Human samples
The cervical carcinoma tissue microarrays (HUteS154Su01-M-060, 119 cases) were purchased from Shanghai Outdo Biotech (Shanghai, China). All procedures were performed under consensus agreements and in accordance with the Chinese Ethical Review Committee. The clinical and biological characteristics of the patients were described in Table 1.
Cell lines and culture
The human cervical carcinoma cell lines (AV3, C33A, Ca Ski, HeLa) were obtained from the American Type Culture Collection (Manassas, USA). The normal cervical squamous epithelial cell lines (H8) were provided by Professor Zhonghan Yang, from Sun Yat-sen University. Cell lines were authenticated by Cellcook Biotech Co., Ltd, (Guangzhou, China). All these cells were cultured in RPMI1640 (Gibco, New York, USA, Cat. No. 61870044) and supplemented with 10% FBS (Gibco, Uruguay, 10270-106) at 37°C in a humidified incubator containing 5% CO2.
RNA isolation and qRT-PCR
Total RNA was extracted using TRIzol (Thermo Scientific, 15596026) according to the manufacturer’s protocol. First-strand cDNA synthesis was performed using 500 nanograms of total RNA, and the qRT-PCR analysis system was performed using iQ SYBR Green Supermix and the iCycler Real-time PCR Detection System (Bio-Rad, USA). β-actin was used for normalization. Primer sets for SYBR Green analysis of human FUBP1 and β-actin are as follows: FUBP1 forward: TCTTTCTCAGCCCTAACCCA; FUBP1 reverse: CTTGTCCAAGAGCCATCTCCAT; β-actin forward: GCACTCTTCCAGCCTTCCTT; β-actin reverse: GTTGGCGTACAGGTCTTTGC.
Immunohistochemistry staining
Immunohistochemistry was performed according to a standard protocol as described previously. The slides were incubated with anti-FUBP1 antibodies (Merck Millipore, ABE1330) at 4°C overnight. On the second day, the slides were treated with HRP-conjugated secondary antibody and the antigen-antibody complex was visualized by incubation with the DAB kit. Finally, all sections were counterstained with hematoxylin and photographed through a slide scanner (Axio Scan. Z1, ZEISS, Oberkochen, Germany). The degree of immunostaining was determined by the staining index (SI). The SI was calculated as the product of the grade of tumor cell proportions and the staining intensity score. The tumor cell proportions were graded as follows: 0, no positive tumor cells; 1, < 10% positive tumor cells; 2, 10-35% positive tumor cells; 3, 35-75% positive tumor cells; and 4, > 75% positive tumor cells. Staining intensity was scored as follows: 1, no staining; 2, weak staining (light yellow); 3, moderate staining (yellow-brown); and 4, strong staining (brown). Accordingly, the protein expression as evaluated by SI has a possible score of 0, 1, 2, 3, 4, 6, 8, 9, 12, or 16. Samples with SI ≥ 6 were determined as high expression, and those with SI < 6 were determined as low expression.
Cell Counting Kit-8 (CCK8)
Cell proliferation was measured via cell viability with a Cell Counting Kit-8 (Dojindo, Japan). cervical carcinoma cells were seeded into 96-well plates and cultured for 24, 48 and 72 h. Then, 10 μl CCK8 reagent was added to 96-well plates and incubated for 2 h. The absorbance (OD450 nm) was measured using a microplate reader (TECAN, Switzerland) and calculated.
Colony formation assay
Cervical carcinoma cells were plated in 6-well dishes (500 cell/dish) and then incubated for 2 weeks for colony formation. After 14 days, cell colonies were then fixed in 4% polyformaldehyde and stained with 0.1% crystal violet. All colonies were counted separately for each sample, and the relative colony numbers were calculated.
EdU staining
EdU staining was performed by the protocol of EdU staining kit (KeyGEN, Nanjing, China), then the pictures were taken with ZEISS Axio Imager Z1 (ZEISS, Jena, Germany).
Plasmids, retroviral infection, and transfection
All lentiviral vectors contained the puromycin resistance gene. Vectors encoding FUBP1 plasmid and FUBP1 shRNA were purchased from Hanbio Biotechnology Co., Ltd, (Shanghai, China). After transfections 48 hours, confirmation of overexpression or interference was carried out using qRT-PCR.
Annexin V/propidium iodide flow cytometric analysis
Cervical carcinoma cell staining with Annexin V and PI was carried out using an Annexin V-FITC/PI Apoptosis Detection kit (Merck, Germany). A total of 1x106 cells were incubated at 37°C for 30 minutes before centrifugation to collect the cell pellet, then resuspended in a Ca2+-enriched binding buffer and analysed using a Beckman Coulter flow cytometry. Data were calculated using Cell Quest software.
TCGA Data Analysis
The RNASeq data and clinical data for cervical carcinoma were obtained from The Cancer Genome Atlas (TCGA) databases (https://genome-cancer.ucsc.edu). For the association of FUBP1 expression with survival, patient vital status (dead and alive) was used as a surrogate end-point and patients dichotomized by FUBP1 expression. Kaplan-Meier survival curves were constructed, and the log-rank test was carried out using univariate analysis. Gene Set Enrichment Analysis (GSEA) was manipulated to predict the biological processes based on FUBP1 high and low expressed phenotype. A leading edge analysis was performed by GSEA 4.0.3 to elucidate key genes related to selected genes sets. EnrichmentMap plugin in Cytoscape 3.7.1 software was utilized with the following parameters: p-value cutoff = 0.005; similarity coefficient cutoff = 0.5. The protein-protein interaction (PPI) networks were constructed using The Search Tool for the Retrieval of Interacting Genes (STRING), which is a publicly available software for assessing the interaction between proteins and proteins (https://string-db.org/).
Statistical analysis
The variability of the data is presented as the SD (mean±SD) and was assessed with Student’s t test between two groups. For multiple groups, significant differences were determined using one-way ANOVA. The relationships between FUBP1 expression and clinicopathological characteristics were determined using the χ2 test. Survival curves were plotted using the Kaplan-Meier method and compared using the log-rank test. Statistical significance was defined at P<0.05.