2.1. Chemicals
Asiatic acid (purity >97.0%; molecular weight 488.70), purchased from Sigma–Aldrich (St. Louis, USA), was dissolved in dimethylsulfoxide (DMSO) as a 2 mM stock solution and stored at 4 °C. Further dilution was done in cell culture medium.
2.2. Cell Isolation and Culture
Cartilage samples were obtained intraoperatively from patients (n = 3, age 55 ± 10) undergoing total knee arthroplasties with approval from Ethics Committee of Southwest Hospital (Chongqing, China). Chondrocytes were isolated according to our previous protocol[19]. Briefly, cartilage pieces were digested in high-glucose DMEM (C11995500BT, Gibco, USA) supplemented with 0.2% type II collagenase (C6885, Sigma, USA) and 1% penicillin/streptomycin (P/S) overnight at 37 °C. The resulting cell suspension was filtered through a 40-μm cell strainer; collected cells were centrifuged (400 g for 5 min), and resuspended in high glucose DMEM supplemented with 10% fetal bovine serum (FBS; Hyclone, USA) and 1% P/S. Finally, cells were plated at a density of 1 × 105 cells per well in 6-well plates and incubated in a humidified atmosphere of 5% CO2 at 37 °C. The medium was changed every 2–3 days. Only cells at passage 1 were used in our study to avoid phenotype loss.
2.3. Live-Dead Cell Staining and Cell Viability Assay
The effects of AA on the viability of chondrocytes were evaluated using a Live/Dead staining kit (40747ES76, Yeasen, China). Briefly, after 24 h treatment of AA (0, 5, 10, and 20 μM), chondrocytes were incubated with 2 μM Calcein-AM and 4.5 μM PI for 15 min at room temperature (RT) in the dark. Labelled cells were visualized using a confocal microscope (IX71, Olympus, Japan). Live cells were stained green, whereas dead cells were stained red.
To further evaluate the cytotoxicity of AA, measurement of cell viability was performed using the Cell Counting Kit-8 (CCK-8; CK04, Do Jindo Laboratories, Japan). Chondrocytes were cultured in 96-well plates at a density of 5 × 103 cells per well for 24 h. Then, cells were pretreated with AA at different concentrations (0, 5, 10 and 20 μM) for 24 h. After that, 10 μL CCK-8 solution was added to each well and incubated at 37 °C for 2 h. The optical density was read at a wavelength of 450 nm with a microplate reader (Thermo Fisher Scientific, USA).
2.4. Alcian Blue Staining
The cells were washed with PBS and fixed with 4% formaldehyde for 10 min at RT. Then, the cells were washed three times with PBS and stained with Alcian Blue (Cyagen, USA) for 30 min. The cells were washed again three times with PBS and imaged.
2.5. Alkaline phosphatase (ALP) staining
Cells were cultured in 24-well plates at a density of 1 × 104 cells per well, followed by stimulation with AA. After 3 days of culturing, the cells were washed with PBS and stained using an ALP staining kit (C3206, Beyotime, China) according to the manufacturer's protocol. The cells were washed again three times with PBS and imaged.
2.6. Immunofluorescence staining
Cells were washed with PBS and fixed with 4% formaldehyde for 10 min at RT. Then, cells were washed three times with cold PBS and treated with Triton X-100 (P0096, Beyotime) for 10 min at RT. Cells were washed again three times with PBS and blocked 1 h with Blocking Buffer (P0260, Beyotime) at RT followed by incubation with the primary antibodies: COL-II (dilution of 1: 200; ab34712, Abcam, USA), Aggrecan (dilution of 1: 100; ab3778, Abcam), SOX9 (dilution of 1: 250; ab185230, Abcam), MMP-13 (dilution of 1: 200; ab39012, Abcam), COL-X (dilution of 1: 50; ab58632, Abcam), Runx2 (dilution of 1: 500; ab23981, Abcam), COL-Ι (dilution of 1: 200; ab34710, Abcam), α-SMA (dilution of 1: 500; A5228, Sigma) overnight at 4 °C. Next, the cells were washed three times with PBST, incubated with secondary antibody for 1 h at RT. Cell nuclei were counterstained with DAPI for 5 min at 37°C, the images were obtained by confocal fluorescent microscope (LSM710, Carl Zeiss, Germany).
2.7. Reverse transcription-polymerase chain reaction (RT-PCR)
RT-PCR total RNA was isolated from chondrocytes using RNA pure Total RNA Kit9 (RP5612, BioTeke, China) following the manufacturer's protocol. RNA concentration was determined spectrophotometrically using a NanoDrop ND1000 spectrophotometer (Isogen Life Science B.V., Netherlands). The A260/A280 ratio was calculated to verify quality and purity. cDNA synthesis was performed using first strand cDNA synthesis kit (Roche, Switzerland) according to the manufacturer’s instructions. Real-time PCR was performed in 20 μL reactions on cDNA with SYBR Green PCR reagents (Roche) using CFX96 Touch TM Real-Time PCR Detection System (Bio-Rad, USA). The level of target mRNA was normalized to the level of GAPDH (B661104, Sangon Biotech, China) and compared with control. Data were analyzed using 2−ΔΔCT method. Each gene analysis was performed in triplicate. Primer’s sequences of the targeted genes were listed in Table 1.
Table 1 Sequences of the primers used in this study
Name Forward Reverse
|
COL2a1 TGCTGCCCAGATGGCTGGAGGA TGCCTTGAAATCCTTGAGGCCC
ACAN TCCTGGTGTGGCTGCTGTCC TCTGGCTCGGTGGTGAACTCTAG
SOX9 GACTTCCGCGACGTGGAC GTTGGGCGGCAGGTACTG
MMP-13 TCCTGGCTGCCTTCCTCTTCTTG AGTCATGGAGCTTGCTGCATTCTC
Runx2 AACAGCAGCAGCAGCAGCAG GCACCGAGCACAGGAAGTTGG
COL10a1 GCCACCAGGCATTCCAGGATTC GGAAGACCAGGCTCTCCAGAGTG
COL1a1 GCGAGAGCATGACCGATGGATTC GCCTTCTTGAGGTTGCCAGTCTG
α-SMA TCGTGCTGGACTCTGGAGATGG CCGATGAAGGATGGCTGGAACAG
|
2.8. Western blot
The cells were lysed in RIPA (P0013B, Beyotime) with 1% PMSF (ST506, Beyotime) on ice for 5 min and removed with a scraper. Then the lysate was centrifuged at 16 100 g for 5 min, and the supernatant was collected. The samples were diluted with SDS-PAGE Sample Loading Buffer (Beyotime) and kept at 100°C for 10 min. Proteins were separated in 8% to 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (according to the molecular weights) and transferred to a PVDF membrane (FFP28, Beyotime) at 200 mA for 1.5 h at 4°C. The membrane was washed twice with Milli-Q water, stained with Ponceau S for protein visualization, and washed three times with 2% v/v TBST (tris-buffered saline with Tween-20). The blot was blocked with QuickBlock™ Blocking Buffer (P0228, Beyotime) for 2 h at RT and incubated separately with the following primary antibodies: COL-II (dilution of 1: 5000), Aggrecan (dilution of 1: 100), SOX9 (dilution of 1: 5000), MMP-13 (dilution of 1: 3000), COL-X (dilution of 1: 250), Runx2 (dilution of 1: 1000), COL-Ι (dilution of 1: 5000), α-SMA (dilution of 1: 1000), p-AMPK (dilution of 1: 1000, AF3423, Affinity), AMPK (dilution of 1: 1000, DF6361, Affinity), p-PI3K (dilution of 1: 1000, AF3242, Affinity), PI3K (dilution of 1: 1000, AF6241, Affinity), p-AKT (dilution of 1: 1000, AF908, Affinity), AKT (dilution of 1: 1000, AF6261, Affinity), GAPDH (dilution of 1: 5000; ab8245, Abcam) for overnight at 4°C. Next, the membrane was washed four times with TBST for 10 min, incubated with Goat Anti-Mouse IgG (H+L) (dilution, 1: 2000; SA00001-1; proteintech, China) or Goat Anti-Rabbit IgG (H+L) (dilution, 1: 2000; SA00001-2; proteintech) secondary antibody for 1 h at RT, washed again four times, and visualized with Western ECL Substrate (Thermo Scientific) for chemiluminescence.
2.9. Rat OA model
Male Sprague-Dawley (SD) rats (10 weeks old) were purchased from Army Medical University (Chongqing, China). All animal experiments were conducted in accordance with guidelines of the Animal Experiments Committee and approved by the Institutional Review Board of Southwest Hospital. The experimental mice were subjected to surgically induced OA by anterior cruciate ligament transection (ACLT) as previously described[20]. The animals were divided into three groups: sham (n = 10), ACLT (n =10), and ACLT +AA (n =10). Rats in ACLT+AA group were followed by intra-articular injection with 0.1 mL of AA (2.5 μg/mL) into the articular cavity once a week for 8 weeks; while rats in ACLT group was injected with 0.1 mL of vehicle (0.9% NaCl) as a control. Food and water were available ad libitum. Rats were maintained under a constant temperature of 20 ± 2°C, a relative humidity of 50% ± 10%, and a 12 h light/dark cycle. At 4 and 8 weeks, 5 rats for each group were sacrificed, and knee joint tissues were collected for further evaluation.
2.10. Macroscopic observation and histological analysis
Macroscopic evaluation was performed by five blinded investigators (LP, YJ, GL, FZ, and LR). The erosion of articular cartilage was graded according to the macroscopic score system[21].
Knee joint samples (n=3) were fixed in 4% v/v paraformaldehyde for 2 days, and tissues were decalcified in 10% wt% EDTA disodium salt dihydrate (GRM1195, neofroxx, Germany) solution for 4 weeks at RT. After that, the samples were dehydrated through an alcohol gradient, cleared, and embedded in paraffin blocks. Frontal serial sections (4 μm thick) across entire joints were obtained and then stained with Safranin-O/Fast Green to assess cartilage destruction. The stained sections were photographed digitally under a microscope. Histologic changes in the medial tibial plateau and medial femoral condyle of knee joints were scored on a scale of 0–6 according to the recommendations of the Osteoarthritis Research Society International (OARSI) scoring system[22].
2.11. Immunohistochemical analysis
Immunohistochemistry (IHC) was performed to evaluate the phenotype of articular chondrocytes. After deparaffinization and hydration with distilled water, the antigen repair was conducted at 37°C for 10 min. Then the tissue slices were penetrated with PBS for 5 min followed with H2O2 treatment for about 20 min, and then blocked for 60 min to avoid the homologous serum.
Sections were incubated overnight at 4 °C with antibodies against the following proteins: COL-II (dilution of 1: 200), MMP-13 (dilution of 1: 100), COL-X (dilution of 1: 80), Runx2 (dilution of 1: 500), COL-Ι (dilution of 1: 200), α-SMA (dilution of 1: 200). After rinsing with PBS, sections were incubated with appropriate biotinylated secondary antibody and horseradish peroxidase-conjugated streptavidin-biotin. Immunoreactivity was visualized with a 3,3′-diaminobenzidine tetrahydrochloride kit (ZSGB Bio, China) followed by counterstaining with methyl green. The presence of antigen in the cartilage was estimated by calculating the number of chondrocytes that stained positive. The total number of chondrocytes and those that stained positive in three central regions of articular cartilage were counted using Image Pro Plus version 5.1 software (Media Cybernetics, USA). The percentage of positive stained cells for the antigen and the relative fold change of different group were then determined.
2.12. Statistical analysis
Data were expressed as mean ± standard deviation (SD). Statistical significance was assessed by one-way analysis of variance (ANOVA) (more than two groups) or unpaired t tests (two groups). P < 0.05 was considered statistically significant.