Animals
All adult male C57BL/6J (B6) mice (8–10 weeks old, approximately 25–30 g) were purchased from the Comparative Medical Center of Nanjing Medical University (Jiangsu Province, China). As previously described, the mice were housed in a suitable environment.
Grouping and Drug Administration
Mice were randomized into four groups as follows: I) control vehicle-treated group (Sham group); II) MVC-treated group (MVC group); III) vehicle-treated CI/R group (CI/R group); and IV) MVC-treated CI/R group (CI/R + MVC group). After the induction of MCAO, mice received intraperitoneal injections with either MVC (5, 20, or 50mg/kg body weight) or the vehicle(10% dimethyl sulfoxide ,10%DMSO,Amresco, Solon, OH, USA) daily for 3 consecutive days.
The Middle Cerebral Artery Occlusion(MCAO) model
The animals were anaesthetized with pentobarbital sodium. The MCAO mouse model was established as previously described[9].. Briefly, a 6/0 monofilament nylon suture (Doccol Corporation, MA, USA) with a heat-rounded tip was inserted into the beginning of the MCA through the internal carotid artery until the ipsilateral blood flow decreased to less than 30% of the baseline value, as monitored using laser Doppler flowmetry (Perimed Corporation, Stockholm, Sweden). After 60 min of occlusion, the filament was withdrawn to allow blood reperfusion. In the sham-operated group, the aforementioned procedure was performed, but a filament was not inserted into the MCA. After the operation, we fed the mice jelly or performed an intraperitoneal (i.p.) injection of normal saline to rehydrate. Pre-dissolved MVC or the same volume of saline was administered to each animal by an i.p. injection at 30 min, 24 h and 48 h after MCAO in a double-blind manner.
Behavioral analysis of neurological deficit score
Neuro-behavioural function was assessed using the modified neurological severity score (mNSS) and Longa score on day 3 following MCAO by a blinded observer[10].. The mNSS evaluates neurological deficits through motor, reflex, sensory, and balance testing. The score ranges from 0, indicating no neurologic deficit, to 18 for animals with the most severe impairment. The Longa score is determined as follows: 0 point, no neurological deficit; 1point, cannot fully extend the contralateral forelimb; 2 points, tail-catching phenomenon while walking (circling to the contralateral side); 3 points, unsteady in the standing position, falling to the contralateral side; and 4 points, no spontaneous walking and decreased consciousness. Scores of 0‑2 are classifiedas mild neurological impairment, while scores of 3‑4 are classified as severe neurological impairment. The evaluators were blinded to the treatment group of mice during the neurobehavioral tests.
Cerebral Infarction Volume Measurement
After neurological evaluation, mice were sacrificed and histological evaluation of brain tissue was performed. The brain was sectioned into six slices and incubated with 0.2%(w/v) 2,3,5-triphenyltetrazolium chloride (TTC, Sigma-Aldrich)at 37°C for 15 min to determine the infarct volume. Infarcted tissue was pale grey in color, compared to the dark red color of normal brain tissue. Images were obtained using a digital camera and analyzed using ImageJ software. The percentage of hemispheric infarction volume was calculated using the following formula: Infarct size = (contralateral area—ipsilateral non-infarct area)/contralateral area x 100%
Quantitative Real-Time-Polymerase Chain Reaction (qPCR)
Total RNA was extracted from the ischemic cerebral cortex using a commercial TRIzol kit, and RNA was then reverse-transcribed into cDNA using a PrimeScript RT reagent Kit(Vazyme,Nanjing,China). Quantitative measurements were performed on an ABI 7500 PCR instrument (Applied Biosystems, USA) using a SYBR green kit(Applied Biosystems). Relative gene expression levels were normalized to GAPDH. The sequences of the primers used are as follows: TNF-a: (forward) TCGGTCCCAACAAGGAGGAG and (reverse) GGGTTGTCACTCGAGTTTTG; IL-1b: (forward) GCAACTGTTCCTGAACTCAACT and (reverse) ATCTTTTGGGGTCCGTCAACT; IL-6:(forward) GGCGGATCGGATGTTGTGAT and (reverse) GGACCCCAGACAATCGGTTG; GAPDH (forward) GCCAAGGCTGTGGGCAAGGT and (reverse) TCTCCAGGCGGCACGTCAGA.
Western Blot Analysis
Western blot analysis was then performed on the cerebral tissue within the ischemic areas. Proteins were homogenized in RIPA lysis buffer (Millipore, Billerica, MA, USA) containing protease inhibitors. The supernatant was assayed using a BCA Protein Assay Kit (Beyotime Biotech). The protein concentration was adjusted to the same concentration with protein buffer. The protein samples were then loaded, electrophoresis was performed, and the separated proteins were electrically transferred to polyvinylidene difluoride (PVDF) membrane. The membrane was blocked in PBS containing 0.1% Tween-20 and 5% non-fat milk for 2 h at room temperature. The membrane was then incubated with the primary antibodies overnight at 4°C. anti-GAPDH(Bioworld), anti-Bax (Cell Signaling Technology), Anti-Bcl-2 (Bioworld),anti-Phospho-IκBα(Cell Signaling Technology),anti-IκBα(Cell Signaling Technology)༌anti-NF-κB (p-p65) (Cell Signaling Technology)༌anti-NF-κB (p65) (Cell Signaling Technology)༌anti-Phospho-p38 MAPK(Cell Signaling Technology)༌anti-p38 MAPK(Cell Signaling Technology)༌anti-Phospho-p44/42 MAPK (Erk1/2) (Cell Signaling Technology)༌anti-p44/42 MAPK (Erk1/2) (Cell Signaling Technology)༌anti-SAPK/JNK (Cell Signaling Technology), and anti-phospho-SAPK/JNK (Cell Signaling Technology)༌
After washing with PBST, the blots were incubated with HRP conjugated secondary antibody in blocking solution for 2 hand developed with the ECL chemiluminescence system(Thermo Company, West Chester, PA, USA).secondary antibody: Rabbit Anti-Goat IgG (H + L)-HRP(Bioworld),Mouse Anti-Goat IgG (H + L) AP(Bioworld).
TUNEL Staining
TUNEL staining was used to detect the apoptosis of neurons in the ischemic penumbra.TUNEL staining according to the manufacturer’s instructions (Vazyme,Nanjing, China) .As previously described, the frozen sections were dried at 37°C for 2 h, washed in PBS 3 times for 5 min each time, soaked in PBS containing 0.25%Triton X-100 for 15 min to permeabilize the cells, and washed with PBS 3 times. The cells were covered with 100 ml of equilibrium buffer and incubated at room temperature for 5‑10min. 50 ul of terminal deoxynucleotidyl transferase recombinant(RTdT) incubation buffer was then added to each tissue slice, and the slices were then incubated for 60 min at 37°C in a dark humidified atmosphere. The slides were soaked in 2X SSC solution, and the reaction was terminated after 15 min. The cells were stained with DAPI for 15 min and then exposed to the quenchant. Laser scanning confocal microscopy was performed with a fluorescence microscope (Olympus X73). Positive cells were quantified via Image-Pro Plus6.0 by blinded observers.
Cytokine measurements
Primary microglia with MVC (20nM) for 12h after OGD/R. The supernatants were collected, and the concentrations of the cytokines TNF-α, IL-1β and IL-6 were measured using enzyme-linked immunosorbent assays (ELISAs) according to the manufacturer’s instructions (Cusabio Biotech, Wuhan, China)
Statistics
Relevant statistical analyses and graphing were performed using ImageJ and GraphPad Prism 8.0.2 All data are expressed as the mean ± SEM. One-way analysis of variance (ANOVA) was used for multiple comparisons among groups, and Student’s t-test was used for comparisons between two groups. P < 0.05 was considered significant.