Materials
Phenylephrine (Phe, α receptor agonist), acetylcholine, endothelin 1 (ET-1, endothelin receptor agonist), adenosine 5’-triphosphate disodium salt (ATP-Na2), 2-aminoethyl diphenylborinate (2APB, inositol triphosphate receptor inhibitor) were purchased from Sigma and dissolved in the distilled water. Thapsigargin (TG) was obtained from Calbiochem and dissolved in dimethyl sulfoxide (DMSO). The primary goat (sc-10377) and rabbit (sc-25749) antibodies against TRPP2, the primary rabbit antibody against IP3 receptor and the primary rabbit antibody against Orai1 were purchased from Santa Cruz Biotechnology. The primary rabbit antibody against STIM1 was obtained from ProSci. Fluo-4 fluorescence dye, TRPP2 small interfering RNA (siRNA), STIM1 siRNA, RNAiMax reagent, lipofectamine 2000, goat anti-rabbit IgG conjugated to Alexa Fluor 488 were purchased from Invitrogen. Protein A magnetic bead was obtained from Millipore.
Cell preparation and culture
All animal experiments were conducted in accordance with NIH publication no. 8523 and were approved by the Animal Experimentation Ethics Committee of Anhui Medical University. Mice were killed by CO2 overdose. VSMCs were isolated according to our previous study [21]. Briefly, thoracic aorta was cut out, and the artery lumen was cut open longitudinally. The endothelial layer was mechanically removed by rubbing the lumen with cotton. The smooth muscle tissues were torn out from the adventitial layers, and were then incubated in a Ca2+-free phosphate buffer saline (PBS) containing 0.2% collagenase type 1A, 0.9% papain, 0.5% bovine serum albumin (BSA), and 10 mmol/L dithiothreitol at 37°C for 50 min. VSMCs were dispersed by Pasteur pipette and washed with PBS. VSMCs were cultured for 5-7 days before the experiment. Both VSMCs and HEK293 cell were cultured in dulbecco modified eagle medium (DMEM) supplemented with 10% fetal bovine serum, 100 μg/ml penicillin and 100 U/ml streptomycin.
Animals preparation
Adult male mice (20 g, 4 weeks old) were housed in a temperature and humidity-controlled vivarium with a 12-/12 hr light/dark cycle with access to food and water ad libitum.
Cloning and transfection
Wild type hTRPP2 (GenBank: U50928.1) and hSTIM1 (GenBank: JX014264.1) were inserted into pEGFP-N1 (at BamH I site), pmCherry-N1 (at BamH I site) or pEGFP-C1 (at Bgl II site) vectors by InFusion Cloning Kit (Clontech Bioinformatics, U.S.). For short N TRPP2, 2-111aa or 112-221aa was deleted from N terminus of TRPP2.
Transfection condition was performed as described previously [22]. HEK293 cells were transfected with all constructs using lipofectamine 2000. About 6×104 HEK293 cells were grown in the each well of the 6-well plates. The transfection was performed with 2 μg plasmid and 4 μl lipofectamine 2000 in 200 μl Opti-MEM reduced serum medium in the 6-well plates. The functional studies were performed 3 days post-transfection. Mouse STIM1 and TRPP2 siRNA sequences information were obtained from the literature. The sequence for mouse STIM1-siRNA was UACAGUGGCUCAUUACGUAUU (sense strand) [23]. The sequence for human STIM1-siRNA was AAGGGAAGACCUCAAUUACCA (sense strand) [24]. The TRPP2-siRNA sequence was AACCUGUUCUGUGUGGUCAGGUUAU (sense strand), and was used in both human and mouse species [25]. Scrambled siRNA sequence is UAACGACGCGACGACGUAA (sense strand). Small interfering RNA delivery was achieved by lipofectamine RNAiMAX reagent according to the manufacturer manual. In the vessel tissue, siRNA was applied into culture medium overnight with lipofectamine RNAiMAX. The blood vessels were used in the experiment, after 24 hr culture.
Fluorescence resonance energy transfer (FRET)
Sensitized emission FRET was performed as described previously [26]. According to Leica confocal software manual, GFP is a donor fluorophore in the GFP-mCherry FRET pair, while mCherry is an acceptor fluorophore to accept GFP emission. TRPP2 and STIM1 were tagged with GFP and mCherry, respectively. Donor only cells transfected with the GFP-tagged construct and acceptor only cells transfected with the mCherry-tagged construct were utilized as references. The references are used to obtain calibration coefficients to correct for excitation and emission cross talk. According to the routine of FRET workflow, FRET efficiency was collected in HEK293 cells co-transfected with GFP-tagged and mCherry-tagged constructs and calculated by following equation [27]:
See equation 1 in the supplementary files section.
In the equation, A, B and C are donor, FRET and acceptor channel intensities respectively. As the calibration factors, β is the FRET channel intensity/donor channel intensity in the donor only cells and γ is the FRET channel intensity/acceptor channel intensity in the acceptor only cells.
Intracellular calcium ([Ca2+]i) measurement
[Ca2+]i was measured according to our previous report [21]. Briefly, the cells were loaded with 10 μmol/L Fluo-8/AM and 0.02% pluronic F-127 dissolved in a normal physiological saline solution (NPSS) that contained in mmol/L: 140 NaCl, 5 KCl, 1 CaCl2, 1 MgCl2, 10 glucose, 5 Hepes, pH 7.4 at 37°C for 1 h in dark. The cell Ca2+ store was depleted by 10 µmol/L ATP or 2 µmol/L thapsigargin in the Ca2+-free solution containing in mmol/L: 140 NaCl, 5 KCl, 1 MgCl2, 10 glucose, 0.2 ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA), 5 Hepes, pH 7.4. Ca2+ influx was initiated by applying 1 mmol/L Ca2+ in bath solution. The fluorescence signal was recorded and analyzed by TCS SP5 confocal laser scanning system (Leica, Germany). Changes in the peak value of cytosolic [Ca2+]i were displayed as a ratio of fluorescence relative to the baseline intensity before the application of ATP/TG or extracellular Ca2+ (F1/F0).
Co-immunoprecipitation and immunoblots
Co-immunoprecipitation and immunoblots were performed according to our previous report [21]. The proteins were extracted from the aorta or cells with detergent extraction buffer containing 1% Nonidet P-40, 150 mmol/L NaCl, and 20 mmol/L Tris-HCl, pH 8.0, plus protease inhibitor cocktail tablets. TRPP2 or STIM1 proteins were immunoprecipitated by incubating 800 μg of the extracted proteins with 7 μg of anti-TRPP2 or anti-STIM1 antibody on a rocking platform overnight at 4°C. Protein A agarose was then added and incubated for another 3 h at 4°C. The immunoprecipitates were washed with the lysis buffer for 3 times and were resolved on an SDS/PAGE gel. For the immunoblots, the poly (vinylidene difluoride) membrane carrying transferred proteins was incubated at 4°C overnight with respective primary antibodies: anti-STIM1, anti-TRPP2, anti-IP3R, anti-Orai1 and β-tubulin (1:200). Immunodetection was accomplished using horseradish peroxidase-conjugated secondary antibody and ECL detection system. The optical density of each blot was normalized to that of β-tubulin and expressed as the relative optical density.
Proximity ligation assay (PLA)
In situ PLA kit Duolink (Sigma-Aldrich, U.S.) was used to detect the interaction of TRPP2 and STIM1 according to the manufacturer's instructions and previous study [28]. Briefly, fresh isolated VSMCs from mesenteric arteries were fixed and permeabilized. Next, VSMCs were blocked with Duolink blocking solution and incubated with anti-TRPP2 (Santa Cruz, sc-10377, U.S.)[29] and anti-STIM1 (Santa Cruz, sc-68897, U.S.)[30] (1:40, each) antibodies overnight at 4 °C in Duolink antibody diluent. Negative control cells were incubated with anti-STIM1 antibody alone. After the following washout with physiological saline solution, the VSMCs were incubated with Duolink secondary antibodies conjugated with oligonucleotides (anti-goat PLA probe Plus (Sigma, DUO92003, U.S.) and anti-rabbit PLA probe Minus (Sigma, DUO92005, U.S.) in a pre-heated humidity chamber for 1 h at 37 °C. Then the VSMCs were incubated with a ligation solution containing two oligonucleotides and one ligase. When two proteins were in close proximity (<40 nm separation), the oligonucleotides would hybridize to the two PLA probes. Subsequently, the ligase would join the two hybridized oligonucleotides to form a close circle. A rolling-circle amplification reaction using the ligated circle as a template would result in a repeated sequence product. A fluorescence (Texas Red channel)-labeled complementary oligonucleotide detection probes (Sigma, DUO92008, U.S.) were used to detect the amplification products. The VSMCs were mounted with a medium containing 4',6-diamidino-2-phenylindole (DAPI) nuclear stain. The fluorescence signals (positive signals: red fluorescent dots) were visualized and imaged using a TCS SP5 confocal microscope (Leica, Germany).
Immunofluorescence
Immunofluorescence was performed as described elsewhere [31]. Cultured aortae or primary cultured VSMCs were fixed with 4% formaldehyde for overnight or 10 min respectively, followed by permeabilization with 0.1% Triton X-100 dissolved in PBS. The samples were blocked by 2% BSA at room temperature for 1 h before incubating with primary antibody at 4ºC overnight. After washing with PBS for three times, the samples were incubated with donkey anti-rabbit IgG conjugated to Alexa Fluor 488 (1:200) for 1 h at room temperature and mounted in 90% glycerol in PBS and the fluorescent signals were determined by a TCS SP5 confocal laser system (Leica, Germany). The 8-bit images were analyzed with ImageJ software [32]. Briefly, projected images were generated by collecting maximum pixel intensity of the in-focus frames into a single frame. The images were threshold to remove background fluorescence and used to create a mask image. Using the mask images, number of STIM1 puncta was scored with automatic “Analyze Particles” algorithm of ImageJ software and using cluster size of 3–100 pixels and circularity 0.1–1.0.
Generation of PKD2 (TRPP2, smooth muscle) conditional knockout (CKO) mice
Pkd2cond mutant mice purchased from Jackson Laboratory (Stock number: 017292; B6.129X1(Cg)-Pkd2tm1.1Tjwt/J, U.S.) possess loxP sites flanking exons 11-13 of Pkd2 gene [33]. In the development of the Pkd2cond mutant mice, a targeting vector was constructed. A loxP site was inserted on the upstream of exon 11 and a second loxP site, followed by a frt-flanked neomycin resistance (neo) cassette was inserted on downstream of exon 13 of Pkd2 gene. The Pkd2 targeting vector was electroporated into 129X1/SvJ-derived embryonic stem (ES) cells. ES cells were injected into blastocysts. Chimeric mice were obtained by breeding to C57BL/6J mice. To delete the neo cassette, Flp transgenic mice were used to bred with offspring. Next, the resulting homozygous for the floxed-Pkd2 (Pkd2cond) allele were obtained after the progeny were crossed to remove the Flp-expressing transgene. Floxed Pkd2 mice were then crossed with STOCK Tg(Tagln-cre)1Her/JNju mice bearing a Cre-recombinase (Fig. 8A). DNA isolated from mice tail tissues of the offspring were genotyped by PCR for LoxP+/+ sites and the presence of the Cre-recombinase using specific primers (For Pkd2 LoxP+/+, forward primer sequence: 5’-GGGGTTCCTATGAAGAGTTCCAAG-3’, the revers primer sequence: 5’-CTGACAGGCACCTACAGAACAGTG-3’; For Cre, the forward primer sequence: 5’-ATTTGCCTGCATTACCGGTC-3’, the reverse primer sequence: 5’-ATCAACGTTTTCTTTTCGG-3’). A representative genotyping result showed Lox P (+/+) sites (485 bp), Cre control (350 bp) and wild type (382 bp). (Fig. 8B). TRPP2 expressing in mice aortic smooth muscle was confirmed by immunoblots (Fig. 8C). PKD2+/+-Cre was as Cre control. All breeding and animal studies were approved by the Animal Experimentation Ethics Committee of Anhui Medical University.
Vessel tension measurement
Vessel tension measurement was performed as described in our previous report [34]. Briefly, after euthanasia, the mouse thoracic aorta was quickly dissected free and placed in Krebs Henseleitt solution consisting of (in mmol/L): NaCl 118, KCl 4.7, CaCl2 2.5, KH2PO4 1.2, MgSO4 (7 H2O) 1.2, NaHCO3 25.2 and glucose 11.1. Under a dissecting microscope, adhering perivascular tissue was cut into 2 mm-long rings. The endothelial layer was mechanically removed by gently rubbing the luminal surface. The vessel rings were mounted onto two thin stainless steel holders, one of which was connected to a force displacement transducer and the other to a movable device that allowed the application of passive tension of 0.5 g, a range that was determined to be the optimal resting tension for obtaining maximal active tension induced by a 60 mmol/L K+ solution. The mounted rings were kept in 5 ml organ baths containing Krebs Henseleit solution at 37ºC and continuously bubbled with a gas mixture of 95% O2 and 5% CO2 to maintain a pH of 7.4. The isometric tension was recorded and analyzed by a DMT myograph (model 610M; Danish Myo Technology, Aarhus, Denmark). After an equilibration period of 60 min, the contractile function of the vessel was tested by replacing Krebs Henseleit solution with 60 mmol/L K+ solution that was prepared by replacing NaCl with an equimolar amount of KCl, which was taken as the reference contraction. After the restoration of vessel tension to the baseline levels, the rings were exposed to 10 μmol/L Phe to test their contractile responses, and subsequently challenged with acetylcholine to certify endothelial functional removal. The contractile response to Phe (10−8.5-10−5.5 mol/L) or ET-1 (10−9-10−7 mol/L) was obtained by cumulatively adding agonists into the bath with or without the pretreatment of inhibitors for 10 min. The vessel contraction was normalized by vessel weight (contraction/weight (g/g)) to remove the effect of vessel thickness and length on maximal intensity of contraction [35]. Some vessel tissues were loaded with heparin (1 mg/ml) using a reversible permeabilization loading procedure. The tissues were exposed to a series of high K+, low Ca2+, EGTA containing solutions [36].
Statistics
Data were expressed as mean ± SEM. The statistical significance was determined using two-tailed Mann-Whitney U test or two-way analysis of variance followed by Games-Howell post hoc tests when more than two treatments were compared. Differences were considered significant with a value of P < 0.05. In the [Ca2+]i measurements, n represents the number of experiments.