Morphologic and anatomic response, catalase gene expression in drought varieties of tomato and bioinformatics analyses of microarray studies of the catalase gene

doi:10.21203/rs.3.rs-888851/v1

PDF

Research Article

Morphologic and anatomic response, catalase gene expression in drought varieties of tomato and bioinformatics analyses of microarray studies of the catalase gene

https://doi.org/10.21203/rs.3.rs-888851/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 16 Sep, 2021

You are reading this latest preprint version

Crops in arid and semi-arid regions are exposed to adverse environmental factors such as drought. Experiments were conducted to determine the morphologic and anatomic response of drought-susceptible and tolerant varieties of tomato (Solanum lycopersicum L.) under drought conditions (100%, 75%, 50%, 25% of field capacity). To investigate the role of antioxidant enzyme, catalase gene expression was examined by real-time RT-qPCR and microarray studies of the catalase gene in tomatoes under stress examined utilizing bioinformatics. The results showed significant morphological changes under drought conditions. Anatomical studies revealed that CaljN3 is more resistant than SuperstrainB varieties under drought stress. Relative expression of the CAT1 gene did not show any significant difference in both Caljn3 and SuperstrainB varieties based on quantitative Real-Time PCR, under drought stress. The bioinformatics results from microarray analysis revealed that this gene did not show a significant difference in expression in any of the cultivars and under any of the stresses. This gene is in the conserve cluster, a cluster with 118 members and a z score of 14.26148. This showed that this cluster is fully protected between two susceptible and tolerant varieties. The enrichment gene of this cluster did not show any significant intracellular pathways. It appears that in response to stress, an activating mechanism other than catalase is necessary. The fight against oxidative stress may begin one step before that of the enzymes and seeks to combat the stressor by activating proteins, especially channels, pumps and some cellular messengers.

Molecular Biology

Molecular Genetics

Abiotic stress

Anatomic

Catalase gene

Microarray

Tomato

Water deficit stress is considered one of the main barriers to the production of crops in many places around the world, especially in arid and semi-arid areas such as Iran. Aridity is the most prevalent environmental stress, which constricts almost 25 percent of the land on earth. More than half of the area of Iran is considered a part of semi-arid areas of the earth with rainfall of around 250 mm or less. Aridity is one of the most critical environmental stresses which affects morphological, physiological, and molecular processes, causing a lack of growth in plants (Mesgaran et al., 2017).

Tomato (Solanum lycopersicum L.) is the chief agricultural produce in many countries and is an essential contributor to human health. The plant is rich in vitamin A, C, and fiber and is cholesterol-free (Honson and Davies, 1971). It also has a considerable amount of lycopene, which is an essential carotenoid antioxidant protecting the cell from deleterious free radicals and preventing cancer (Gerster 1997).

Plants responded to water deficit by making morphological, physiological, and metabolic changes in all their organs. Some studies have shown that stress due to water deficit leads to a lack of growth in various parts of the plant, including roots, shoots, leaf area, height, and dry weight. A decrease in stomata closure during photosynthesis, and a decline in the levels of chlorophyll have also been observed (Hung et al., 2005). Plants make certain morphological and physiological changes to minimize damages caused by stress, and there is a remarkable diversity between the cultivated species and even members of the same species (Zhang et al., 2020).

Drought changes the metabolic process and function of some enzymes in plants and make some changes on the anatomical and morphological levels. One of the biochemical changes which occur due to the placement of plants in drought conditions is an increase in the production of free radicals of oxygen (ROS). Their toxic effects are neutralized by the plant’s antioxidant immune system (enzymatic and non-enzymatic). The degree of sensitivity to oxidative stress relies on the proportion of agents producing ROS and production of antioxidants in the plants (Nadarajah, 2020). ROS is very reactive and would destroy the natural metabolism of the plants in the absence of any defensive mechanism by oxidative damage to lipid, protein, and other macromolecules (Rout and Shaw 2001).

The structure of catalase (CAT) includes a tetrameric protein, porphyrin iron, and is considered one of the most important antioxidant enzymes. It prevents the harmful effects of hydrogen peroxide through degradation to water and oxygen. Catalase is found in all living organisms, including plant cells, animal cells, and aerobic microorganisms. In plants, catalase exists in peroxisomes, glyoxisomes, and mitochondria but does not exists in chloroplasts (Sarker and Oba, 2018).

Catalase performs a vital function in neutralizing H₂O₂, which is produced as a result of various processes such as electron flow in the mitochondrial electron transport chain, beta-oxidation of fatty acids and oxidation during photorespiration. Furthermore, the role of catalase in the immune system and the senescence phenomenon in plants has been proven (Mura et al. 2007). Catalase in animals is only coded by one particular gene, whereas in plants, a small gene family code the enzyme catalase. In Arabidopsis, a small family of proteins including CAT1, CAT2, CAT3 is coded by the catalase gene (CAT). These proteins have a vital function in neutralizing reactive oxygen species (Du et al. 2008). Based on studies performed on the Arabidopsis plant, it was shown that the expression of CAT2 and CAT3 is controlled by circadian rhythm with CAT2 being expressed in the morning and CAT3 in the evening (Micheal and McClung, 2002).

Selection of drought-tolerant plants and finding mechanisms that increase plant tolerance to drought are essential. The purpose of the current study is to measure changes in the morphological and anatomical characteristics of two varieties of tomato, one drought-susceptible and one drought-tolerant. The expression of catalase genes involved in the production of antioxidant enzymes was measured utilizing Quantitative real-time-PCR. Morphological and anatomical changes due to stress and the way in which the genes were expressed in different varieties was evaluated.

Microarray analysis is utilized in biology as a predictable tool for analyzing the number of transcripts (Trevino et al. 2007). One of the most useful and informative ways for analyzing different conditions of stress is to study transcripts (Shaik and Ramakrishna 2014). Microarray studies of plant genomes gives essential data to test the expression of some genes. This research seeks to study the effects of drought stress on the expression of catalase through real-time PCR. Bioinformatics data obtained from the tomato microarray was also analyzed.

2.1. Primary tomato seed cultures

Seeds from tolerant and susceptible varieties of tomato (CaljN3 and SuperstrainB) were germinated in pots containing sterilized sand. The sand was hydrated with distilled water every few days to prevent dehydration. After the emergence of early leaflets (20 days), germinated seeds were transferred to pots containing coco peat and perlite mix (70%-30%) which were washed with distilled water and wholly dried at ambient temperature before plant transfer.

2.2. Exposure To Salinity Stress

Leaflets were illuminated with a light (1 h, 21°C)/darkness (8 h, 18°C) cycle. For cultures, the Hoagland diet formula (pH 7 − 6) was utilized. After two weeks, salinity was applied (0, 200, 250, 300 mM NaCl). At the end of each week, the pots were utterly rinsed with distilled water, and saline treatments again applied. The plants were harvested after approximately four weeks of salinity stress and utilized for the various studies. Experiments were performed utilizing a completely random design with three repetitions.

2.3. Morphological And Anatomical Studies

Morphological parameters such as plant height, root length, fresh & dry weight of root and shoot and leaf area were measured. Different parts of the plant such as the internodes, roots and leaves (sixth internode, middle or apical leaflet in the seventh leaf, for roots two centimeters from the root cap) after fixing and sectioning (or cutting) were stained with safranin-fast green (Berlyn and Miksche 1976), and evaluated. The xylem was red and the rest of the cell content green.

2.4. RNA expression analysis by real-time RT-qPCR

Total RNA was extracted from frozen samples utilizing YTzol (Pure RNA isolation reagent) (Yekta Tajhiz Azuma Co., Iran) and stored at − 80°C. RNA was quantified at a wavelength of 260nm utilizing a Nanodrop spectrophotometer (NanoDrop 2000™, USA). RNA purity was determined from the Optical Density ratio (260/280 nm), which should be between 1.6 and 1.8.

First-strand cDNA was synthesized using RNA (8µg), Oligo-dt primer, and M-MLV reverse transcriptase. The PCR reaction was set up in a final volume of 25µl with 5µl cDNA (Yekta Tajhiz Azuma Co., Iran). Sequences of sense and antisense primers (Bioneer, Seoul, South Korea) for CAT₁ and ACT were designed utilizing Primer Express 3 software (ABI, USA). The sequence of the primers was as follows: CAT1: 5’- GCGACCAAGGATCTTTACGA − 3’, reverse: 5’- CAACACCAATCGACCAACTG − 3’, ACT: 5’-ATGCCTATGTTGGTGACGAG-3’ and 5’-CTCTGGAGCCACACGAAGT − 3’. The reaction conditions included an initial denaturation (5min, 95°C), followed by 40 cycles of (95°C, 1min; Tm of each primer 56–58–60, 45 Sections; 72°C, 1min), and a final 5min extension at 72°C. A reaction without cDNA was used as a negative control. PCR products were visualized on a 2% agarose gel.

Real-time PCR reactions were performed in a total volume of 20µl containing forward and reversed primers (100nM), cDNA (4µl), DNase free water (4.5µl) and 2x Syber Green qPCR Master Mix (10µl) (Yekta Tajhiz Azuma Co., Iran). The reactions were performed with the following settings: Pre-denaturation (8min, 95°C) followed by 40 cycles for 1min with duplicate reactions performed at 60°C for 15s. Reactions were performed in duplicate. Reactions without cDNA were performed in parallel as a negative control. qRT-PCR results were analyzed based on the ΔΔCt method, utilizing the Step One software 2.1. Relative quantification was performed according to the comparative 2ΔΔCt method as described previously (Pfaffl, 2001). To check the validity of the primer for the housekeeping gene (GAPDH) and PCS, amplification efficiencies were performed (Paff, 2001).

2.5. Statistical analysis

Data analyses were performed using the SPSS 20.0 software package (SPSS Inc., Chicago, IL, USA). All experimental data were presented as the mean ± SD. One-way ANOVA was used to test differences between various means, followed by the post hoc Tukey test. The level of significance was set at P < 0.05 for all tests.

2.6. Microarray Study

2.6.1. Collection of data

GPL4741 was obtained from the geodatabase containing 47 series and 744 samples. This particular GPL belongs to the [Tomato] Affymetrix Tomato Genome Array. Within the 47 series, four were associated with salinity, drought and heat stressors on the tomato plant. Samples were further subdivided based on plant sensitivity, tolerance or applied stressor, which resulted in the creation of 10 datasets (GSE16401-salt susceptible, GSE16401-salt-tolerant, GSE22304-SENSITIVE WATER, GSE22304-SUCEPTIBL HEAT, GSE22304-TOLERANT HEAT, GSE22304-TOLERANT WATER, GSE39894 susceptible water, GSE39894 tolerance water, GSE97045 WATER SENSITIVE, GSE97045 WATER tolerance).

2.69.2. Expression analysis

Each of the selected GSE (Gene Expression Omnibus (GEO) Series (GSE), was analyzed utilizing the ReadAffy function from the affy package followed by normalization with the RMA function. Probes identified with different expression patterns when exposed to stress were analyzed with the Limma package with significant probes having adjusted p values of less than 0.05 and a log fold change of > 2 or <-2.

2.6.2. Co-expression Data Analysis

Weighted gene co-expression network analysis (WGCNA) were utilized in deriving co-expression networks, followed by implementation in the R WGCNA package. The power of beta = 12 was chosen based on the scale-free topology criterion. The modules resulted in possessed genes that were significantly interconnected, thereby allowing the construction of two distinct networks, one that utilized tolerant samples, with the other only utilizing susceptible samples.

2.6.3. Module Preservation

Module preservation statistics in WGCNA was utilized to predict whether a particular module as defined in the reference data set (tolerant network) was also a part of the test data set (susceptible network). The significance of the preservation statistics as ascertained from _summary Eq. (2) takes into account several preservation statistics.

Based on the proposed thresholds from the first methodology proposal (Goldberg and Roth 2003), a _summary < two indicates no preservation, two < _summary < ten suggests weak to moderate preservation, with a _summary > ten suggesting vital module preservation. Intramodule connectivity or Kin is a measure given to each gene in a module. It shows how much the gene has relationship with other genes in the same module. Catalse’s Kins in both tolerant and susceptible groups was calculated to determine the difference.

3.1. Effects of drought-stress on morphometric features of varieties of tomato

Morphological results from the application of drought-stress to different varieties of tomato showed an effect on plant height, fresh & dry weight of tomato shoots. Plant height decreased substantially due to drought-stress. An increase in the level of drought decreased the height of both varieties. The most decrease was observed at the highest level of drought treatment. Of the two varieties, CaljN3 showed more tolerance than SuperstrainB at all levels of drought treatment. SuperstrainB is therefore the susceptible variety. In most cases, drought stress resulted in a decrease in leaf surface area. Decreasing the leaf surface area reduces transpiration and increases plant tolerance to osmotic stress conditions. Drought resulted in a decrease in leaf surface area for both varieties (Table 1).

Table 1

Effect of different levels of drought stress on morphologic features of root in CaljN3 and SuperstrainB varieties. Values with different letters are statistically significantlydifferent at p < 0.05.
Field capacity Parameters	Varieties	%100 FC	%75 FC	%50 FC	%25 FC
Shoot length (cm)	Calj N3	33.533 ± 0.838a	30.716 ± 1.943a	23.993 ± 2.523b	16.873 ± 0.997cd
Shoot length (cm)	Super strain B	24.21 ± 2.8b	18.473 ± 0.481c	17.2 ± 1.62c	13.61 ± 1.526d
Root length (cm)	Calj N3	32.086 ± 1.675a	27.993 ± 1.555a	22.736 ± 2.695b	18.57 ± 2.299c
Root length (cm)	Super strain B	23.06 ± 2.173a	19.99 ± 1.705b	14.916 ± 2.107c	10.953 ± 0.464c
Shoot fresh weight (g)	Calj N3	13.563 ± 1.356a	13.12 ± 1.235a	9.64 ± 0.998b	6.54 ± 0.822cd
Shoot fresh weight (g)	Super strain B	10.05 ± 1.62b	8.136 ± 1.06bc	7.363 ± 0.675c	4.883 ± 1.21d
Root fresh weight (g)	Calj N3	5.51 ± 1.366a	4.263 ± 1.077ab	3.703 ± 0.872bc	2.363 ± 0.556cd
Root fresh weight (g)	Super strain B	4.133 ± 0.978ab	3.286 ± 0.593bc	2.353 ± 1.049cd	1.06 ± 0.17d
Shoot dry weight (g)	Calj N3	1.22 ± 0.17a	1.15 ± 0.13a	0.843 ± 0.056bc	0.556 ± 0115de
	Super strain B	0.926 ± 0.125b	0.743 ± 0.12bcd	0.663 ± 0.05cd	0.43 ± 0.131e
Root dry weight (g)	Calj N3	0.506 ± 0.105a	0.468 ± 0.099a	0.355 ± 0.104ab	0.183 ± 0.072b
	Super strain B	0.396 ± 0.82a	0.295 ± 0.075ab	0.216 ± 0.104bc	0.079 ± 0.026c
Leaf area (mm²)	Calj N3	4018 ± 194.679a	3993.67 ± 273.876a	2873 ± 313.728b	1875 ± 232.265c
	Super strain B	3602 ± 276.005a	2541.33 ± 232.53b	2426 ± 297.542b	1767.33 ± 246.358c

Based on the data of the effect of drought stress on the average fresh & dry weight of roots, the average root weight decreased. The CalJN3 variety roots had the highest weight in drought stress conditions and had the lowest drought stress conditions. The dry & fresh weight of shoots in the SuperstrainB variety substantially decreased while the CaljN3 variety showed high tolerance against weight increase.

3.2. Effect of drought-stress on anatomical features of roots, stems and leaves in varieties of tomato

Anatomical studies of root from two centimeters upwards from the root cap showed that the diameter of the root does not differ substantially between the control plants and that of the treated plants. The number of dermis layers however increased in the treated plants. Cells within the dermis area in the control plants were well ordered and elongated decreasing in cell size towards the center. In drought stressed plants, cells within the dermis area appeared wrinkled and disordered. The epidermis was made of one cell layer, which was the same in both the control and drought stressed plants. In general, the diameter of the vascular cylinders in the roots of control plants was more extended than which was observed in drought stressed plants. The number of vessels in the roots of drought stressed plants increased. The diameter of metaxylem elements within the control plants of both varieties was greater than that observed in water stressed plants. The number of layers in the dermis and cell volume in water stressed plants for both varieties showed an increase in comparison to control plants. Comparative data showed that the epidermis in transversal sections of the internodes of CaljN3 & Super strainB varieties was made of one cell layer in both the control and water stressed plants. These cells differ in shape for the control versus the treated plants. In the control plants, epidermis cells were elongated and long. The epidermis of cells from the treated plants was not elongated and were thicker. On average the number of trichomes was higher in the treatment plants relative to the control. The vascular bundle in tomato is of the B collateral type. The number of vessels and vascular bundles in the treated plants increased. The diameter of vascular pores was wider in control plants relative to the treated plants. On the other hand, the thickness of the transversal wall of vessels in the treated plants was higher than that of the control due to high levels of lignin deposition. The pith area of the treated and control plants was the same. In general, the control and treated plants had a constant number of collenchyma layers. The size of the collenchyma cells was however more extensive in the controls and wall thickness was less. In drought stressed plants the size of the cells was small, with increased thickness. The size of cells within the dermis area was relatively larger in drought stressed plants. Anatomical studies of the leaf showed that tomato leaves have a structure like the typical dicot leaf with upper and lower epidermis being cuticular with stomata. Mesophyll tissue contained one layer of palisade parenchyma followed by spongy parenchyma tissue. The lower epidermis, which covers the lower surface of the leaf blade, had cutin, stomata, and trichomes. Palisade parenchyma and spongy parenchyma were completely distinguishable from each other. Under low intensity drought stress, the leaves were like that of the control plant. A comparison of a transversal section of control leaves and treated leaves showed that the vascular system in midrib and secondary veins were diminished. On average, for both varieties the diameter of vascular pores in treated plants was smaller than that of the controls, but the transversal walls of the vessels had high thickness. The distance between vascular bundles also decreased. Drought stress caused a decrease in the number of vessels in both varieties. Drought stress decreased the number of cells in the parenchyma under the midrib consequently decreasing leaf thickness in the midrib area for both varieties. In both varieties the concentration of palisade parenchyma in treated plants was more, and intercellular space less than that of the control. The size of palisade parenchyma changed in such a way that the length of palisade parenchyma cells decreased, but their diameter increased. Empty intercellular space within the spongy parenchyma cells decreased in treated plants relative to the control. The difference in growth and development between that of the control and treated plants is well visible, and in all cases, the control plants showed more growth in comparison to the treated plants (Fig. 1).

3.3. Effect of drought-stress on CAT1 gene expression in tomato varieties

A study of the relative expression of the CAT1 gene in two varieties of tomato in conditions of drought was conducted (Fig. 2). As is seen, in Fig. 2 the relative expression of the gene CAT1 did not show any considerable difference as the level of stress increased for both Caljn3 and SuperstrainB varieties. A comparison of the level of expression of the CAT1 gene in the two varieties revealed that expression of the gene CAT1 in Caljn3 and Superstrain3 in control conditions are similar. Likewise, for the treated samples expression of the gene CAT1 did not show considerable differences in both varieties (Fig. 2).

3.4. Bioinformatics Study Of Cat1 Gene Utilizing Microarray Analysis

In this study, Prob Id named Les.3098.1.S1_at was selected indicative of Cat1 in Solanum Lycopersicum with Gene ID 543990. Of the studied groups which were divided based on varieties and type of stress, the prob did not show any significant log fold change (Table 2). The gene located in the Salmon module, which is a cluster with 118 genes had a z score equal to 14.26. The Z score showed that this cluster was conserved between the susceptible and tolerant cultivars. Gene enrichment performed utilizing Kobas3 also did not show any pathway with a significant p value for the cluster. Table 3 shows that in both groups the average expression was just around 13, and the Kin did not differ. Genes representing the hub gene changed between the two tolerant and susceptible states in different clusters with a specific color. The Kin parameter was derived from the amount of hub gene and gene descriptions. Kin CI and kin MS are related to the tolerant and susceptible varieties, respectively.

Table 2

Catalase gene expression in microarray studies of different tomato cultivars under different stress conditions.
GSE ID	Cultivar/Genotype	Type of stress	Other characterization	Log fold change
GSE16401	Moneymaker	salinity	susceptible	-0.339588916
GSE16401	PI365967	salinity	tolerant	-0.235236336
GSE22304	Is not mentioned	drought	susceptible	0.840218131
GSE22304	Is not mentioned	drought	tolerant	0.75971927
GSE39894	S. lycopersicum	drought		0.399835513
GSE39894	S. pimpinellifolium	drought		0.182271858
GSE97045	S. lycopersicum, cv. P73	drought		0.143336524
GSE97045	S. pennellii (Sp) (acc. PE47)	drought		0.189479176
GSE22304	Is not mentioned	heat	susceptible	-0.22713333
GSE22304	Is not mentioned	heat	tolerant	0.97014

Table 3

Study of the hub gene of catalase, the results of which do not represent the hub gene change between the two tolerant and susceptible states in different clusters. The Kin parameter was derived from the amount of hub gene and gene descriptions.
Genes	Mean ExprCI		Mean ExprMS		Kin_CI		Kin_MS
543990	13.59782	13.62833		0.411476		0.53013

The study revealed that under drought stress there was a substantial decrease in length, fresh weight and dry weight of the roots for both varieties. Research has shown that with sufficient moisture root growth increased and that by going away from the optimal amount of moisture root growth decreased. Asang et al. (1998) reported a decrease in root growth and growth limitations in upper layers of the soil due to water deficit. In low irrigation, less moisture is around the root. This results in mechanical resistance of the soil against root development and, as a result, a reduction in the length and density of the root in common irrigation treatments. With sufficient irrigation, water is more reserved in the root area and the plant by condensing its roots make better use of water. As a result, acceptable use of water in this treatment was increased relative to low irrigation treatments. Plant growth is dependent on the supply of essential carbohydrates to stems and shoot. Factors limiting photosynthesis like light and water, in addition to decreasing plant function also decreases root growth. This is the main reason for the observed difference in the dry weight of the root in different treatments. Plants in dry environment prefer to deposit its photosynthetic production in the root and not in the stems and shoots as the plant can preserve its ability to absorb more amounts of soil water (Assenge et al. 1998). Tomato is susceptible to drought stress, and therefore, when applying stress, its vegetative growth and function decrease. Miguel and Francisco (2007) also reported a reduction in root growth, fresh weight and dry weight in tomatoes, which is comparable to the results of this study.

Plant growth under stress usually depends on roots ability to absorb water from the soil and transferring it to stems (Navarro et al. 2008). The intensity of root growth affects the shoot of a plant. Root length is an index for absorbing water from deep layers of soil (Franco et al. 2011).

Based on this study's results, drought stress caused a reduction in leaf surface in both CaljN3 and SuperstrainB varieties. In Farooqi et al.'s (1999) studies on Martini symbopogon, leaf area decreased in comparison to the control sample. Drought stress decreases leaf growth, and leaf area in a lot of species (Farooq et al. 2009). The production and expansion of leaves are very susceptible to water deficit. The reason for this is the essential need for cellular division and growth to turgor the pressure of cells which stimulating power is water (Pagter et al. 2005). Drought has a profound impact on the growth, production, and quality of the plant. The first impact caused by stress is a loss of turgor pressure, which affects the speed of cell expansion and final cell size. Turgor is a process which is very susceptible to drought stress. Its absence caused by stress will cause a reduction in the speed of growth, reduction of stem length, reduction of leaf expansion, and a reduction in stomata pores (Kumar and Purohit, 2001). Reduction of leaf growth induced by drought stress could be considered an adaptation response. Drought stress restricts leaf area and ultimately transpiration (Sikuku et al. 2010). Results from this study showed that drought stress caused a reduction in height, fresh and dry weight of shoot in both CaljN3 and SuperstrainB varieties. Hoseini et al. (1389), Jaafarabad et al. (1389), Mohammadi et al. (1390), and Dehghan et al. (1394) also reported a reduction in length, fresh and dry weight of shoot in tomato, which is comparable to the results of this study. In Mentha piperita (Simon & Alkire 1993), and Ocimum basilicum (Saleh & Reffat 1997), results similar to our study has been reported.

On the other hand, in the control and under stress conditions, shoot dry weight of in susceptible varieties was lower relative to tolerant varieties, which can be used as an index for selection of susceptible and tolerant varieties. The typical reaction of a plant to drought stress includes reducing stem growth and the size of the whole plant (Munns 2002). A decrease in leaf area causes a reduction in the receival of light and photosynthesis (Ourcut and Nilsen, 2000). Researchers also reported that water stress causes a reduction of shoot dry weight in plants and is reported in Vigna radiate, Cicer arietinum, Glycine max, Medicago sativa and Trifolium subterraneum (Mrema et al. 1997).

A reduction in photosynthesis, increased production of inhibitory substances, and a reduction in the levels of hormones during drought stress are possibly some of the reasons for decreased growth and shoot weight (Hayat & Ahmad, 2007). It is expected that under water deficit conditions, the absorption of nutritional substances decreases, transpiration is reduced which closes the stomata thereby preventing the entrance of carbon dioxide and reducing photosynthesis. These events cause a reduction in the growth and expansion of shoots in the plants. Water deficit causes a reduction of root and shoot growth. The reduction for the shoot is however greater than that of the root (KirnaK 2001).

The level of production of fresh and dry matter of plants has a strong co relation with leaf area and absorbed light. A reduction of each one of these indexes can reduce the fresh and dry weight of the plant. Continuous reduction of water in the soil, causes a reduction of leaf size and surface, and as a result, reduces the dry matter of the shoot (Wanldron et al. 1987).

Anatomical changes can occur in plants under water deficit. Some of these changes include increased lignification or suberin deposition in the cortex, endoderm cells, and cell layers that are near to cortex and medulla. Such changes protect cortex cells from death and drought (Mmostajeran et al. 2008).

In this study vessel diameter decreased for both tomato varieties which is comparable with the results of Claudio et al. (1998) in Vitis vinifera and also Babu et al. (2001) in Oryza sativa.

Reduction of vessel diameter, which is caused by an increase in lignification, shows the adaptability of a plant to stress conditions and the prevention of water wastage. Increased thickness of the transverse wall of vessels and a reduction in the diameter of the vessels, allows water to run through the vessels with greater speed. Other researchers who have studied the effects of drought and salinity stress have also reported a reduction of dermal parenchyma and a reduction of vessel diameter. The development of secondary structure is a kind of immune response of plants against stressful conditions and inappropriate environments. It has been observed that the tonality rate of lignified areas is much lower than that of the control plants, which can be as a result of increased polymerization of the lignin component. The number of vascular elements in the root, leaf and stem of treated plants tended to increase. A decrease can be justified and may serve as a mechanism for more water transportation and lower water loss. The number of layers and root volume of dermis cells in drought stress plants for both varieties increased as compared to the control plants. Cell shriveling was also observed. Dishevelment of dermal parenchyma cells in growing roots under drought conditions is a common observation in plants (Pena- Valdivia et al. 2010).

Tissues placed in water deficit conditions usually demonstrate a decrease in cell size and amount of vascular tissues. Cell wall thickness also increased. Under these conditions, processes corresponding to cell elongation are more vulnerable compared to processes related to cell division (Claudio et al. 1998).

In this study the number of parenchyma cells under the midrib decreased in both tomato varieties. The length of palisade parenchyma cells also decreased, which is comparable with the results of Eydie Najaf Abadi & Enteshari (1389). The space between spongy parenchyma cells seems to be beneficial for the prevention of water wastage. Blade thickness did not show any change in the tomato varieties studied. In a study of the effect of water stress on some varieties of avocado (Americana Persea), it was shown that palisade parenchyma and the total leaf thickness was lower than that of the control plants with an observable 35–45 percent reduction in intercellular space (Chartozoulakis et al. 1999). Reduction in blade thickness, palisade and spongy parenchyma in some species of Acacia auriculiformis under water deficit stress was reported by Liu et al. (2004). A leaf is considered a responsive organ to environmental conditions (Nevo et al. 2000) and among environmental factors that could potentially affect the structure of a leaf, certainly drought stress is one of the most important ones (Nardini et al. 2005). Changes in leaf anatomy in plants under stress could be related to reduced transportation via the stomata. A reduction of leaf expansion could be related to different mechanisms such as reduction in cell division (Granier et al. 2000), hardening of cell wall (Neumann 1995), or reduction of turgor pressure (Bouchabke et al. 2002).

Based on the results of this study, drought stress did not have a significant effect on the expression of the CAT1 gene in both tomato varieties. Relative gene expression was the same in CaLjN3 and SuperstrainB varieties. In some plants, changes in antioxidant enzyme function is a mechanism utilized by the plant to increase plant tolerance against stress. Several reports have documented that drought stress, high temperature and salinity causes an increase in SOD, APX, CAT and GR activity in tolerant wheat genotypes (Sairam et al. 2001). The level of antioxidant enzyme activity and levels of antioxidants during drought stress, is variable between plant species and even varieties of the same species (Bacelar et al. 2006; Bacelar et al. 2007). Changes in expression of the catalase enzyme during stress is dependent on the species. In some species an increase is observed whereas in other species there is a decrease (King et al. 1992).

In this study, expression of the gene CAT1 in drought stressed plants of the CaLjN3 variety did not increase when compared to control plants. Increased expression of the catalase gene in drought stressed tomatoes have been reported, which is comparable with the results of this study (Daneshmand et al. 2014). In rice seedlings water deficit stress has been found to increase the expression of all the enzymes that delete active oxygen, including CAT (Srivalli et al. 2003). Increased catalase function has been reported in Cathar anthus under salinity stress (Jaleel et al. 2007) as well as in Sesamum indicum (Koca et al. 2007). Decreased catalase expression has however been reported in wheat (Herbinger et al. 2002) and Arabidopsis (Jung 2004) undergoing stress.

In this study, we did not observe an increase in CAT1 gene expression in the CaLjN3 variety relative to the SuperstrainB variety despite the CaLjN3 variety being tolerant compared to SuperstrainB. Increased expression of the CAT1 gene has however been observed in drought stressed conditions for the more tolerant variety of Brassica napus, relative to the susceptible variety (Hosseini et al. 2015). The SuperstrainB variety, did not show decreased CAT1 gene expression compared to the control which shows that despite SuperstrainB being a susceptible variety, CAT1 inactivation, under drought stress conditions doesn’t occur due to the inhibition of enzyme synthesis or enzyme inactivation by radical oxygen, peroxide and hydroxyl ions (Hosseini Boldaji et al. 2012).

A study of antioxidant response and photosynthetic behavior of some algae under abiotic stress showed no significant increase of antioxidant enzyme activities, indicating that these antioxidant enzymes from algae persisted for some stress (Li et al. 2016). The impact of some stress on antioxidant systems of alfalfa did not have a significant effect on antioxidant activity and capacity of the alfalfa plant. The outcomes revealed that inoculation did not impose any significant effect on antioxidant activity (SOD, CAT, GPOX), and there was no significant change between inoculated and non-inoculated plants (Hosseinkhani Hezave et al. 2015). A study of the impact of salinity on oxidative stress in two Faba bean varieties did not show a significant effect on SOD activity in plant roots (Gaballah, Maybelle & Gomaa, Abu-Bakr, 2005). Also, in pea plants, APX activity did not show any significant changes under aluminum toxicity (Panda and Matsumoto, 2010).

Some soybean genotypes did not show any significant change in APX activity due to NaCl treatment as compared to the control. CAT and GR activity was not significantly affected by any level of NaCl treatment in some soybean genotypes (Faheema Khan et al., 2009). Study of Stress-Tolerant and Stress-Sensitive Potato Genotypes under stress suggested that the plants responded to potential increases in oxidative stress by altering antioxidant metabolism and activities of key antioxidant enzymes measured. Many other changes in activity were observed under stress. Antioxidant enzyme activities of the stress-sensitive genotype were moderately unaffected by stress treatment. Activities of ascorbate peroxidase, peroxidase, catalase, and superoxide dismutase did not change following heat and drought stress (Ufuk Demirel et al., 2020). Research conducted by Rizhsky et al. with the Double antisense method showed that the plant genome is a highly redundant and dynamic genome. In this research, plants lacking two significant enzymes, ascorbate peroxidase and catalase, stimulate an alternative/redundant defense mechanism that compensates for the lack of APX and CAT. It seems that the plant genome has a high ability to alter the degree of plasticity and will react contrarily to different stressful conditions, namely, lack of APX, lack of CAT, or a lack of both (Rizhsky et al., 2002).

Bioinformatics study of the catalase gene in microarray studies showed no significant difference in catalase gene expression in different tomato plants studied under salinity and drought stress. On the other hand, WGCNA results showed that this gene is in a fully conserved cluster. It does not show any difference between the susceptible and tolerant cultivars. The results of the enrichment gene showed that this gene does not guide any significant cell pathways. Gene hub studies for the catalase gene also indicated that this gene is a non-hub in microarray studies. Other studies show that in tomato drought and salinity treatments, rather than activating the catalase pathway, the cell process activates the SOS pathway of cells, pumps, carriers, and cellular messengers until they have an enzymatic response. Tomatoes seem to go one step further in response to stress oxidation and increased oxygen free radicals, activating enzymes other than catalase. Apparently, in this plant, the fight against oxidative stress begins one step before the enzymes and seeks to expel the stressor by activating proteins, especially channels, pumps and cellular messengers.

BR signaling activation adjusts the expression of genes involved in cell wall biosynthesis and remodeling and cell wall homeostasis through cell expansion in response to environmental stress (Sahni et al., 2016). Cellulose synthase-like protein encoded with SOS genes plays a role in response to osmotic stress tolerance in Arabidopsis (Zhu et al., 2010). The plasma membrane receptor kinase BRASSINOSTERIOID INSENSITIVE 1 (BRI1) after connecting to its co-receptor BAK1 upon successful recognition of BRI1-EMS SUPPRESSOR 1 (BES1) and BRASSINAZOLE-RESISTANT 1 (BZR1) transcription factors leads to expression of BR-responsive genes. BES1/BZR1 is controlled by the GSK3-like kinase BR-INSENSITIVE 2 (BIN2), a vital member of BR-associated signaling (Falkenstein et al., 2000).

Anatomic observations showed that drought stress causes a reduction in the diameter of vessels and increased thickness of transverse wall due to the deposition of lignin in leaves, internode, and root cells of both CaLjN3 and SuperstrainB varieties. Drought stress caused a reduction in the diameter of the vascular cylinder of roots and leaves an increase in the number of vessels in roots and stems and a reduction of them in the leaves, increased vascular bundle in the stem of both varieties, increased cell wall thickness of collenchyma cells and a reduction of their size in both varieties, increased number of layers and volume of dermis cells in the root of both varieties, decreased length of palisade parenchyma, increased diameter and decreased intercellular space in leaf tissue of treated plants and a reduction of morphological characteristics such as height, root length, leaf area, fresh and dry weight of root and shoot in both varieties of tomatoes.

Based on the morphological results the CaLjN3 variety is tolerant compared to SuperstrainB as it had the lowest reduction in fresh and dry weight of root and shoot. SuperstrainB showed lower tolerance to drought stress. CaLjN3 variety showed more tolerance with regards to a reduction of height compared to other variables. SuperstrainB is therefore considered the susceptible variety. CaLjN3 variety also showed moderate anatomic changes in comparison to the other variety. The results could be the reason for better growth of the CaLjN3 variety relative to the SuperstrainB variety under drought stress environments and justifies the anatomical and morphological differences observed Results obtained by quantitative real-time PCR technique showed that the CaLjN3 variety is considered the tolerant variety and that the level of expression of CAT1 gene is relatively equal to the susceptible variety, SuperstrainB.

Bioinformatics study of the catalase gene in microarray studies showed no significant difference in catalase gene expression in the different tomato plants studied under abiotic stresses. On the other hand, WGCNA results showed that this gene is in a fully conserved cluster without any variance between susceptible and tolerant cultivars and lacking any significant cell pathways in enrichment gene study. Gene hub studies on the catalase gene also indicated that this gene is a non-hub from microarray studies. It seems that in some cases tomatoes undergoing abiotic stress instead of activating the catalase pathway, the cell process activates other pathways such as SOS, pumps, carriers, and cellular messengers. Tomatoes seem to go one step further in responding to stress oxidation and increased oxygen free radicals, by activating mechanisms other than catalase. Apparently, in this plant, the fight against oxidative stress begins one step before the enzymes and seeks to expel the stressor by activating proteins, especially channels, pumps and cellular messengers.

Acknowledgments

We are grateful to the Research Council of Shahid Chamran University of Ahvaz for ﬁnancial support.

Competing interests

The authors declare that they have no competing interests.

Funding

Not applicable for that section.

Ethical approval

This article does not contain any studies with human participants performed by any of the authors.

Abedi T, Pakntyat H (2010) Antioxidant enzyme changes in response to droughtnstress in ten cultivars of oilseed rape (Brassica napus L.). Czech J Gen Plant Breed 16:27–34
Alkire BH, Simon JE (1993) Water management for Midwestern peppermint (Mentha piperita L.) growing in highly organic soil. Acta Hortic 344:544–556
Asseng A, Ritchia JT, Smuchker AJM (1998) Root growth and water uptake during water deficit and recovering in wheat. Plant Soil 201:265–273
Babu RC, SHashidhar HE, Lilley JM, Thanh ND (2001) Variation in root penetration ability, osmotic adjustment and dehydration tolerance among accessions of rice adapted to rain fed lowland and upland ecosystem. Plant Breed 120:233–238
Bacelar EA, Santos DL, Moutinho-Pereira JM, Goncalves BC, Ferreira HF, Correia CM (2006) Immediate responses and adaptive strategies of three olive cultivars under contrasting water availability regime: Change on structure and chemical composition of foliage and oxidative damage. Plant Sci 170:596–605
Bacelar EA, Correia CM, Moutinho-Pereira JM, Gonçalves B, Lopes JI, Torres- Pereira JM (2004) Sclerophylly and leaf anatomical traits of five field-grown olive cultivars growing under drought conditions. Tree Physiol 24:233–239
Bacelar EA, Santos DL, Moutinho-Pereira JM, Gonçalves BC, Ferreira HF, Correia CM (2006) Immediate responses and adaptative strategies of three olive cultivars under contrasting water availability regimes: changes on structure and chemical composition of foliage and oxidative damage. Plant Sci 170(3):596–605
Bacelar EA, Santos DL, Moutinho-Pereira JM, Lopes JI, Gonçalves BC, Ferreira TC, Correia CM (2007b) Physiological behavior, oxidative damage and antioxidative protection of olive trees grown under different irrigation regimes. Plant Soil
Bouchabke O, Tardieu F, Simonneau T (2002) Leaf growth and turgor in groming cell to maize (Zea mays L.) respond to evaporative demand under moderate irrigation but not in water saturated soil. Plant Cell Environ
Casano LM, Lascano HR, Trippi VS (1994) Hydroxyl radicals and a thylakoid bon end opeptidase are involved in light and oxygen induced proteolysis in at chloroplasts. Plant Cell Physiology 35:145–152
Claudio L, Andrea S (1998) Effects of water stress on vessel size and xylem hydraulic conductivity in Vitis vinifera L. Journal of Experimental Botany 49(321):693–700
Daneshmand F (2014) Response of antioxidant system of tomato to water deficit stress and its interaction with ascorbic acid. Iranian Journal of Plant Biology 6(1):57–72
Du YY, Wang PC, Chen J, Song CP (2008) The comprehensive functional analysis of catalase gene family in Arabidopsis thaliana. Journal of Integrativ Plant Biology 50:1318–1326
Faheema Khan TO, Siddiqi M, Altaf Ahmad (2009) Morphological changes and antioxidant defence systems in soybean genotypes as affected by salt stress. J Plant Interact 4(4):295–306. DOI:10.1080/17429140903082635
Falkenstein M, Hoormann J, Christ S, Hohnsbein J (2000) ERP components on reaction errors and their functional significance: a tutorial. Biol Psychol 51:87–107
Farooq M, Wahid A, Kobayashi N, Fujita D, Basra SMA (2009) Plant drought stress: effects, mechanisms and management. Agron Sustain Dev 29:185–212
Farooqi AHA, Fatima S, Ansari SR, Sharma S (1999) Effect of water stress on growth and essential oil metabolism in Cymbopogon martinii (Palmarosa) cultivars. J Essent Oil Res 11(4):491–496
Franco JA, Ban˜o´n S, Vicente MJ, Miralles J, Martı´nez-Sa´nchez JJ (2011) Root development in horticultural plants grown under abiotic stress conditions- a review. Journal Hortic Science Biotechnolgy 86:543–556
Gaballah M, Gomaa A-B (2005) Interactive effect of Rhizobium inoculation, sodium benzoate and salinity on performance and oxidative stress in two faba bean varieties. INTERNATIONAL JOURNAL OF AGRICULTURE & BIOLOGY, 8530. 7 – 3
Gerster H (1997) The potential rol of lycopene for human health. Journal of the American college Nutrition, 109–126
Granier C, Turco O, Tardieu F (2000) Co – orination of cell division and tissue expansion in sunflower, tobacco and pea leaves: dependence or independence of both processes? Journal of Plant Growth Regulation 39145–54
Hayat S, Ahmad A (2007) Salicylic Acid a Plant Hormone. Springer, pp 97–99
Herbinger K, Tausz M, Wonisch A, Soja G, Sorger A, Grill D (2002) Complex interactive effects of drought and ozone stress on the antioxidant defense systems of two wheat. Plant Physiology Biochemistry 40:691–696
Hosseini SM, Hasanloo T, Mohammadi S (2015) Physiological characteristics, antioxidant enzyme activities, and gene expression in 2 spring canola (Brassica napus L.) cultivars under drought stress conditions. Turkish Journal of Agriculture Forestry 39:413–420
Hosseinkhani Hezave S, Askary M, Amini F, Zahedi M (2015) Influence of Air SO2 Pollution on Antioxidant Systems of Alfalfa Inoculated with Rhizobium. Journal of Genetic Resources 1(1):7–18. doi:10.22080/jgr.2015.1122
Hung SH, Yu CW, Lin CH (2005) Hydrogen peroxide functions as a stress signal in plants. Botanical Bulletin of Academia Sinica 46:1–10
Jaleel CA, Manivannan P, Wahid A, Farooq M, Somasundaram R, Panneerselvam R (2009) Drought stress in plants: a review on morphological characteristics and pigments composition. Int J Agric Biol 11:100–105
Jung S (2004) Variation in antioxidant metabolism of young and mature leaves of Arabidopsis thaliana subjected to drought. Plant Sci 166:459–466
King BJ, Siddiqi MY, Glass AD (1992) Studies of the uptake of nitrate
Kirnak H, Kaya C, Tas I, Higgs D (2001) The influence of water deficit on vegetative growth, physiology fruit yield and quality in eggplants. J Plant Physiol 27:34–46
Kumar A, Purohit SS (2001) Plant Physiology Fundamentals and Applications. Second Enlarged Edition. Agrobios (India)
Li Y (2008) Kinetics of the antioxidant response to salinity in the halophyte Limonium bicolor. Plant Soil Environ 54:493–497
Liu LX, Xu SM, Woo KC (2004) Deficit irrigation effects on photosynthesis and the xanthophyll cycle in the tropical tree species Acacia auriculiformis in north Australia. New ZealandJBotany 42:949–957
Mesgaran MB, Madani K, Hashemi H, Azadi P (2017) Iran's Land Suitability for Agriculture. Scientific reports 7(1):7670. https://doi.org/10.1038/s41598-017-08066-y
Miguel A, Francisco M (2007) Response of tomato s to deficit irrigation under surface or subsurface drip irrigation. Journal of Applied Horticulture 9(2):97–100
Mostajeran A, Rahimi-Eichi V (2008) Drought stress effects on root anatomical characteristics of rice cultivars (Oryza sativa L.). Pakistan J Biol Sci 11:2173–2183
Mrema AF, Granhall U, Sennerby-Forsse L (1997) Plant growth, leaf water potential, nitrogenase activity and nodule anatomy in Leucaena leucocephala as affected by water stress and nitrogen availability. Trees 12:42–48
Munns R (2002) Comparative physiology of salt and water stress. Plant ‎Cell Environ25:239–250.&#8206
Mura A, Pintus F, Medda R, Floris G, Rinaldi AC, Padiglia A (2007) Catalase and antiquitin from Euphorbia characias: Two proteins involved in plant defense. Biochemistry 72:501–508
Nadarajah KK (2020) ROS Homeostasis in Abiotic Stress Tolerance in Plants. Int J Mol Sci 21(15):5208. doi:10.3390/ijms21155208. Published 2020 Jul 23.
Nardini A, Salleo S; Water stressinduced modifications of laef hydraulic architecture in sunflower: Co-ordination with gas exchange. J.Exp.Bot 422:3093–3101;2005
Navarro A, Vicente MJ, Martı´nez-Sa´nchez JJ, Franco JA, Ferna´ndez JA, Ban˜o´n S (2008) Influence of deficit irrigation and paclobutrazol on plant growth and water statusin Lonicera implexa seedlings. Acta Hortic 782:299–304
Neumann PM (1995) The role of cell wall adjustments in plant resistance to water deficits. Crop Sci 1513250–3222
Nevo E, Bolshakova MA;Martyn GI, Musatenko LI, Sytnik K, Palieek T, Beharvan A (2000) Drought and light anatomical adaptive leaf strategies in three woody species caused by microclimatic selection at “Evolution canyon”. Isreal Isr J PlantSci 48:3346
Ourcut DM, Nilsen ET (2000) Salinity stress in: physiology of plants under stress. KA/PP pp177–235
Panda SK, Matsumoto H (2010) Changes in antioxidant gene expression and induction of oxidative stress in pea (Pisum sativum L.) under Al stress. Biometals 23:753–762. https://doi.org/10.1007/s10534-010-9342-0
Peña-Valdivia CB, Sánchez-Urdaneta AB, Meza Rangel J, Juárez Muñoz J, García-Nava R, Celis Velázquez R (2010) Anatomical root variations in response to water deficit: wild and domesticated common bean (Phaseolus vulgaris L.). Biol Res 43:417–427
Rance N, Munos S, Santoni S, Causse M (2008) Clarified position for Solanum lycopersicum var. cerae in the evolutionary history of tomatoes (solanaceae). MBC Plant Biolog
Rizhsky L, Hallak-Herr E, Van Breusegem F, Rachmilevitch S, Barr JE, Rodermel S, Inzé D, Mittler R (2002 Nov) Double antisense plants lacking ascorbate peroxidase and catalase are less sensitive to oxidative stress than single antisense plants lacking ascorbate peroxidase or catalase. Plant J 32(3):329–342
Rout NP, Shaw BP (2001) Salt tolerance in aquatic macrophytes: possible involvement of the antioxidative enzymes. Plant Sci 160:415–423
Sahni S, Prasad BD, Liu Q, Grbic V et al (2016) Overexpression of the brassinosteroid biosynthetic gene DWF4 in Brassica napus simultaneously increases seed yield and stress tolerance. Sci Rep 6:28298–28298
Sairam RK, Chandrasekhar V, Srivastava GC (2001) Comparison of hexaploid and tetraploid wheat cultivars in their response to water stress. Biol Plant 44:89–94
Sarker U, Oba S (2018) Catalase, superoxide dismutase and ascorbate-glutathione cycle enzymes confer drought tolerance of Amaranthus tricolor. Sci Rep 8:16496. https://doi.org/10.1038/s41598-018-34944-0
Sikuku PA, Netondo GW, Onyango JC, Musyimi DM (2010) Effects of water deficit on physiology and morphology of three varieties of NERICA rainfed rice (Oryza sativa L.). ARPN Journal of Agricultural Biological Science 5:23–28
Srivalli B, Sharma G, Khanna-Chopra R (2003) Antioxidative defence system in an upland rice cultivar subjected to increasing intensity of water stress followed by recovery. Physiology Plantarum 119:503–512
Ufuk Demirel MWayneL, Ducreux Laurence JM, Caner Y, Arslan A, Ilknur T, Raymond C, Jenny M, Verrall Susan A, Hedley Pete R, Gokce Zahide E, Sevgi NO,C, Emre A, Caliskan Mehmet E, Taylor Mark A, Hancock Robert D (2020) Physiological, Biochemical, and Transcriptional Responses to Single and Combined Abiotic Stress in Stress-Tolerant and Stress-Sensitive Potato Genotypes. Front Plant Sci 11:196
Zhang X, Yang Z, Li Z et al (2020) Effects of drought stress on physiology and antioxidative activity in two varieties of Cynanchum thesioides. Braz J Bot 43:1–10
Zhu J, Brown KM, Lynch JP (2010) Root cortical aerenchyma improves the drought tolerance of maize (Zea mays L.). Plant Cell Environ 33:740–749
Zhu J, Lee BH, Dellinger M, Cui X et al (2010) A cellulose synthase-like protein is required for osmotic stress tolerance in Arabidopsis. Plant J 63:128–140

PDF

Version 1

posted 16 Sep, 2021

You are reading this latest preprint version

Morphologic and anatomic response, catalase gene expression in drought varieties of tomato and bioinformatics analyses of microarray studies of the catalase gene

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Method

2.1. Primary tomato seed cultures

2.2. Exposure To Salinity Stress

2.3. Morphological And Anatomical Studies

2.4. RNA expression analysis by real-time RT-qPCR

2.5. Statistical analysis

2.6. Microarray Study

2.6.1. Collection of data

2.69.2. Expression analysis

2.6.2. Co-expression Data Analysis

2.6.3. Module Preservation

3. Results

3.1. Effects of drought-stress on morphometric features of varieties of tomato

4. Discussion

5. Conclusion

Declarations

References

Status:

Version 1