Viruses and cells
Two plasmids, pCLZ651 and pC15, containing the full-length cDNA copies of HRV-C were a gift from Professor Zhao-jun Duan (China CDC, Beijing, China). Lz79 (GenBank: JF317014) and lz101 (GenBank: JF317017) were used as two clinical HRV-C samples. RSV1 (RSV-A1: ATCC-VR-1540) and RSV2 (RSV-B1: ATCC-VR-955) were used as RSV samples.
HeLa cells were cultured in DMEM supplemented with 10% FBS (Gibco, Grand Island, NY, USA) and 1% penicillin/streptomycin (Gibco) and were tested for mycoplasma (Mycoplasma Test Kit, ExCell Bio, Shanghai, China).
Cultures of primary bronchial epithelial cells grown on ALI
Primary HBE cells were isolated from patients who underwent surgical lung resection for pulmonary diseases in Nanjing Children’s Hospital, as described previously[11]. HBE cells were plated onto type I and III collagen-coated six-well tissue culture plates and cultured in BEGM media (Lonza, Germany) supplemented with the required additives (Lonza). When the cells reached 80%–90% confluence, traditional monolayer two-dimensional (2D) HBE cells were dissociated using trypsin, and 3 × 105 cells were seeded on type IV collagen-coated 12-well transwell inserts (Costar, ME, USA). The medium was renewed for both the apical and basolateral surfaces every other day. The medium was then changed to air–liquid interface (ALI) medium (BEGM+DMEM+additives) until the HBE cells reached full confluence. After 5 days, the HBE cells were exposed to air, and only the basolateral compartment was cultured in ALI medium. The ALI culture was continued for 4–6 weeks, during which time the cells differentiated into 3D pseudostratified HBE cells. Prior to the experiments, all cultures were maintained at 37°C in a 5% CO2 incubator.
In vitro HRV-C RNA transcription, transfection, and inoculation
The two plasmids, Lz651 and PC15, containing HRV-C viral genome were digested to linearize using Endonuclease Cal I (NEB), followed by HRV-C RNA transcription in vitro with a MEGAscript® T7 Transcription Kit (Ambion) in accordance with the manufacturer’s instructions. The RNA transcripts were treated with DNase I (Promega), purified with MEGAclear™ Transcription Clean-Up Kit (Ambion), and analyzed by formaldehyde denaturing agarose gel electrophoresis. RNA was transfected into HeLa cells with Lipofectamine 3000 (Invitrogen), and the dishes were incubated at 34°C for 24 h. After freeze and thaw cycles, the virus was prepared. The cell lysates of PC15- and Lz651-transfected HeLa cells were added to the apical surface of the HBE 3D cells and incubated at 34°C. Next, the HBE 3D cells were washed with PBS three times, and cells to assess cell-associated virus were collected in 500 µL Trizol (Invitrogen) at indicated time point.
Immunostaining for HBE 3D cells and HRV-C
HBE 3D cells and those infected with 105 RNA copies of HRV-C for 24 h were fixed in 4% paraformaldehyde (PFA) for 30 min at room temperature, followed by washing of both the apical and basolateral sides three times with PBS. Subsequently, the fixed cells were permeabilized with 0.2% Triton X for 2 h and blocked with 5% bovine serum albumin for 1 h. For the simultaneous detection of HRV-ssRNA, ciliated cells, secretion cells, and tight junctions, we applied anti-HRV-ssRNA mouse polyclonal antibody (mAb12, 10010200-200UG, 1:500, Thermo Fisher), mouse monoclonal anti-β tubulin antibody (T4026, 1:100, Sigma), MUC5AC monoclonal antibody (MAB11324,1:500, Abnova), and mouse monoclonal anti-ZO-1 antibody (33–9100, 1:500, Invitrogen), respectively. Light 594-labeled anti-mouse IgG (H + L) (35,511, 1:500, Thermo Fisher) was applied as secondary antibody. For the detection of VP1 protein, rabbit polyclonal anti-HRV-C VP1 protein–antibody complexes (1:500, Invitrogen) bound to the cells were visualized using an Alexa Fluor 594 goat anti-rabbit IgG (1:500, Invitrogen). Nuclei were counterstained with DAPI. Finally, the filters with cells were excised from the insert and mounted under coverslips on glass slides using mounting medium. Confocal images were taken with an UltraView VoX confocal microscope (PerkinElmer, Boston, MA, USA).
Inoculation of other viruses on HBE 3D cells
HRV-C79 and HRV-C101 were quantified using qRT-PCR, and the RNA copies before inoculation were similar to those of pCLZ651 and pC15. RSV1 and RSV2 viral stock was propagated in HeLa cells; we infected HeLa cells with serially diluted RSV, followed by observation of cytopathic effects (CPE) to assess the 50% tissue culture infective doses (TCID50) per milliliter. TCID50 of RSV1and RSV2 were 10−5.
Virus suspensions of HRV-C79 and HRV-C101 (100 µL each) and RSV1 and RSV2 viral stocks (100 µL each) were applied on the apical surface of HBE 3D cells. At 4 h or 6 h post-incubation at 34°C or 37°C, the tissues were rinsed three times with PBS, and cultures were continued in the liquid–air interface in 500 μL of fresh culture medium.
Quantitative real-time reverse transcription-PCR (qRT-PCR)
The RNAs of pCLZ651, pC15, HRV-C18, and HRV-C25 were quantified using a Quanti Tect Probe RT-PCR kit (QIAGEN) with the probe (FAM-TCC TCC GGC YCC TGA ATG-MGB) and the primers (HRV1A, 5’-AGC CTG CGT GGC TGC CTG-3’; HRV1A2, 5’-CCT GCG TGG CGG CCA RC-3’; HRV1B, 5’-CCC AAA GTA GTY GGT CCC RTC C-3’). These primers are complementary to the 5’ nontranslated regions of HRVsE1. For RSV1 and RSV2, the probe was FAM-CTGTGTATGTGGAGCCTTCGTGAAGCT; the forward primer was GGCAAATATGGAAACATACGTGAA; and the reverse primer was TCTTTTTCTAGGACATTGTAYTGAACAG. HRV-C RNA levels were normalized to human glyceraldehyde-3-phosphate dehydrogenase (GADPH) RNA levels in cell and tissue lysates with the probe (VIC-TGG TAT CGT GGA AGG A-MGB) and primers (forward, 5’-GCC AAA AGG GTC ATC ATC TC-3’; reverse, 5’-GGG GCC ATC CAC AGT CTT CT-3’).
Cytokine and/or chemokine production
Basal medium was assayed for IFN-λ1, CCL5, IP10, IL-6, IL-8, and MCP-1 using solitary ELISA kits (eBioscience, USA) following the manufacturer’s instructions. Determination of each cytokine level was repeated for three times.
Statistical analysis
Statistical analysis was performed with SPSS, version 22.0. Data were presented as mean ± standard deviation. Mann–Whitney test for comparisons between two viral groups was used to determine statistical significance (P<0.05).