Human Sample
Human brain sections were obtained from the Department of Forensic Medicine in Nanjing Medical University. The protocols for human research were approved by the Ethics committee of Nanjing Medical University (Permit Number: 2019-889).
Animals
All animal experiments were performed according to the protocols approved by the Animal Core Facility of Nanjing Medical University (IACUC-1601153). The Maged1 KO mice used in this study were provided by the Animal Research Center (Nanjing University, China). Mice were maintained on a C57BL/6 background. Animals were housed in the Experimental Animal Center of Nanjing Medical University on a 12 h light/dark cycle. 8-10-week-old male mice were used. To establish the acute model of Parkinson’s disease, mice were intraperitoneally injected with 20 mg/kg MPTP four times, after 2-hour intervals. Three days after injection, the midbrain and striatum were collected for western blot or immunohistochemistry to detect autophagy-related markers. Four days after injection, behavioral tests were performed. Seven days after injection, tissues were collected for western blot, high-performance liquid chromatography (HPLC), and immunohistochemistry.
Genotyping
The genotype of mice was identified via PCR using genomic DNA obtained from their toes. The primers for genotyping were as follows: Maged1-WT-F: AGATCCTCCTCCAACTCTCG, Maged1-WT-R: GAAAAACCCCACAAGCTTACC. Maged1-KO-F: AAACCACACTGCTCGACCTAGC, Maged1-KO-R: CCAATTTAGACTCCCCCAAGACC. The program was as follows: following initial denaturation for 5 minutes at 94 °C, 30 cycles including denaturation for 40 s at 94 °C, annealing for 30 s at 55 °C, and elongation for 1 minute at 72 °C. The products were electrophoresed on a 1% gel at 120 V.
Behavioral tests
Behavioral tests were performed on the fourth day after MPTP injection. To examine motor balance and coordination, the rotarod test and pole test were used. For the rotarod test, after being handled for 4 consecutive days, mice were trained with 16 revolutions per minute (rpm) for 1 minute on a rotarod apparatus for 3 consecutive days. Each mouse was trained three times a day. On the testing day, mice were tested on the rotarod set at 25 rpm for 60 s and their latency to fall off the rotarod was recorded. Pole test: A 55-cm gold-threaded rod with a diameter of 0.8 cm was used. Mice were placed on the top with their heads oriented upward, and the time for them to turn from the top and descend to the base of the pole was calculated to reflect their motor ability. During the training phase, mice were trained 5 times a day. On the testing day, the time for each mouse to reorient themselves facing downward of the straight bar and descend to the bottom was recorded. Each mouse was tested 5 times and the values were averaged.
Immunohistochemistry
After the mice were deeply anesthetized using pentobarbital, cardiac perfusion was performed with 20 mL cold PBS and 40 mL pre-cooled 4% paraformaldehyde solution. The brains were transferred to 4% PFA and fixed at 4 °C for 24 hours and then transferred to 30% sucrose solution (prepared with PBS) at 4 °C for dehydration until the brain tissues sank to the bottom of the centrifuge tubes. Brains were embedded in optimal cutting temperature compound (OCT) and deep-frozen at -80 °C. Tissues were sectioned to obtain the midbrain or striatum sections (25 µm) for immunohistochemistry. Then, the sections were immersed into an antigen repair solution (C8H8O7·H2O: 0.378g, C6H6Na3O7·2H2O: 2.41g; pH adjusted to 7.4 and a final volume of 1L) and heated for 5-10 minutes in a microwave. Next, the sections were blocked in PBS with 0.3% Triton X-100 and 10% FBS for 2 hours at room temperature (RT). Then, the sections were incubated with the primary antibodies overnight at 4 °C and rinsed with PBS plus 0.1% Triton X-100 for 3×10 minutes the next day. The primary antibodies were washed and the sections were incubated with the corresponding fluorescent secondary antibodies and DAPI in darkness for 2 hours at room temperature. After washing with PBS three times for 10 minutes each, and with 0.1% PBST once, sections were sealed using glycerin solution. Stained sections were observed using a laser confocal microscope (FV-1200, Olympus, Japan).
Antibodies and Reagents
All antibodies and reagents used in this study are listed in detail in Tables S1 and S2.
High-performance liquid chromatography (HPLC)
Tissue levels of DA and its metabolites (DOPAC, HVA) were determined using HPLC. Briefly, the striatum of mice was homogenized in 0.1 M perchloric acid (HClO4) containing 100 mM disodium EDTANa2 and 3.5×10-8 M DHBA, and then centrifuged at 20,000×g for 30 minutes at 4 °C. The supernatants were filtered through a 0.45-mm pore membrane and analyzed for 5-HIA, DA, and DOPAC using HPLC coupled with electrochemical detection.
Cell culture
The SH-SY5Y cell line was a kind gift from Shi Yun (Animal Research Center, Nanjing University, China). Cells were cultured in DMEM/F12 supplemented with 10% fetal bovine serum at 37°C in 5% CO2.
Primary dopaminergic neuron cultures were prepared from the ventral mesencephalon of embryonic day 13.5 (E13.5) fetal mice. Briefly, embryos were obtained and placed in Hanks’ balanced salt solution and dissected to obtain mesencephalon tissue. Next, it was treated with 0.125% trypsin for 5 minutes at 37 °C, followed by neurobasal medium supplemented with 10% FBS. Approximately 2 × 105 cells/mL were seeded on poly-L-lysine-coated coverslips and cultured in 500 μL of neurobasal medium supplemented with 2% B27 and 0.5 mM glutamine. The medium was replaced with fresh medium after 24 hours and the cells were cultured for 7 days before incubation with 200 μM MPP+ for 24 hours. Then, the cells were characterized by immunostaining for Tuj1 and TH.
ReNcell VM cells (purchased from Millipore) were cultured as neurospheres in DMEM/F12 supplemented with 2% B27, 20 ng/mL epidermal growth factor (EGF), and 20 ng/mL basic fibroblast growth factor (bFGF). To label ReNcell with tdTomato, cells were stably transduced with packaged lentivirus vectors to express tdTomato fused with the palmitoylation sequence of growth cone-associated protein (PalmtdTomato). The plasmid was kindly provided by Dr. Bakhos Tannous (Massachusetts General Hospital, Boston, MA, USA). After 5-7 days of proliferation, aggregated cells were collected and dissociated by gentle trituration and replated on laminin-coated coverslips with media without bFGF and EGF. Differentiation was initiated by the addition of 1 mM dibutyryl-cAMP and 2 ng/mL glial cell-derived neurotrophic factor (GDNF). Experiments were conducted 12 days after differentiation.
Plasmid and siRNA transfection
For plasmid or siRNA transfection, SH-SY5Y cells seeded in 35-mm dishes were transfected using Lipofectamine 2000 or Lipofectamine-iMAX according to the manufacturer’s instructions. Twenty-four hours post-transfection, 200 μM MPP+ was added for another 48 hours for downstream experiments. For autophagy assessment, 24 hours after transfection with siRNA-Maged1, cells were further transfected with the GFP-LC3 vector to label autophagosomes for another 24 hours followed by treatment with 200 μM MPP+ for 48 hours. Then, the cells were fixed and immunostained using anti-GFP. Immunofluorescence was determined as described above. siRNA-Maged1 were purchased from GenePharma. Sequence for si-Maged1: GGUCAAGUACUUGAUGCUUTT, normal control (NC): UUCUCCGAACGUGUCACGUTT.
Western blot
Mice were deeply anesthetized with pentobarbital and decapitated. Brains were collected and dissected rapidly on ice to obtain the midbrain and striatum, which were then frozen in liquid nitrogen and stored at -80°C until further use. When needed, tissues were homogenized in 300-500 μL lysis buffer containing protease and phosphatase inhibitors. The homogenates were incubated for 30 minutes on ice and centrifuged at 12,000 rpm for 15 minutes at 4 °C. The supernatant protein was collected and 5 × SDS loading buffer was added. After boiling at 95 °C for 8 minutes, equivalent amounts of protein (40 µg) were separated using 8-12% SDS-PAGE gels and transferred to PVDF membranes. Membranes were blocked in 5% milk in TBS with 1% Tween (TBST) for 1 hour and were incubated overnight with primary antibodies diluted in TBST with 1% bovine serum albumin. The following day, after 3×8 minutes washes with TBST, membranes were incubated with secondary antibodies for 1 hour at RT. After 3×10 minutes washes with TBST, protein signals were detected using an ECL chemiluminescence kit and the luminescence was visualized using a Tanon luminescent imaging system. Image J was used to obtained quantified results. SH-SY5Y cells were washed with cold PBS three times and incubated in 200 μL lysis buffer containing protease and phosphatase inhibitors for 30 minutes and centrifuged at 12,000 rpm for 15 minutes at 4 °C. Western blot was performed as described earlier.
CCK8 assay
To evaluate cell viability using CCK8 assay, cells were seeded in a 96-well plate (1×104 cells/well). After MPP+ treatment for 48 hours, cells were exposed to fresh culture medium containing 10% CCK8 and then incubated at 37 °C for an additional 1.5 hours. The absorbance was measured at 450 nm.
Propidium iodide (PI) staining assay
Apoptosis of SH-SY5Y cells was determined using the PI staining assay and flow cytometry. Briefly, after the indicated treatment, cells were collected and stained with PI before flow cytometry analysis. About 10,000 cells were collected and analyzed using the FACS cytometer (BD Bioscience).
Transmission electron microscopy
Collected cell pellets were fixed in sodium cacodylate buffer (0.1 M; pH 7.4), 2.5% glutaraldehyde, and 0.25 M sucrose at 4 °C, then post-fixed in 1% osmium tetroxide for 1 hour at 4 °C. Samples were dehydrated, embedded in plastic, and cut into in 70-nm sections for microscopy. Sections were subsequently poststained using 5% uranyl acetate and viewed using a Tecnai G2 transmission electron microscope.
Statistical analysis
All data are presented as mean ± SE. Statistical significance between 2 groups was calculated using a two-tailed Student’s t-test for parametric variables and Mann-Whitney’s U test for nonparametric variables. One-way ANOVA with Tukey’s posthoc tests was used for comparisons among groups. P < 0.05 was considered statistically significant. Randomization and blind analyses were used whenever possible.