Characterizing the transcriptional expression and in situ localization of the Dnmt2 gene in Drosophila willistoni

doi:10.21203/rs.2.9608/v1

Download PDF

Research article

Characterizing the transcriptional expression and in situ localization of the Dnmt2 gene in Drosophila willistoni

https://doi.org/10.21203/rs.2.9608/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Organisms that have only the DNA methyltransferase 2 (Dnmt2) to mediate the DNA methylation are called "Dnmt2-only" and they have been investigated in recent surveys. Drosophila is one of the “Dnmt2-only” organisms and is also an ideal model for Dnmt2 research. However, the biological function of the Dnmt2 protein is still uncertain. Some studies have pointed to a putative role during the early stages of invertebrate development. In this work, we present our findings on the Dnmt2 expression in D. willistoni, a neotropical species of large ecological versatility and peculiar molecular features. Results: By RT-PCR and in situ hybridization we demonstrate here the presence of transcripts not only in the early stages of development, but also during the oogenesis. Using qPCR analysis, we verify that Dnmt2 transcription level is higher during early stages of development, though transcription levels are subtly higher in D. willistoni adults than in D. melanogaster levels found in previous studies. We also mapped the Dnmt2 on the IIL chromosome arm (Muller’s B element) of D. willistoni, near at the end of the singular telomeric region. Conclusions: Our findings give insights on the possible biological function of Dnmt2-related processes associated with the development and differentiation of oocytes since germinative tissue formation seems to require a higher expression of Dnmt2. The Dnmt2 localization in the subtelomeric region brings up a series of issues that involve the peculiar characteristics of D. willistoni Dnmt2 enzyme, like evolutionary patterns and the epigenetic phenomena of sex-specific methylation.

Epigenetics & Genomics

Dnmt2

Drosophila willistoni

embryogenesis

oogenesis

hybridization in situ

transcription

epigenetic

Cytosine-5 RNA methylation is one among more than 100 distinct RNA modifications that has been already detected in tRNA, rRNA and mRNA [1], representing an important epigenetic modification that regulates gene expression in eukaryotes, with a standing role on their development and for the etiology of human diseases and mediating chromatin organization [2–4]. Elucidation of the molecular mechanisms mediating RNA and DNA methylation is crucial to understanding the roles that diverse nucleic acids play in the regulation of genetic information.

Although DNA methylation appears to be a widespread epigenetic regulatory mechanism, genomes are methylated in different ways in diverse organisms. DNA methylation in plant genomes, for instance, can occur symmetrically at cytosine nucleotides in both CG and CHG (H= A, T or C) contexts, whereas DNA methylation systems are well characterized in vertebrates [5] and occur mostly symmetrically at the cytosine of a CG dinucleotide [6,7]. The cytosine methylation is established and maintained by a family of conserved methyltransferases. In eukaryotes, there are three distinct families of DNA methyltransferases: Dnmt1, Dnmt2, and Dnmt3. Whereas Dnmt3 enzymes seem to be responsible for establishing DNA methylation patterns (de novo methyltransferases), Dnmt1 enzymes are involved in the maintenance of the methylation patterns [8]. On the other hand, the biochemical activity and the biological function of Dnmt2 enzymes are still an open case.

Evidence for DNA methylation has been described and its importance demonstrated in different insect orders. The honeybee genome contains genes that encode orthologues of all vertebrate proteins required for DNA methylation [9,10]. In addition to Dnmt2 (also found in Diptera), two CpG-specific Dnmt family genes were identified: Dnmt1 and Dnmt3a/b genes [11]. The specificity for CpT and CpA nucleotide residues distinguishes Dnmt2 from all other known animal DNA methyltransferases and confirms our previous suggestion of predominant non-CpG methylation in Drosophila [12,13]. The Apis mellifera genome shows greater similarities to vertebrate genomes than Drosophila and Anopheles genomes for the genes involved in DNA methylation, among others (The Honeybee Genome Sequencing Consortium, 2006). For these reasons, methylation in D. melanogaster and other invertebrates remains a controversial research area.

Regarding the genus Drosophila, the species of this genus are so-called “Dnmt2-only” organisms, not containing any of canonical vertebrates DNA methyltransferases homologs (Dnmt1 and Dnmt3). For the species of this genus studied so far, methylation was demonstrated at non-CpG nucleotides [13–15], in contrast to most organisms already analyzed. Furthermore, the specificity for CpT, CpA, and CpC nucleotide residues distinguishes Dnmt2 from all other known animal DNA methyltransferases [13,16], and the functional role of DNA methylation in Drosophila remains unclear. However, adding to that discussion, a recent study describes the importance of the methyl-CpG binding domain proteins to inhibit interspecies courtship and promoting aggression in Drosophila [17]. Another important difference between DNA methylation in mammals and Drosophila is the level of the cytosine nucleotides methylated. Whereas mammals have 2 to 10% of all cytosine residues modified to 5-methylcytosine [18,19], Drosophila melanogaster has only about 0.1 - 0.6% [14,20], making it experimentally difficult to demonstrate unambiguously DNA methylation in this organism. Moreover, in contrast to the pattern of genome-wide DNA methylation in vertebrates, DNA methylation is relatively scattered in invertebrates [21].

Several attempts were made to demonstrate the DNA methylation activity of Dnmt2 in D. melanogaster [13,22] revealing a low, but significant activity by distinct experimental methods. Overexpression of Dnmt2 in Drosophila species appears to enhance genome-wide DNA methylation from 0.2% to 0.4 – 0.7%, as determined by capillary electrophoresis [13,22]. Nevertheless, in a recent study reported that Dnmt2 controls DNA methylation in early D. melanogaster embryos and provide insight into its function in control of retrotransposon silencing and telomere integrity in somatic cells [23]. This report showed a clear-cut difference of methylation within Invader4 elements LTRs between wild type and Dnmt2-/- ﬂies [23]. Dnmt2 appears to mediate methylation on D. melanogaster embryos genome, even though both this activity and its functional consequences remaining poorly understood. However, a recent study showed that cytosine methylation in the genome of Drosophila melanogaster probably is independent of Dnmt2 activity [24]. These findings show how elusive is the genomic methylation context in drosophilids.

Previous studies reported by our research group in the neotropical D. willistoni and its related species (willistoni subgroup) shows a distinct scenario. Adult flies show sex-specific patterns of rDNA genes investigated by Methylation Restriction Sensitive Endonucleases [15,25]. Comparisons of D. willistoni and D. melanogaster Dnmt2 protein sequences indicated higher primary structure conservation on motifs responsible for the catalysis of methyl transfer and great variability in the region related to speciﬁc recognition of target DNA sequences. These outcomes from the willistoni subgroup species are encouraging due to the previously reported peculiarities of this species when compared to other species of the Drosophila genus that have their genomes sequenced [26]. D. willistoni singularities correspond to overall genome size, distribution of transposable element classes, patterns of codon usage, dot chromosome lacking and unclear phylogenetic clustering placement, among others [26–28].

In addition to the peculiarity of having sex-specific methylation [15,25], D. willistoni is known to have extensive gene arrangement polymorphisms on all chromosomes [29–32] as observed from chromosomal variability in natural populations. Because of the high rate of intraspecific polymorphism and and a deep evolutionary time that separates D. willistoni from the other species of Drosophila 12 Genomes Project, several methods of analysis have demonstrated difficulty in establishing the correct phylogenetic positioning of this clade [33]. The ambiguity arises as a consequence of the elevated level of sequence and gene-order evolution that leads to a significantly long lineage leading to D. willistoni. Most phylogenetic reconstruction software tends to force D. willistoni as an outgroup, based on the high evolutionary rates. In light of these reasons, studies are needed to map more genes in the genome of D. willistoni in order to elucidate the discrepancies found in the previous reports. New approaches, using an additional marker will not only identify more genes to confirm the ordering of scaffolds assembled so far but will also facilitate further comparative studies by increasing the database from this species.

To improve the Dnmt2 knowledge about its biological function and importance, more assays for characterization and detection of Dnmt2-dependent DNA/RNA methylation will have to be established. Genomic DNA methylation patterns need to be characterized mostly in “Dnmt2-only” model systems, like Drosophila. In the present study, we detected and quantified the expression of D. willistoni Dnmt2 in different development stages. Accordingly, we also detected the expression of Dnmt2 on oogenesis and embryogenesis, indicating a possible contribution of Dnmt2 expression during development. In addition, we localized Dnmt2 homologs on polytene chromosomes of D. willistoni and we attempted to establish cause and/or effect relationships for the exact location of the gene with its adjacent sites and possible activity modulated by position.

Detection of Dnmt2 transcripts by Reverse Transcription PCR (RT-PCR)

RNA was obtained from D. willistoni adult males, adult fertilized females, adult females without ovaries, pupae, larvae and 0-3h dechorionated embryos using Trizol, according to the manufacturer's protocol (Invitrogen). Extracted RNA was further treated with DNaseI (Promega) to eliminate DNA contamination. cDNA synthesis was performed using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) with random primers. After cDNA synthesis, Dnmt2 fragment was amplified by PCRs with the following primers wDnmt2AF: 5’-CAGGCTCGCCAACAGTTTAT-3’ and wDnmt2BR: 5’-CCTTGTCCTTGCGTGCTAAA-3’. Primers were designed based on the D. willistoni Dnmt2 sequence [15]. The PCR reaction was performed in 25μL reactions using 20ng of cDNA, 1U Platinum Taq DNA Polymerase (Invitrogen), 1x reaction buffer, 200μM dNTPs, 20pmol of each primer and 1.5mM MgCl2. The ampliﬁcation conditions were 95°C for 5 min and 30 cycles of 95°C for 40s, 55°C for 40s and 72°C for 1 min, followed by a ﬁnal extension cycle at 72°C for 5 min. A fragment of 280 bp was expected as a result of the amplification reactions. The 𝛽-actin housekeeping gene was used as a control for ampliﬁcation. PCR products were verified by electrophoresis on a 1% agarose gel and stained with GelRed GelRed™ (Sigma-Aldrich).

Expression analysis by Quantitative Real-Time PCR

The relative abundance of D. willistoni Dnmt2 mRNA transcripts was measured by quantitative real-time PCR (qPCR) using an Applied Biosystems (ABI) 7500 Real-Time PCR System with the same primers of conventional RT-PCR (Dnmt2 and 𝛽-actin gene). Samples of cDNA from D. willistoni, produced as previously described, were used. The qPCR conditions were: 94°C for 5 min followed by 40 cycles at 95°C for 15s, 60°C for 10s, 72°C for 15s and 35s at 60°C to measure fluorescence. Next, samples were heated from 55ºC to 99°C at a 0.1°C/s temperature gradient to construct the denaturation curve of the ampliﬁed products. Relative quantiﬁcations of ampliﬁed products were made by the 2−ΔΔCt method [34] and Ct values were obtained in the SDS software. SYBR-green (Molecular Probes) was used to detect ampliﬁcation and to estimate Ct values, as well as to determine speciﬁcity of the amplicons by denaturing curves and melting temperatures (Tm). The 𝛽-actin gene was used as the internal control gene for all relative expression calculations.

Inspecting Dnmt2 mRNA transcripts by in situ hybridization in embryos

For Dnmt2 riboprobe synthesis, the fragment of 949-bp of the gene was obtained from genomic DNA of adult flies by PCR using the primers wDnmt2C-F: 5’ TCACCCACAACCTTGACATT 3’ and wDnmt2D-R: 5’ ACCTTCTCGCAGACACCAA 3’. Resulting PCR products were cloned into pCR4-TOPO vector (Invitrogen) and submitted to automatic nucleotide sequencing performed by Macrogen Inc. (Korea), to assign insert orientation. Resulting plasmids were then linearized according to the vector map and digoxigenin-labeled using a DIG-labeled dNTP mix (Roche). The antisense riboprobe was labeled by T3 RNA Polymerase in vitro transcription of the NotI-linearized plasmid. In situ hybridization assays were performed in embryos collected in different developmental stages [35]. Prior to in situ hybridization, probes (200ng in 50μL) were mixed with in situ hybridization solution as follows: 50% formamide, 5x SSC, 100μg/mL of herring sperm DNA, 50μg/mL of heparin and 1% of Tween 20. The hybridization mixture was added to the embryos at 55 °C and incubated overnight. After hybridization embryos were washed several times with PBS and color development was performed with BCIP/NBT 75 (Promega). Embryonic stages were identiﬁed according to the outlined criteria [36].

Physical mapping of Dnmt2 gene

Non-fluorescent in situ hybridization technique for the precise location of Dnmt2 sequences in polytene chromosomes of D. willistoni was used since it allows better visualization of the banding patterns and is recommended for precise physical mapping [26]. DNA probe of Dnmt2 of D. willistoni was constructed from a fragment of 949 bp cloned into the vector TOPO PCR-4 (Invitrogen). The probe was obtained by PCR, from the sequenced Gd-H4-1 line, as well as the photos of the polytene chromosomes. The probe was labeled with a Biotin PCR Labeling Core Kit (Jena Bioscience) following the manufacturer instructions, with minor adjustments. The labeled products were purified with a NucleoSpin Gel and PCR Clean-up Kit (MACHEREY-NAGEL). Vectastain Elite ABC (Vector Laboratories) and DAB Substrate (Roche) performed the detection and revelation of hybridization signals, respectively. Slides were stained with Giemsa solution (5%) and coverslips were assembled with Entellan (Merck). Polytene chromosomes images were acquired in phase contrast photomicroscope and analyzed according to the photomap of D. willistoni [33].

Transcriptional expression of D. willistoni Dnmt2 is developmental delimited

We performed RT-PCR analysis to verify the levels of Dnmt2 transcriptional expression. The expression of Dnmt2 transcripts was detected for all cDNA samples used: D. willistoni adult males, females, females without ovaries, pupae, larvae, and 0-3h dechorionated embryos. The amplification of a single fragment with an expected size of 280 bp, corresponding to processed mRNA, confirmed the absence of genomic DNA contaminants in all samples (Figure 1). In order to infer the amount of Dnmt2 transcripts at different stages of development and samples analyzed, further investigations were carried out by qPCR.

The qPCR showed that Dnmt2 expression has different levels along D. willistoni development (Figure 2). The analysis showed a pattern of Dnmt2 expression where embryos rank higher than the other developmental stages (approximately 2 to 3-fold). The Dnmt2 transcription decreases along the development, although the adult stages showed a slight increase. Females, females without ovaries and males showed no substantial differences between the levels of Dnmt2 expression.

Dnmt2 transcripts follow the dynamics of embryonic development

In situ hybridization experiments were conducted at different developmental oogenesis and embryogenesis stages to determine the spatial and temporal pattern of the Dnmt2 transcriptional expression of the D. willistoni. Initially, the Dnmt2 transcripts were detected as uniform and widespread in all stages of oogenesis (Figure 3). The staining pattern indicates early expression at the anterior end and in the ventral position of the oocyte (Figure 3A-3H).

In the initial embryonic developmental stages, Dnmt2 transcripts appear as superficial and later as diffuse internal granules, a pattern similar to those found in maternal transcripts (Figure 4A-4C). This pattern persists until the cellular blastoderm stage. Throughout development, Dnmt2 transcripts accumulate at the embryonic ventral periphery (Figure 4D), and subsequent expression can be detected on the anterior portion, coinciding with the moment when the cephalic furrow is formed (Figure 4E). The expression of Dnmt2 was detected from the cephalic region expanding through the ventral region to the embryo’s posterior pole (Figure 4F-4H). The anterior and posterior expression levels of staining decreased and became a basal signal from then on (Figure 4I). During late embryogenesis, at the germ-band retraction stage, transcript accumulation persisted as a basal expression in the ectoderm layer.

The Dnmt2 gene resides in the arm IIL of the D. willistoni chromosome

The location of the probe hybridization signal was determined to be at the distal region of the chromosome II left arm (IIL), specifically in section 55C (Figure 5A and 5B). The IIL arm of D. willistoni corresponds to the Muller B element, according to a previous study [37]. On FlyBase search tool [38], we could verify that in the other eleven species (D. melanogaster, D. simulans, D. sechellia, D. erecta, D. yakuba, D. ananassae, D. pseudoobscura, D. persimilis, D. virilis, D. mojavensis, and D. grimshawi) whose genomes are available, the sequences homologs to Dnmt2 are also localized on B element.

Drosophila are so-called ‘‘Dnmt2-only’’ organisms, that is, they do not have any of the canonical DNA methyltransferases (Dnmt1 and Dnmt3). DNA methylation was also observed in other ‘‘Dnmt2-only’’ organisms, especially in other dipterans, though direct evidence of Dnmt2 involvement is still enigmatic. Interestingly, there is a diverse group of animal species that have retained Dnmt2 as their only DNA methyltransferase candidate, like Schizosaccharomyces pombe, Dictyostelium discoideum, Entamoeba histolytica, Schistosoma mansoni, and D. melanogaster. For instance, about 1 in 600 (0.17%) cytosine nucleotides are methylated in the DNA of the Aedes albopictus mosquito [39]. However, although such species have genomic methylation, this is still at low global levels and Dnmt2 biological function has been fervently discussed [40,41].

There are accumulating findings that instigate investigations in “Dnmt2-only” organisms, such as female-specific DNA methylation that was reported for D. willistoni and related species [15,25]. Recently, males that have reduced expression of dMBD-R2 (a methylated cytosine binding protein), specifically octopamine (equivalent to norepinephrine) neurons, have exhibited mating behavior toward divergent interspecies such as D. virilis and D. yakuba and a decrease in the success of co-specific mating [17]. These data strongly suggest the existence of methylation-dependent chromatin structures in Drosophila, that is, the role of methylation of genomic cytosines appears to be fundamental at various levels in these organisms. Thus, Dnmt2 studies is of great importance towards a better understanding of DNA and RNA methylation in ‘‘Dnmt2-only’’ systems, whose data are still vastly controversial and uncertain.

Our quantitative analyses on different development stages showed differences in Dnmt2 expression (Figure 2), with the highest expression being observed in embryos, in the D. willistoni, in which Dnmt2 expression was 2-fold higher than in the larvae stage. Essentially, on Drosophila genus, DNA methylation is described as predominant during embryonic development. In D. melanogaster, the DNA methylation is prevalent in young (1–2 h) embryos, but less marked in older (15–16h) embryos and only trace amounts of 5-methylcytosine were found in isolated ovaries (oocytes), and Dnmt2 transcripts present similar levels corresponding to DNA methylation stages [12]. The data herein showed a very close pattern of Dnmt2 expression in D. willistoni, similar to previously founded in D. melanogaster. Interestingly, the Dnmt2 expression in females and males of D. willistoni revealed a slightly higher value when compared with the pupae stage, and this relative expression levels in the D. willistoni adults are higher than what is found in D. melanogaster adults (Figure 2) [12]. Thus, this Dnmt2 expression can be relevant, since recently we had reported evidence of DNA methylation in adult flies of D. willistoni and closely relates species [15,25].

Employing whole D. willistoni embryos hybridization with Dntm2 riboprobe, we could observe transcriptional expression along different embryonic stages. The oocytes showed the most prominent hybridization signals, suggesting a higher activity of the enzyme on this stage of oogenesis (Figure 3). The early stages of embryogenesis (Figure 4) showed hybridization staining with distinct patterns, in which the expression pattern seems to decrease from syncytial blastoderm to late development. Interestingly, the expression patterns ranged from a granular composition throughout the whole embryo on syncytial blastoderm to a peripheral occurrence on cellular blastoderm. During gastrulation, we observed that the Dnmt2 expression seems to suffer compartmentalization from the anterior portion in the ventral region, reaching the posterior portion. Moreover, it showed only a fading basal signal in the head region and in the position of the developing central nervous system (CNS). All the presented results with embryos of D. willistoni are in agreement with those previously found concerning the genomic DNA methylation that predominates during early embryonic development and decreases at later stages [12], presumably as a result of reduced methyltransferase expression.

The importance of DNA methylation in Drosophila still is an elusive case, and there are some attempts to understand the biological function in Drosophila genomes. However, when we are talking about a genus with more than 4.000 species, peculiarities may arise, like the sex-specific methylation described in D. willistoni [15,25], so generalization must be avoided. It was observed that overexpression of D. melanogaster Dnmt2 results in an extended fly life span and in overexpression of several genes [42]. Also, it is discussed whether Dnmt2 acts as DNA or tRNA methyltransferase. If Dnmt2 was described associated to a nuclear matrix, and if Drosophila is a “Dnmt2-only” organism, and if D. willistoni has sex-specific methylation in its genome, we cannot deny that the evidence suggests a duality in the activity of that enzyme in these organisms. The peculiarities of Dnmt2 enzyme rise in different organisms; in humans, for example, it is located in cytoplasmic regions [43], whereas in Dyctiostelium discoideum and Entamoeba histolytica, Dnmt2 is located only in the nuclear matrix [27,44], and guaranteeing the structural integrity of chromatin and silencing retrotransposons in Drosophila [23]. Generating Dnmt2 null mutations allowed us to correlate loss of DNA methylation, identified in early D. melanogaster embryos by bisulfite sequencing and restriction enzyme analysis. Besides that, these results suggest the Dnmt2-dependent DNA methylation during early embryonic development of D. melanogaster has a key function in control of retrotransposon silencing in somatic cells, specifically as an initial step of the process [23]. This feature contrasts with the high local specificity of the Dnmt1 and Dnmt3 to the cell nucleus region.

On the other hand, the HIV virus is able to increase its survival in the host cell using the RNA methylation activity of Dnmt2, increasing the stability of its own genome. Through infection, Dnmt2 relocates from the nucleus to the cytoplasmic stress granules and methylates the RNA virus, promoting the post-transcriptional stability of viral RNA [45]. RNAs interference (RNAi) have a strong association with different epigenetic mechanisms, such as histone methylation/acetylation and genomic DNA methylation [46]. Double-stranded RNAs (dsRNA) trigger the process of post-transcriptional homology-dependent gene interference (RNAi) closely related to the co-suppression of viral exogenous transcripts. The dsRNAs are processed by a Dicer family of enzymes into small dsRNA sequences having 21-25 nucleotides, termed small interfering RNAs (or siRNAs). Interestingly, it is known that Dnmt2 also interacts with Dicer-2 in response to heat shock treatments [47,48], controlling the expression and regulation of various Heat Shock proteins [49–51]. Finally, the activity of Dnmt2 in conjunction with NSun2 is important to promote the stability of tRNAs and protein synthesis [52]. That is, we can assume that the Dnmt2 has a multilevel biological role, inserted in an extensive network of interactions in the genetic machinery of the gene expression control.

In the present study, we performed the in situ localization of the D. willistoni Dnmt2 (Figure 5). The gene is located in the arm IIL (Muller B element), like in D. melanogaster and D. pseudoobscura, where it was possible to ascertain the position of the gene, it is present in B element. This is a very important aspect because we present here the determination of another gene marker in D. willistoni, following previous work [37], which will help in the organization of the D. willistoni scaffolds regarding the physical position of the genes in the chromosomes.

Surprisingly, D. willistoni Dnmt2 is found in the subtelomeric region of the chromosome IIL (Muller B element), whereas D. melanogaster and D. pseudoobscura Dnmt2 are found, approximately, in the central region of the chromosome IIL (Muller B element) (Figure 6). Most likely, the differences found for the Muller element and the location of the Dnmt2 in the chromosome are related to translocation events followed by breakage and inversion of the region where the gene is found.

It is known that heterochromatin regions (centromeric and telomeric) have different patterns of evolution than those found in the euchromatin regions (gene-rich). Comparative analyses between telomeric regions of humans and chimpanzees have shown that both are very distinct, in that the human chromosomes present a large scale of rearrangements and differences in the repetitive elements present [53]. Interestingly, the chromosome ends in Drosophila melanogaster have the peculiarity of presenting transposable elements (HeT-A and TART) [54–57], contrasting with the human chromosome ends that are structured from the activity of the enzyme telomerase. Another interesting aspect is that most-distal regions of Drosophila subtelomeres seem to evolve rapidly between Drosophila melanogaster and its close relatives, D. simulans and D. yakuba [58]. In this region, the mutation rate of the most-distal portion is so high that the structure is likely to be different among cells of the same individual [59]. However, what is observed in terms of recombination in the telomeric regions of Drosophila melanogaster is that there is a great suppression of crossing over events, within and in regions proximal to the telomeres [60]. These aspects are in agreement with previous findings of our research group, in which D. willistoni Dnmt2 shows the highest rate of nucleotide substitution per codon in relation to the other drosophilids and different selective pressures at specific sites involved in an interaction-driven co-evolution with other genes [61].

CONCLUSION

Epigenetic mechanisms are fundamental in the coordination of the ontogeny of organisms and in the intermediation of information from the environment to the nucleus and from the nucleus to the environment. The understanding of such mechanisms is of paramount importance in order to understand the ecological, physiological and evolutionary aspects of the different species. Among the epigenetic phenomena, cytosine methylation is the most widely studied and known. However, its role is still elusive in organisms known as "Dnmt2-only", among them Drosophila.

In the present work, we verified that the expression of Dnmt2 in D. willistoni is closely related to its ontogenetic stages. In addition, it has been found that expression levels in adults of D. willistoni Dnmt2 are apparently slightly higher than in D. melanogaster. It is suggested, therefore, that this difference may be closely related to the phenomenon of sex-specific methylation, a peculiar and restricted phenomenon to the species of the subgroup willistoni. We also conduct the in situ localization of the Dnmt2 gene, revealing its presence in the arm IIL (Muller B element). The Dnmt2 is located in the subtelomeric region, and this brings up a series of issues that involve the peculiar characteristics of D. willistoni Dnmt2 enzyme, like evolutionary pattern in nucleotide substitutions rates [61], the high prevalence of basic amino acids residues in its target recognition domain surface [62] and the epigenetic phenomena of sex-specific methylation [15,25].

With that, fortunately further questions are being raised about such peculiarities in this unique group of Neotropical species which are D. willistoni. Future studies are needed for a more in-depth understanding of the importance of sex-specific methylation in development and survival, as well as the impact related to the subtelomeric position occupied by the Dnmt2.

tRNA: transfer ribonucleic acid; mRNA: messenger ribonucleic acid; rRNA: ribossmal ribonucleic acid; DNA: deoxyribonucleic acid; C: cytosine; G: guanine; A: adenine; T: thymine; Dnmt: DNA methyltransfarese; CpG: Cytosine-phosphate-Guanine; CpA: Cytosine-phosphate-Adenine; CpC: Cytosine-phosphate-Cytosine; RT-PCR: reverse transcription polymerase chain reaction; cDNA: complementary DNA; qPCR: quantitative polymerase chain reaction; CNS: central nervous system; HIV: human immunodeficiency virus; RNAi: RNA interference; dsRNA: double-stranded RNA; siRNA: small interfering RNA

Acknowledgements

We thank the Genetics Department of the Universidade Federal do Rio Grande do Sul for their support. We thank the Dr Rogério Margis for qPCR instrumental and support. We thank all Drosophila Laboratory colleagues for their valuable discussions and conversations.

Funding

This study was supported by grants and fellowships from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Fundação de Amparo à Pesquisa do Estado do Rio Grande do Sul (FAPERGS) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES).

Availability of data and materials

All the data supporting the results of this article are included within the article. All data can be provided by request.

Authors’ contributions

GCV, MFD and MD conceived the project and designed the experiments. GCV, RZ and PSO conducted the RT-PCR and qPCR analysis. CFG and GCV conducted the in situ hybridization analysis. MD and GCV conducted the in situ hybridization in oocytes and embryos analysis. VLSV provided expertise and feedback. GCV, CFG and RZ wrote the manuscript with input from all authors. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

1. Li S, Mason CE. The Pivotal Regulatory Landscape of RNA Modifications. Annu Rev Genomics Hum Genet. 2014;15: 127–150. doi:10.1146/annurev-genom-090413-025405

2. Cheng JX, Chen L, Li Y, Cloe A, Yue M, Wei J, et al. RNA cytosine methylation and methyltransferases mediate chromatin organization and 5-azacytidine response and resistance in leukaemia. Nat Commun. Springer US; 2018;9: 1–16. doi:10.1038/s41467-018-03513-4

3. Klose RJ, Bird AP. Genomic DNA methylation: The mark and its mediators. Trends Biochem Sci. 2006;31: 89–97. doi:10.1016/j.tibs.2005.12.008

4. Zhao BS, Roundtree IA, He C. Post-transcriptional gene regulation by mRNA modifications. Nat Rev Mol Cell Biol. Nature Publishing Group; 2016;18: 31–42. doi:10.1038/nrm.2016.132

5. Bird A. DNA methylation patterns and epigenetic memory. Genes Dev. 2002;16: 6–21. doi:10.1101/gad.947102

6. Lee T -f., Zhai J, Meyers BC. Conservation and divergence in eukaryotic DNA methylation. Proc Natl Acad Sci. 2010;107: 9027–9028. doi:10.1073/pnas.1005440107

7. Jin B, Li Y, Robertson KD. DNA methylation: Superior or subordinate in the epigenetic hierarchy? Genes and Cancer. 2011;2: 607–617. doi:10.1177/1947601910393957

8. Goll MG, Bestor TH. Eukaryotic cytosine methyltransferases. Annu Rev Biochem. 2005;74: 481–514. doi:10.1146/annurev.biochem.74.010904.153721

9. Schaefer M, Lyko F. DNA methylation with a sting: An active DNA methylation system in the honeybee. BioEssays. 2007;29: 208–211. doi:10.1002/bies.20548

10. Elango N, Hunt BG, Goodisman MAD, Yi S V. DNA methylation is widespread and associated with differential gene expression in castes of the honeybee, Apis mellifera. PNAS. 2009;106: 11206–11211.

11. Wang Y, Jorda M, Jones PL, Maleszka R, Ling X, Robertson HM, et al. Functional CpG methylation system in a social insect. Science. American Association for the Advancement of Science; 2006;314: 645–7. doi:10.1126/science.1135213

12. Lyko F. DNA methylation learns to fly. Trends Genet. 2001;17: 169–172. doi:10.1016/S0168-9525(01)02234-X

13. Kunert N, Marhold J, Stanke J, Stach D, Lyko F. A Dnmt2-like protein mediates DNA methylation in Drosophila. Development. 2003;130: 5083–5090. doi:10.1242/dev.00716

14. Lyko F, Whittaker AJ, Orr-Weaver TL, Jaenisch R. The putative Drosophila methyltransferase gene dDnmt2 is contained in a transposon-like element and is expressed specifically in ovaries. Mech Dev. 2000;95: 215–217. doi:10.1016/S0925-4773(00)00325-7

15. Garcia RN, D’Ávila MF, Robe LJ, Loreto ELDS, Panzera Y, De Heredia FO, et al. First evidence of methylation in the genome of Drosophila willistoni. Genetica. 2007;131: 91–105. doi:10.1007/s10709-006-9116-3

16. Panikar CS, Rajpathak SN, Abhyankar V, Deshmukh S, Deobagkar DD. Presence of DNA methyltransferase activity and CpC methylation in Drosophila melanogaster. Mol Biol Rep. Springer Netherlands; 2015;42: 1615–1621. doi:10.1007/s11033-015-3931-5

17. Gupta T, Morgan HR, Andrews JC, Brewer ER, Certel SJ. Methyl-CpG binding domain proteins inhibit interspecies courtship and promote aggression in Drosophila. Sci Rep. Springer US; 2017;7: 1–12. doi:10.1038/s41598-017-05844-6

18. Breiling A, Lyko F. Epigenetic regulatory functions of DNA modifications: 5-methylcytosine and beyond. Epigenetics and Chromatin. BioMed Central; 2015;8: 1–9. doi:10.1186/s13072-015-0016-6

19. Li E, Zhang Y. DNA methylation in mammals. Cold Spring Harb Perspect Biol. 2014;6: a019133. doi:10.1101/cshperspect.a019133

20. Gowher H, Leismann O, Jeltsch A. DNA of Drosophila melanogaster contains 5-methylcytosine. EMBO J. 2000;19: 6918–6923. doi:10.1093/emboj/19.24.6918

21. Suzuki MM, Bird A. DNA methylation landscapes: provocative insights from epigenomics. Nat Rev Genet. Nature Publishing Group; 2008;9: 465–476. doi:10.1038/nrg2341

22. Mund C, Musch T, Strödicke M, Assmann B, Li E, Lyko F. Comparative analysis of DNA methylation patterns in transgenic Drosophila overexpressing mouse DNA methyltransferases. Biochem J. 2004;378: 763–8. doi:10.1042/BJ20031567

23. Phalke S, Nickel O, Walluscheck D, Hortig F, Onorati MC, Reuter G. Retrotransposon silencing and telomere integrity in somatic cells of Drosophila depends on the cytosine-5 methyltransferase DNMT2. Nat Genet. 2009;41: 696–702. doi:10.1038/ng.360

24. Takayama S, Dhahbi J, Roberts A, Mao G, Heo SJ, Pachter L, et al. Genome methylation in D. melanogaster is found at specific short motifs and is independent of DNMT2 activity. Genome Res. 2014;24: 821–830. doi:10.1101/gr.162412.113

25. D’Ávila MF, Garcia RN, Panzera Y, Valente VLS. Sex-specific methylation in Drosophila: An investigation of the Sophophora subgenus. Genetica. 2010;138: 907–913. doi:10.1007/s10709-010-9473-9

26. Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, et al. Evolution of genes and genomes on the Drosophila phylogeny. Nature. 2007;450: 203–218. doi:10.1038/nature06341

27. Schaefer M, Steringer JP, Lyko F. The Drosophila cytosine-5 methyltransferase Dnmt2 is associated with the nuclear matrix and can access DNA during mitosis. PLoS One. 2008;3. doi:10.1371/journal.pone.0001414

28. Vicario S, Moriyama EN, Powell JR. Codon usage in twelve species of Drosophila. BMC Evol Biol. 2007;7: 1–17. doi:10.1186/1471-2148-7-226

29. da Cuhna B, Dobzhansky T. A Further Study Of Chromosomal Polymorphism In Drosophila willistoni In Its Relation To The Environment. Evolution (N Y). 1954;8: 119–134.

30. da Cunha AB, Dobzhansky T. Adaptive Chromosomal Polymorphism In Drosophila willistoni. 1950; 212–235.

31. Valente VLS, Araújo AM. Chromosomal polymorphism, climatic factors, and variation in population size of Drosophila willistoni in southern brazil. Heredity (Edinb). 1986;57: 149–159. doi:10.1038/hdy.1986.105

32. Rohde C, Valente VLS. Three decades of studies on chromosomal polymorphism of Drosophila willistoni and description of fifty different rearrangements. Genet Mol Biol. 2012;35: 966–979. doi:10.1590/S1415-47572012000600012

33. Schaeffer SW, Bhutkar A, McAllister BF, Matsuda M, Matzkin LM, O’Grady PM, et al. Polytene chromosomal maps of 11 Drosophila species: The order of genomic scaffolds inferred from genetic and physical maps. Genetics. 2008;179: 1601–1655. doi:10.1534/genetics.107.086074

34. Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. Academic Press; 2001;25: 402–408. doi:10.1006/METH.2001.1262

35. Deprá M, Valente VLS, Margis R, Loreto ELS. The hobo transposon and hobo-related elements are expressed as developmental genes in Drosophila. Gene. Elsevier; 2009;448: 57–63. doi:10.1016/J.GENE.2009.08.012

36. Campos-Ortega JA, Hartenstein V. The Embryonic Development of Drosophila melanogaster [Internet]. Berlin, Heidelberg: Springer Berlin Heidelberg; 1985. doi:10.1007/978-3-662-02454-6

37. Garcia CF, Delprat A, Ruiz A, Valente VLS. Reassignment of Drosophila willistoni genome scaffolds to chromosome II arms. G3 Gene Genomes Genet. 2015;5: 2559–2566. doi:10.1534/g3.115.021311

38. Wilson RJ, Goodman JI, Strelets VB. FlyBase: Integration and improvements to query tools. Nucleic Acids Res. 2008;36: 588–593. doi:10.1093/nar/gkm930

39. Adams RLP, McKay EL, Craig LM, Burdon RH. Methylation of mosquito DNA. Biochim Biophys Acta - Nucleic Acids Protein Synth. Elsevier; 1979;563: 72–81. doi:10.1016/0005-2787(79)90008-X

40. Jeltsch A, Nellen W, Lyko F. Two substrates are better than one: dual specificities for Dnmt2 methyltransferases. Trends Biochem Sci. 2006;31: 306–308. doi:10.1016/j.tibs.2006.04.005

41. Krauss V, Reuter G. DNA Methylation in drosophila-a critical evaluation. Prog Mol Biol Transl Sci. 1st ed. Elsevier Inc.; 2011;101: 177–191. doi:10.1016/B978-0-12-387685-0.00003-2

42. Lin M-JJ, Tang L-YY, Reddy MN, Shen C-KKJJ. DNA methyltransferase gene dDnmt2 and longevity of Drosophila. J Biol Chem. 2005;280: 861–864. doi:10.1074/jbc.C400477200

43. Goll MG, Kirpekar F, Maggert KA, Yoder JA, Hsieh C-LL, Zhang X, et al. Methylation of tRNAAsp by the DNA methyltransferase homolog Dnmt2. Science (80- ). American Association for the Advancement of Science; 2006;311: 395–398. doi:10.1126/science.1120976

44. Kuhlmann M, Borisova BE, Kaller M, Larsson P, Stach D, Na J, et al. Silencing of retrotransposons in Dictyostelium by DNA methylation and RNAi. Nucleic Acids Res. 2005;33: 6405–6417. doi:10.1093/nar/gki952

45. Dev RR, Ganji R, Singh SP, Mahalingam S, Banerjee S, Khosla S. Cytosine methylation by DNMT2 facilitates stability and survival of HIV-1 RNA in the host cell during infection. Biochem J. 2017;474: 2009–2026. doi:10.1042/BCJ20170258

46. Volpe TA, Kidner C, Hall IM, Teng G, Grewal SIS, Martienssen RA. Regulation of Heterochromatic Silencing and Histone H3 Lysine-9 Methylation by RNAi. Science (80- ). 2002;297: 1833–1837. doi:10.1038/098448b0

47. Durdevic Z, Mobin MB, Hanna K, Lyko F, Schaefer M. The RNA methyltransferase dnmt2 is required for efficient dicer-2-dependent siRNA pathway activity in Drosophila. Cell Rep. The Authors; 2013;4: 931–937. doi:10.1016/j.celrep.2013.07.046

48. Durdevic Z, Schaefer M. TRNA modifications: Necessary for correct tRNA-derived fragments during the recovery from stress? BioEssays. 2013;35: 323–327. doi:10.1002/bies.201200158

49. Fisher O, Siman-Tov R, Ankri S. Pleiotropic phenotype in Entamoeba histolytica overexpressing DNA methyltransferase (Ehmeth). Mol Biochem Parasitol. 2006;147: 48–54. doi:10.1016/j.molbiopara.2006.01.007

50. Schaefer M, Pollex T, Hanna K, Tuorto F, Meusburger M, Helm M, et al. RNA methylation by Dnmt2 protects transfer RNAs against stress-induced cleavage. Genes Dev. 2010;24: 1590–1595. doi:10.1101/gad.586710

51. Thiagarajan D, Dev RR, Khosla S. The DNA methyltranferase Dnmt2 participates in RNA processing during cellular stress. Epigenetics. 2011;6: 103–113. doi:10.4161/epi.6.1.13418

52. Tuorto F, Liebers R, Musch T, Schaefer M, Hofmann S, Kellner S, et al. RNA cytosine methylation by Dnmt2 and NSun2 promotes tRNA stability and protein synthesis. Nat Struct Mol Biol. Nature Publishing Group; 2012;19: 900–905. doi:10.1038/nsmb.2357

53. Trask BJ, Friedman C, Martin-Gallardo A, Rowen L, Akinbami C, Blankenship J, et al. Members of the olfactory receptor gene family are contained in large blocks of DNA duplicated polymorphically near the ends of human chromosomes. Hum Mol Genet. 1998;7: 13–26. Available: http://www.ncbi.nlm.nih.gov/pubmed/9384599

54. Rubin GM. Isolation of a telomeric DNA sequence from Drosophila melanogaster. Cold Spring Harb Symp Quant Biol. 1978;42 Pt 2: 1041–6. Available: http://www.ncbi.nlm.nih.gov/pubmed/98261

55. Young BS, Pession A, Traverse KL, French C, Pardue ML. Telomere regions in Drosophila share complex DNA sequences with pericentric heterochromatin. Cell. 1983;34: 85–94. Available: http://www.ncbi.nlm.nih.gov/pubmed/6411353

56. Renkawitz-Pohl R, Bialojan S. A DNA sequence of Drosophila melanogaster with a differential telomeric distribution. Chromosoma. 1984;89: 206–11. Available: http://www.ncbi.nlm.nih.gov/pubmed/6425021

57. Traverse KL, Pardue ML. A spontaneously opened ring chromosome of Drosophila melanogaster has acquired He-T DNA sequences at both new telomeres. Proc Natl Acad Sci U S A. 1988;85: 8116–20. Available: http://www.ncbi.nlm.nih.gov/pubmed/3141921

58. Anderson JA, Gilliland WD, Langley CH. Molecular population genetics and evolution of Drosophila meiosis genes. Genetics. 2009;181: 177–185. doi:10.1534/genetics.108.093807

59. Roberts PA. Rapid change of chromomeric and pairing patterns of polytene chromosome tips in D. melanogaster: Migration of polytene-non-polytene transition zone? Genetics. 1979;92.

60. Lindsley DL, Sandler L, Counce SJ, Chandley AC, Lewis KR. The Genetic Analysis of Meiosis in Female Drosophila melanogaster [Internet]. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences. Royal Society; 1977. pp. 295–312. doi:10.2307/2417716

61. Vieira GC, D’Ávila MF, Zanini R, Deprá M, Valente VLS. Evolution of DNMT2 in drosophilids: Evidence for positive and purifying selection and insights into new protein (pathways) interactions. Genet Mol Biol. 2018;41. doi:10.1590/1678-4685-gmb-2017-0056

62. Vieira GC, Sinigaglia M, Vieira GF, Valente VLS. Linking epigenetic function to electrostatics: The DNMT2 structural model example. Dimitri P, editor. PLoS One. 2017;12: 1–19. doi:10.1371/journal.pone.0178643

Download PDF

Version 1

posted

You are reading this latest preprint version

Characterizing the transcriptional expression and in situ localization of the Dnmt2 gene in Drosophila willistoni

Status:

Version 1

Abstract

Figures

BACKGROUND

MATERIAL AND METHODS

RESULTS

DISCUSSION

Abbreviations

DECLARATIONS

REFERENCES

Status:

Version 1