.
The Maximum-likelihood method was utilized to construct phylogenetic tree with 1000 bootstrap replicates in MEGA software (version 7.0). The complete genome sequences of TuMV strains utilized in this study were collected from NCBI (Table 2), including isolates previously reported in South Korea [16, 17, 25] and 6 newly collected isolates (two each from Perilla, radish, and Chinese cabbage)
Recombination analysis
Firstly, complete genome sequences of all Korean TuMV isolates were aligned by clustal X in MEGA 7.0. Recombination analysis was performed using RDP4 software package and employed seven detection methods: RDP [26], GENECONV [27], Bootscan [28], Maxchi [29], Chimaera [30], SiScan [31], and 3SEQ [32]. Recombination events were noted if supported by at least four different methods (p-values < 1.0x10 -6) [18].
Construction of full-length cDNA clones
The full-length PCR products amplified from Perilla were evaluated by gel electrophoresis (Fig 1A), and then the PCR products were digested using ApaI and XmaI. Subsequently, the digested product was ligated with the pJY vector which was treated with the same enzymes. Colony PCR was performed to screen the colonies harboring recombinants (Fig 1B), and finally we obtained 5 positive colonies which were also confirmed by double enzyme digestion, namely KPF-1, KPF-2, KPF-3, KPF-4 and KPF-5 (Fig 1C).
Results of agroinfiltration test and sap inoculation
At 4 days post inoculation (dpi), we observed weak leaf curling symptoms on the top leaves of N. benthamiana plants inoculated by KPF-2 while no symptoms were observed in plants infiltrated with other isolates. At 6 dpi, plants inoculated by construct KPF-1 also showed symptoms. Symptoms were further recorded at 7, 10 and 14 dpi (Fig 2A). Finally, infectivity was only confirmed for full-length cDNA clones KPF-1 and KFC-2. KPF-2 was shown to cause symptoms more quickly and induced obvious chlorosis which was not induced by KPC-1. The infection was confirmed by RT-PCR as described previously, and the RT-PCR result was consistent with their symptom development (Table 3).
For sap inoculation, both isolates infected radish cv. Iljin systemically, causing mild mosaic symptoms, while neither isolate could infect Chinese cabbage cv. CR Victory systemically (Fig 2B).
Nucleotide and amino acid sequence analysis
The genomes of isolate KPF-1 and KPF-2 are both composed of 9832 nucleotides excluding the poly (A) tail, and the genome is predicted to encode a polyprotein of 3164 amino acids. However, the complete genome size of TuMV isolates we obtained previously was 9833 bp. By contrast, the complete genome sequences of the new isolates reported here lack a base in the 3’ untranslated region (at 9753 nt). The two isolates shared 99.92% identity in nucleotide sequence and 99.84% in amino acid sequence. Alignment analysis revealed that there are 8 nucleotide differences between their genomes which are located in P1 (nt 579), HC-Pro (nt 1279 and 2201), P3 (nt 3528 and 3653), CI (nt 4419), VPg (nt 6233) and NIa-Pro (nt 6597) respectively. Amino acid alignment showed 5 differences, in P1 (R150S); HC-Pro (D384N and P691H); P3 (R1175Q); and VPg (E2035G) (Fig 3).
Phylogenetic analysis
Two phylogenetic trees were constructed by using Maximum-likelihood method with 1000 bootstrap replicates in MEGA 7.0. The first phylogenetic tree containing isolates collected from a variety of hosts in multiple countries was divided into four branches, which is consistent with previous studies [18, 19] (Fig 4). In addition, the newly collected Perilla isolates (KPF-1 and KPF-2), and radish isolates (KRS-3 and KRS-8) were grouped together and fell in the Basal-BR group. The Chinese cabbage isolates (KBC-1 and KBC-8) were predicted to belong to the World-B group. However, most of the isolates collected from Korea belong to the Basal-BR group. Subsequently, we constructed a second phylogenetic tree which only include Korean TuMV isolates with PVY as the outgroup (Fig 5). Interestingly, four strains previously identified as Basal-BR isolates were clustered with KBC-1and KBC-8 which belonged to the World-B group in the first tree, forming a special branch separated with the other branch composed of only Basal-BR isolates
Recombination analysis
Due to the close correlation between four Basal-BR isolates and two World-B isolates shown by the second phylogenetic tree, we conducted recombination analysis by RDP 4 software, which is a mature and common tool to study the recombination events which have occurred in virus populations.
As we expected, isolates BE, and three highly similar isolates (HJY1, HJY2, and R007, sharing 99.93% identity in nt) were detected as recombinants supported by all seven detection methods (Fig 6). Three recombination events were indicated. The information for each recombination event is shown in Table 4, with HJY-1 representing the three closely-related isolates HJY1, HJY2, and R007.
P. frutescens, a crop with high economic value, has been studied in recent years. With climate change resulting in rising temperatures, diseases caused by viruses have been reported constantly. More and more attention has been paid to the survey and study on the diseases caused by viruses in Perilla plants. In this research, we collected two TuMV isolates from a Perilla sample collected from Kangwon, South Korea. In addition, the complete genome of each isolate was determined, the genomes of both isolates are comprised of 9832 bp. Interestingly, they lack a nucleotide in the 3’ UTR region compared with all TuMV strains we have previously collected in South Korea [16, 17, 23].
In addition, we successfully constructed full-length infectious clones of these two isolates, namely KPF-1 and KPF-2. Their infectivity was evaluated by agroinfiltration on N. benthamiana. Both isolates are able to infect N. benthamiana systemically, but isolate KPF-2 induced symptoms more quickly, usually two days earlier than isolate KPF-1. Amino acid sequence alignment suggested that there are 5 amino acid differences located in P1, HC-Pro (2), P3 and VPg regions. One conserved motif in HC-Pro region has been studied and proved to recruit and employ host ARGONAUTE1 (AGO 1) in the formation of stable virions, which may be involved the efficient systemic infection [33]. The P1 region is the most variable part of the genome [34], it also has been shown to indirectly adjust the RNA silencing suppression activity through reduction of its proteolytic activity which leads to the accumulation of intermediate P1-HCPro [35]. The P3 region also was reported to be an important symptom determinant affecting the host range and cell to cell movement [36, 37]. Our study provided the complete genome sequences of two new TuMV isolates, and we constructed full-length infectious clones to investigate their corresponding symptom phenotypes on N. benthamiana, which is a useful tool in future studies.
Recently, many studies about TuMV have focused on the common recombinants of TuMV and the evolutionary history of the virus [18]. Besides, some phylogenetic studies have emphasized the utilization of non-recombinant sequences to reduce the ‘noise’ caused by recombinants during the evolutionary analysis [14].
In this study, we analyzed the phylogenetic relationship of six new Korean TuMV isolates and determined their respective affiliation with the four major groups. In addition, owing to the close relationship among several Basal-BR isolates and two World-B isolates, we conducted the recombination analysis for Korean TuMV isolates by RDP4. And the recombinant analysis results suggested that recombination events were detected on isolates BE, HJY1 (and also HJY2 and R007), which is supported by seven detection methods (Fig. 6). The recombinant events 2 and 3 could account for the close relationship among Basal-BR isolates BE, HJY1 (plus HJY2 and R007) and World-B isolate KBC-8 (KBC-1). Similar recombinant cases of TuMV have been reported previously, such as the recombination between the Basal-B group and World-B group identified from Australian TuMV isolates [14]. To our knowledge, there are few studies on recombination analysis of Korean TuMV isolates [15], and our analysis provides new insights into the evolutionary relationships among Korean isolates of TuMV.
Conflict of Interest
The authors declare that they have no conflict of interest.
Ethical approval
This article does not contain any studies with human participants performed by any of the authors
Acknowledgement
This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (IPET) through Golden Seed Project (GSP), Ministry of Agriculture, Food and Rural Affairs (MAFRA)(213006-05-5-SBL20).
Table 1. Sequences of the sequencing primers designed and used in this study
No. |
Name |
Sequence |
1 |
KPF_F1 |
AGTGCCATTGCGAACCAC |
2 |
KPF_F2 |
CAAGATCTTCAAGGCGAAG |
3 |
KPF_F3 |
TGACGGATAGTGAGTTGTCT |
4 |
KPF_F4 |
AACGGATCACGAAGGCT |
5 |
KPF_F5 |
ATATCCTCAAGACAAACACC |
6 |
KFP_F6 |
ACCGAATAATGAGCTGC |
7 |
KPF_F7 |
ATTCACAGCGTATATTGCT |
8 |
KPF_F8 |
TCTTGAACCAACTCGACC |
9 |
R1 |
AATCTCACCACATGCGCTAA |
10 |
R2 |
TTGGGGAGGTTCCATTCT |
11 |
R-cover |
ACATCCAGATGAAAGCAG |
12 |
R3 |
GTTCGATCATCCATGCGT |
13 |
R4 |
TTCCATAAATTCCAAGCGGAT |
14 |
R5 |
AGTTCGCAGTCGATATTTC |
15 |
R6 |
TTGGTGCTAATCCAGTGTT |
16 |
R7 |
CATGGAGGTCACACACCT |
17 |
KPF_R8 |
TAACGTTTTATTCCATTTGCC |
18 |
KPF_R9 |
ATACTCGCTTGCTGTGAG |
Table 2. Details of the TuMV isolates analyzed in this study
No. |
Accession Number |
Isolates |
Original Host |
Location |
1 |
AB701698 |
BEL1 |
Rorippa nasturtium-aquaticum |
Belgium |
2 |
AB093611 |
BZ1 |
Brassica oleracea |
Brazil |
3 |
D10927 |
Q-Ca |
Brassica napus |
Canada |
4 |
KF246570 |
ZH1 |
Phalaenopsis sp |
China |
5 |
AB252106 |
CHZJ26A |
Brassica campestris |
China |
6 |
AB093627 |
HRD |
Raphanus sativus |
China |
7 |
AB252103 |
CH6 |
Raphanus sativus |
China |
8 |
AB252107 |
CZE5 |
Brassica oleracea |
Czech Republic |
9 |
AB701703 |
DNK3 |
Brassica rapa |
Denmark |
10 |
AB701708 |
FRA2 |
Brassica napus |
France |
11 |
NC 001616 |
Potato virus Y |
Solanum spp. |
France |
12 |
AB701697 |
ASP |
Allium sp. |
Germany |
13 |
AB701734 |
TIGA |
Tigridia sp. |
Germany |
14 |
AB701735 |
TIGD |
Tigridia sp. |
Germany |
15 |
AB701700 |
DEU2 |
Raphanus sativus |
Germany |
16 |
AB701699 |
DEU1 |
Unknown |
Germany |
17 |
AB252117 |
GRC42 |
Wild Allium sp. |
Greece |
18 |
AB701696 |
GK1 |
Matthiola incana |
Greece |
19 |
AB701719 |
HUN1 |
Alliaria petiolata |
Hungary |
20 |
AB440238 |
IRNTra6 |
Rapistrum rugosum |
Iran |
21 |
AB440239 |
IRNSS5 |
Sisymbrium loeselii |
Iran |
22 |
AB093602 |
IS1 |
Allium ampeloprasum |
Israel |
23 |
AB701720 |
ITA1A |
Brassica ruvo |
Italy |
24 |
AB093598 |
AI |
Alliaria officinalis |
Italy |
25 |
AB701721 |
ITA2 |
Cheiranthus cheiri |
Italy |
26 |
AB701725 |
ITA8 |
Abutilon sp. |
Italy |
27 |
AB093600 |
ITA7 |
Raphanus sativus |
Italy |
28 |
AB093601 |
Cal1 |
Calendula officinalis |
Italy |
29 |
AB252125 |
KWB779J |
Brassica rapa |
Japan |
30 |
MG200170 |
KBJ5 |
Raphanus sativus |
Korea |
31 |
MG200169 |
KBJ4 |
Raphanus sativus |
Korea |
32 |
MG200168 |
KBJ3 |
Raphanus sativus |
Korea |
33 |
MG200167 |
KBJ2 |
Raphanus sativus |
Korea |
34 |
MG200166 |
KBJ1 |
Raphanus sativus |
Korea |
35 |
KX674727 |
HJY1 |
Raphanus sativus |
Korea |
36 |
KX674728 |
HJY2 |
Raphanus sativus |
Korea |
37 |
KX674729 |
KIH1 |
Raphanus sativus |
Korea |
38 |
KX674730 |
KIH2 |
Raphanus sativus |
Korea |
39 |
KX674731 |
GJS1 |
Raphanus sativus |
Korea |
40 |
KX674732 |
GJS2 |
Raphanus sativus |
Korea |
41 |
KX674733 |
GJS3 |
Raphanus sativus |
Korea |
42 |
KX674734 |
GJS4 |
Raphanus sativus |
Korea |
43 |
KY111268 |
SW1 |
Raphanus sativus |
Korea |
44 |
KY111267 |
SW2 |
Raphanus sativus |
Korea |
45 |
KX674726 |
BE |
Raphanus sativus |
Korea |
46 |
KY111274 |
DJ1 |
Raphanus sativus |
Korea |
47 |
KY111273 |
DJ2 |
Raphanus sativus |
Korea |
48 |
KY111272 |
DJ3 |
Raphanus sativus |
Korea |
49 |
KY111271 |
DJ4 |
Raphanus sativus |
Korea |
50 |
KY111270 |
DJ5 |
Raphanus sativus |
Korea |
51 |
KY111269 |
DJ6 |
Raphanus sativus |
Korea |
52 |
KU140420 |
R007 |
Raphanus sativus |
Korea |
53 |
KU140421 |
R041 |
Raphanus sativus |
Korea |
54 |
KU140422 |
R65 |
Raphanus sativus |
Korea |
55 |
MZ570590 |
KPF-1 |
Perilla frutescens |
Korea |
56 |
MZ570591 |
KPF-2 |
Perilla frutescens |
Korea |
57 |
MW556024 |
KBC-1 |
Brassica rapa |
Korea |
58 |
MW556025 |
KBC-8 |
Brassica rapa |
Korea |
59 |
MW556026 |
KRS-3 |
Raphanus sativus |
Korea |
60 |
MW556027 |
KRS-8 |
Raphanus sativus |
Korea |
61 |
DQ648591 |
CAR37A |
Cochlearia armoracia |
Poland |
62 |
AB701731 |
POL2 |
Papaver somniferum |
Poland |
63 |
AB701728 |
POL1 |
Brassica napus oleifera |
Poland |
64 |
AB701729 |
PRT1 |
Brassica oleracea acephala |
Portugal |
65 |
AB093606 |
RUS1 |
Armoracia rusticana |
Russia |
66 |
AB362513 |
TUR9 |
Raphanus sativus |
Turkey |
67 |
AB701717 |
GBR83 |
Brassica oleracea |
UK |
68 |
AF169561 |
UK1 |
Brassica napus |
UK |
Table 3. Results of RT-PCR detection assays of agro-infiltrated Nicotiana benthamiana plants
Clone |
N. benthamiana |
Number tested |
KPF-1 |
+ |
3 |
KPF-2 |
+ |
3 |
KPF-3 |
- |
2 |
KPF-4 |
- |
2 |
KPF-5 |
- |
2 |
Table 4. Recombination events detected among Korea TuMV isolates
Event number |
Recombinant |
Major parent |
Minor parent |
Type of 'recombinant' |
Detection methods * |
|
||||||
R |
G |
B |
M |
C |
S |
T |
p-value |
|||||
1 |
BE |
KBC-8 |
R65 |
World-B x Basal-BR |
+ |
+ |
+ |
+ |
+ |
+ |
+ |
2.414x10-130 |
2 |
HJY1 |
GJS |
KBC-8 |
Basal-BR x World-B |
+ |
+ |
+ |
+ |
+ |
+ |
+ |
6.946x10-103 |
3 |
BE |
R65 |
KBC-8 |
Basal-BR x World-B |
+ |
+ |
+ |
+ |
+ |
+ |
+ |
7.22x10-64 |
* R = RDP; G = GENECONV; B = Bootscan; M = Maxchi; C = Chimaera; S = Siscan; T = 3Seq.