2.1 Experimental animals
45 female Sprague-Dawley(SD) rats(200-220g), 8 week of age, were purchased from the Animal Experimental Center of Chongqing Medical University. The rats were bred and housed with cages(5 animals per cage) in controlled environment(12-h light-dark cycle), and room temperature 22℃, and allowed free access to chow and water. The study protocol was proved by the ethics committee of Chongqing Medical University (20141230).
2.2 hAMSCs isolation and culture
Amniotic membrane specimens were obtained from the University-Town Hospital of Chongqing Medical University and the Obstetrics Department of the First Affiliated Hospital of Chongqing Medical University. The isolation and culture methods of hAMSCs followed the previous hAMSCs extraction method of research group. hAMSCs were isolated from the amniotic membranes of healthy pregnant women at day cesarean section after informed constent was obtained from them. The amniotic membrane was minced to fragments of about 1×1 mm in size, mixed them in 0.25% trypsin (Beyotime C0201, China) and digested in a water bath at 37°C with shaking for 30 min, then used 0.1% type I collagenase (Meilun MB2686, China) to digest in a water bath at 37°C with shaking for 1 h. Then, put the separated hAMSCs into Dulbecco’s Modified Eagle Medium (DMEM) nutrient mixture F-12(DMEM/F12) (Gibco) supplemented with 10% fetal bovine serum (FBS, PAN ES) in an incubator at 37°C with 5% CO2(Thermo Scientific, USA)[18]. Changed half medium after 24h, changed it completely after 72h, and took the 3rd generation cell after the cell fusion reaches more than 80% , identified and stored until use (Figure1 A).
2.3 Preparation of endometrial conditioned medium
12-week-old female SD rats were fully anesthetized with 5% chloral hydrate (10 ml/kg, Biosharp, China), and the bilateral uteruses were harvested under an aseptic environment and placed on ice. The serosa was carefully removed, the uteruses were dissected along its long axis and were cut into transverse segments of 0.3cm in length. Then, the segments were weighed and added with pre-cooled DMEM/F12 at a concentration of 100 g/L, which was sealed and mixed at 4 ° C with shaking in shaker for 2h, and then placed in the refrigerator at 4 ° C overnight. Next day, the mixture was centrifuged at 18000g for 30 min at 4 ° C. The supernatant was collected by using a sterile filter into a new centrifuge tube and stored at -20 ° C in the refrigerator[19].
2.4 Construction of Intrauterine adhesion model
In order to prevent the experiment from being affected by operating, the chemical injury method (95% alcohol injury method) was selected to damage the endometrium, and a stable and repeatable Intrauterine adhesion model was established. According to vaginal smear analysis, rats at diestrus were selected and fully anesthetized with 5% chloral hydrate (10 ml/kg), then their lower abdomen was disinfected with iodophor and was longitudinally incised from 3cm above the vaginal orifice. The incision was about 2 cm in length. The abdomen was inserted layer by layer to expose the uterus (Figure1 B1). A small round needle with silk thread was used to suture the avascular area of the mesometrium, which was 0.5 cm above the Y-shaped intersection point of the right uterus. After the whole uterus was ligated, an assistant clamped the ovarium of the right uterus with flat forceps. Then, 95% alcohol was injected into the uterine cavity using a 1 ml needle until the uterus was full of alcohol ; The change of uterine color was observed. When the uterus became white (about 3min later) (Figure1 B2), the 95% alcohol was drawn off and the uterine cavity was washed with normal saline. Then the assistant released the flat forceps and removed the silk thread. Restored the uterus to its normal position and sutured the muscles and skin of rats. We reentered the abdomen at week1, week 2, and week 4 after modeling and observed the general morphological changes of the uterine tissue on the modeling side (Figure1 B4). Lastly, we collected uterine specimens, performed histochemical staining, and evaluated the modeling effect.
2.5 Experimental design and treatment protocol
45 SD female rats were randomized equally into five groups, including sham group, IUA group, IUA+Estradiol(E2) group, IUA+hAMSCs group, and IUA+Estradiol(E2)+hAMSCs group. In sham group: ligated the uterus at the same position as the modeling group and clamped with flat forceps without injecting alcohol. After 3 min, loosened the flat forceps, then removed the silk thread to restore the anatomical position of the uterus and closed the abdomen. In IUA group: 9 rats were selected and established the uterine adhesion model, and were performed without any intervention or treatment. In IUA+E2 group: at the end of the second week after severe IUA modeling in SD rats, estrogen (estrogen tablets purchased from the University-Town Hospital of Chongqing Medical University) was ground into powder and dissolved in water for intragastric administration, 0.1 mg/kg, daily once. In IUA+hAMSCs group: at the end of the second week after severe IUA modeling in SD rats, opened abdomen at the original incision in the lower abdomen of rats, took out the right uterus, and injected hAMSCs into the uterus with a 1 ml sterile syringe where the diameter of the uterus became smaller and the texture became hard (resuspend 1*107 hAMSCs in 200ul PBS buffer). Then, uterine tissue were welling with the injection of hAMSCs, and closed the abdomen after hAMSCs treatment. In IUA+E2+hAMSCs group: at the end of the second week after severe IUA modeling in SD rats, hAMSCs injection and estrogen gavage in the same operation as in before group.
2.6 Sampling
In each group, 3 rats were sacrificed on the end of week 1, week 2, and week 4 after operations, and left and right uterine tissues were taken. Hematoxylin-eosin (H&E) and Masson trichrome staining were used to evaluate the specimens and immunohistochemical to detect the expression of key proteins (Notch1-4, Jagged1, Jagged2, Hes1, NICD) in the E-cadherin and Notch pathways.
2.7 Histochemical staining and image analysis
Uterine tissues were collected from the four groups at each prespecified period and then were fixed, embedded and sectioned in 4% paraformaldehyde (Biosharp, China). The operations of HE staining and Masson staining were followed instructions (HE staining and Masson staining kit: Solarbio, China). HE staining calculated the number of endometrial glands, Masson staining calculated the percentage of fibrosis area (the total area of endometrial interstitial fibrosis divided by the sum of the area of endometrial interstitium and glands), the collagen fibers were blue under the microscope. The three-step immunohistochemical method was used to detect the expression of E-cadherin, Notch1, Notch2, Notch3, Notch4, Jagged1, Jagged2, NICD, and Hes1 in endometrial tissue. (immunohistochemistry kit, SP9001, Zhongshan Jinqiao, China). The major procedures are as follows: the sections were de-waxed to water and immersed in Phosphate buffered saline (PBS) for 3 times (5 min each time). EDTA antigen retrieval solution (AR0023,BOSTER,China) was used for antigen retrieval and then the sections were immersed in PBS for 3 times (5 min each time). After that, the sections were removed of endogenous peroxidase and immersed in PBS for 3 times (5 min each time). Then, the sections were blocked with the use of goat anti-rabbit serum, incubated with primary antibody, each section were separately treated with E-cadherin (3195T, CST,USA), Notch1(3608S, CST, USA), Notch2 (5732, CST, USA), Notch3 (ab23426,Abcam,USA), Notch4 (ab199295, Abcam, USA), Jagged1 (70109, CST, USA), Jagged2 (2205, CST, USA), NICD (ab52301, Abcam, USA), Hes1 (ab108937, Abcam, USA), which were diluted in the maximum dilution proportion using primary antibody dilution buffer overnight at 4°C and immersed in PBS for 3 times (5min each time). The treated sections were subsequently incubated using secondary antibody (biotin-labeled goat anti-rabbit IgG at 37°C for 60min) and immersed in PBS for 3 times (5min each time). Next, the horseradish peroxidase-labeled streptavidin solution was added dropwise for 15min, after which DBA (Zhongshan Jinqiao, China) staining was conducted and observed for positive staining under microscope. The sections were then rinsed with ultrapure water and counterstained with hematoxylin stain (G1080, Solarbio, China) for 20s. Thereafter, they were washed and alkalized with saturated lithium carbonate and observed under microscope. In the end, regular dehydration, transparency and mounting were conducted. The positive expression is brown-yellow, the final results were determined according to the ratio of IOD value to area size. Image J software was used to measure the data of the pictures. Three specimens were randomly selected in each group, and three high-power fields of view were randomly selected for each slice to take pictures, and the average value was taken for subsequent comparison.
2.8 In-vitro induction and differentiation of hAMSCs
The third-generation hAMSCs were routinely cultured in a 6-well plate(Corning, USA). When the cell fusion reached 30%-40%, the induction group medium was replaced with DMEM/F12 containing 2% FBS + (10 ng/mL Transforming growth factor-β1 (TGF-β1)(AF-100-21C-10)+10 ng/mL Epidermal Growth Factor(EGF)(AF-100-15-100)+10 ng/mL Platelet derived growth factor-BB (PDGF-BB)(AF-100-14B-50))+ 1x10-6mol/Lβ-estradiol (E8140, Solarbio, China) + endometrial conditioned medium, while the control group, hAMSCs were cultured with 2% FBS in DMEM/F12 alone. The medium was changed every other day, and cultured under induction for 1, 3, 5, and 7 days.
2.9 Real-time fluorescence quantitative PCR
The total RNA in experimental group and control group was extracted from the 6-well plates according to the cell RNA extraction reagent instructions, using cytokeratin7(CK-7), cytokeratin8(CK-8), cytokeratin18(CK-18), cytokeratin19(CK-19), and E-Cadherin as non-specific primers, according to TAKARA reverse transcription reagent Box instructions for reverse transcription. And the CK-7 sequence:upstream5'-TGGATGCCCTGAATGATGAGAT-3',downstream5'-GGGAGCGACTGTTGTCCA-3';CK-8sequence:upstream5'-CCATTAAGGATGCCAACGCCAA-3',downstream5'-TTCATCAGCTCCTGGTACTCAC-3'; CK-18 sequence:upstream 5'- ATGGGAGGCATCCAGAACGA-3',downstream5'-TCTCCAAGTGCTCCCGGATT-3',CK-19sequence:upstream5'-ACTACACGACCATCCAGGAC -3', downstream 5'- GCAGAGCCTGTTCCGTCTCA -3'; E-Cadherin sequence : upstream 5'- ACCATTCAGTACAACGACCCAA-3', downstream 5'- GCCTTCCTACAGACGCCAG-3',GAPDH sequence:upstream5'- AACAGCCTCAAGATCATCAGC -3', downstream 5'- ATGAGTCCTTCCACGATACCAA -3'. PCR reaction system: the total amount of each capillary reaction system is 20μL. PCR reaction amplification conditions included four steps: step 1, pre-denaturation at 95°C for 30sec; step 2, PCR reaction at 95°C for 5sec; or at 60°C for 30sec, 40 cycles in total; step 3, dissociation. GADPH was used as an internal reference, calculate expression level of the target genes which were CK-7, CK-8, CK-18, CK-19, E-Cadherin mRNA based on the Ct value, 3 replicate wells were set for each gene. repeated 3 times and calculated the relative expression of each group of genes 2-△△Ct value.
2.10 Immunofluorescence
Immunofluorescence was used to detected the expression changes of NICD and Hes1 before and after hAMSCs induction. The third-generation hAMSCs were inoculated in a 24-well culture plate (Corning, USA), and the experiment was set up in 2 groups, inducted group and control group. The cells were took and cultured in a 24-well plate, climbing piece (801010, NEST) were placed in each well according to the size of the climbing piece, first several drops of medium were added to each well before placing climbing piece, and then place it on the droplet and press it tightly to make the climbing piece and the culture dish stick together by the tension of the culture medium for the prevention of the floating of slides at the time of cell suspension being added, which could result in cells covering two sides of the slide. Morphological changes and growth of cells were observed every day by an inverted phase contrast microscope (Nikon, Japan). After 5 days of culture, the differences in the expression of NICD and Hes1 were detected by immunofluorescence. Immunofluorescence staining procedures are as follows: the medium was extracted from the 24-well plate and were washed with PBS for 3 times (5min each time); the cells were fixed with 4% paraformaldehyde for 15 min and were washed with PBS for 3 times (5min each time); then the cells were fixed with 0.1% Triton X-100 (sigma V900502) for 15 min; next, they were blocked with 10% goat serum (AR004) which was added in a drop wise manner and incubated at room temperature for 30 min without washing; thereafter, the cells were added anti-rabbit NICD monoclonal antibody in a 1:100 ratio and anti-rabbit Hes1 monoclonal antibody in a 1:1000 ratio. The control group was added with PBS, incubated overnight at 4 ° C in the dark and washed with PBS for 3 times (5min each time); goat anti-rabbit IgG Alexa Fluor fluorescent secondary antibody(ab150077, Abcam, USA) were then added in a 1:100 ratio and incubated in the dark at 37 ° C for 2h and were washed with PBS for 4 times (5min each time); the nuclei were counterstained with 0.5 μg/ml DAPI fluorescent dye (AR1177, Boster Bio, China) and placed in the dark for 10 min, which was washed subsequently with PBS for 3 times to remove the remaining DAPI. After that, 20 μl anti-fluorescent quencher (Meilun MA0222) was added for mounting. The slides were observed and photographed under a fluorescence microscope. Positive NICD was green fluorescence and nuclei were blue fluorescence.
2.11 Recombinant adenovirus vector AdR-dnNotch1, Adr-Jag1, Ad-RFP transfection
AdR-dnNotch1, Adr-Jagged1, Ad-RFP were purchased from denovo company, Ad-RFP were used as a virus control. In order to determine the relationship between the Notch signaling pathway and the induction and differentiation of hAMSCs, Adr-dnNotch1 (inhibited group), Adr-Jaagged1 (activated group) and Ad-RFP (control group) were added to hAMSCs induction and differentiation medium to irreversibly interfere with the activation of the pathway. The medium was changed every other day, continuously cultured for 36 and 72h. And real-time fluorescence quantitative PCR was used to detect total RNA, repeated 3 times.
2.12 Flow cytometry analysis
The old medium was aspirated by the cells in inhibited group, activated group and control group , washed the bottom of the bottle with PBS, and digested the cells into single cells with 0.25% trypsin (Beyotime, China). Then, added PBS buffer(pre-cooled), centrifuged at 1000r/min (Thermo Scientific, USA) for 5min, discarded the supernatant. Next, added PBS to resuspend the cells, centrifuged at 1000r/min for 5min, discard the supernatant, and repeat twice. Finally, 1×106 cells were resuspended in PBS 0.1ml PBS buffer, 500ul of pre-cooled 75% ethanol (Chongqing Chuandong Chemical Co., Ltd., China) was slowly added, and shaking when adding to avoid cell aggregation, and then used flow cytometry to analyze the percentage of cells in G0/G1, S and G2/M phases. All reactions were carried out in three stages.
2.13 Statistical analysis
Data was analyzed with SPSS 22.0 software and expressed as `x ±s. Normal analysis and homogeneity of variance test were performed. Independent sample t test was used for comparison between two groups, single-factor analysis of variance was used for multiple group comparisons, and multiple comparisons between groups were performed by LSD method. The inspection level p = 0.05.