Reagents
Polymerase chain reaction (PCR) primers (Sangon Biotech Co., Ltd., Shanghai, China), Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan), TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Carlsbad, CA, U.S.A), PrimeScript™ RT Master Mix Kit (036a, Takara Biotechnology Co., Ltd., Dalian, China), TB Green® Premix Ex Taq™ Kit (420a, Takara Biotechnology Co., Ltd., Dalian, China), Phosphorylase Protease Inhibitor Mixture (Thermo Fisher Scientific, Inc., Waltham, Ma, U.S.A), DAPI (Sigma Aldrich, Merck KGaA, St Louis, MO, U.S.A), PVDF membranes (EMD Millipore, CA, U.S.A)Primary antibodies against myc-tag (cat. no. 71d10; rabbit mAb), B-cell lymphoma 2 (Bcl-2)-associated X (Bax; cat. no. d3r2m; rabbit mAb), IRE1α (cat. no. 14c10; rabbit mAb), protein disulfide isomerase (cat. no. c81h6; rabbit mAb), binding immunoglobulin protein (BiP; cat. no. c50b12; rabbit mAb), C/EBP homologous protein (CHOP; cat. no. l63f74; mouse mAb), Protein kinase RNA-like endoplasmic reticulum kinase (PERK; cat. no. c33e10; rabbit mAb), Caspase 3 (cat. no. 9662; rabbit mAb), Caspase 9 (cat. no. 9508; rabbit mAb), Cleaved Caspase 9 (cat. no. 9507; rabbit mAb), poly (ADP-ribose) polymerase (PARP; cat. no. 46d11; rabbit mAb) and β-actin (cat. no. d6a8; rabbit mAb) were purchased from Cell signaling Technology, Inc., Denver, MA, USA. Anti-IRE1α (cat. no. ab37073; rabbit mAb), Anti-gasdermin D (GSDMD; cat. no. ab219800; rabbit mAb), Anti-receptor-interacting protein (RIP; cat. no. ab202985; rabbit mAb), Anti-SOX9 (cat. no. ab185966; rabbit mAb) and Anti-UFM1 (cat. no. ab109305; rabbit mAb) were purchased from Abcam, Cambridge, UK. Anti-DDRGK1 (cat. no. 21445-1-AP; rabbit mAb) primary antibodies were purchased from ProteinTech Group, Inc., Chicago, IL, USA. Anti-Bcl-2 (cat. no. AF6139; rabbit pAb) and Anti-aggrecan (cat. no. DF7561; rabbit pAb) were purchased from Affinity Biosciences, Changzhou, China. Anti-hemagglutinin (HA)-tag (cat. no. abs137982; rabbit pAb) and anti-FLAG tag (cat. no. abs120265; rabbit pAb) primary antibodies were purchased from Absin Bioscience, Inc., Shanghai, China.
Culture of ATDC5 cells
ATDC5 chondrocytes are immortalized cell lines purchased from Shanghai Fuheng Biological Company (cat. no. FH0378). The cells were cultured in Dulbecco's modified Eagle medium F12 (DMEM/F12) with 5% fetal bovine serum (FBS) and 1% penicillin and streptomycin (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA) at 37℃ with 5% CO2.
DDRGK1 overexpression and knockout in ATDC5 cells
DDRGK1 overexpression (O/E; pcSLenti-CMV-DDRGK1-3xFLAG-PGK-Puro-WPRE) virus and O/E control (O/E-C; pcSLenti-CMV-3xFLAG-PGK-Puro-WPRE), in addition to viruses for DDRGK1 knockout, produced using the SgNC (GCACTACCAGAGCTAACTCA; pLenti-U6-spgRNA v2.0-CMV-EGFP) and SgDDRGK1(CCCCGGCGTCGGAGGGACTT; pLenti-U6-spgRNA v2.0(Ddrgk1)-CMV-EGFP) and Cas9 virus (pLenti-CMV-Puro-P2A-3Flag-espCas9_1.1), were purchased from Shanghai Heyuan Biological Company, Shanghai, China. For transfection, ATDC5 chondrocytes were seeded into a six-well plate at a density of 1x 105 cells per well. On day 2, O/E-C, O/E and Cas9 virus were added with a MOI of 20. On day 3, the media was changed, and the cells were screened with puromycin (cat. no. BS111; Biosharp, Hefei, China) at a concentration of 5 µg/ml. On day 5, the O/E-C, O/E cells were determined by western blotting of DDRG1 and the Cas9 cells were then transfected with the SgNC or SgDDRGK1 viruses with a MOI of 20 for the second transfection. Among them, on day 7 the Cas9/SgNC and Cas9/SgDDRGK1 cell lines were then subjected to monoclonal culture. Firstly, 100 µl DMEM/F12 medium with 5% FBS and 1% penicillin and streptomycin were added to each well in a 96-well plate before 1,000 cells in 100 µl DMEM/F12 medium were added to A1 and mixed thoroughly. Subsequently, 100 µl DMEM/F12 medium with cells was transferred from A1 to B1, then repeatedly into H1. We then used an eight-channel pipette to transfer 100 µl medium with cells from the first line to the second line and finally into the last line in a 1:1 ratio. The cells were cultured in DMEM/F12 medium with 10% FBS and 1% penicillin and streptomycin at 37℃ with 5% CO2.
High-density culture and pellet culture
To evaluate chondrocyte differentiation, 1.5x 105 ATDC5 cells (SgNC or SgDDRGK1) were resuspended in 10 µl medium and seeded into a 24-well plate. Cells were allowed to adhere at 37˚C for 1 h, before 0.5 ml DMEM/F12 medium containing 10 ng/ml insulin-transferrin-selenium (ITS) and 2% FBS was added. After 24 h at 37˚C, the cells were stimulated with or without thapsigargin (Tg, 6.25 nM; Apexbio; cat. no. B6614; Houston, TX, USA) and the medium was changed every 2 days. After 9 days at 37˚C, the micromasses were stained with alcian blue for 24 h at room temperature (RT).
For the pellet culture, 1.5x 107ATDC5 cells (SgNC or SgDDRGK1) were centrifuged as a pellet in the bottom of a 15-ml centrifuge tube, which was filled with the Mesenchymal Stem Cell Chondrogenic Differentiation Medium (Cyagen Biosciences, Inc., Santa Clara, CA, USA). The medium was refreshed every 3 days. After 21 days of culture at 37˚C, the pellets were collected via tweezer and fixed in 4% paraformaldehyde (PFA) for 5 h at RT and then embedded in optimal cutting temperature compound (Sakura Finetek USA, Inc.). The pellets were then stored at -80˚C overnight and cut to a 20-µm thickness using a freezing microtome (Leica Microsystems GmbH)
RNA extraction and reverse transcription-quantitative PCR (qPCR) analysis
According to the manufacturer’s protocols, TRIzol Reagent was used to isolate total RNA from tissues and cells. First strand complementary DNA (cDNA) was reverse transcribed from the extracted RNA using a PrimeScript™ RT Master Mix Kit (036a, Takara Biotechnology Co., Ltd., Dalian, China). TB Green Premix Ex Taq Kit (Takara bio, Inc., Otsu, Japan) was used to perform qPCR in the Applied Biosystems QuantumStudio 6 Flex Real-Time PCR system (Thermo Fisher Scientific, Inc., Waltham, MA, USA) per the following conditions: Denaturation at 95˚C for 30 sec; 40 cycles of 95 ˚C for 3 sec and 60 ˚C for 34 sec; and then 95 ˚C for 15 sec, 60 ˚C for 60 sec and finally, 95 ˚C for 15 sec. Specific primer pairs were designed using NCBI blast and the sequences are provided in Table 1. GAPDH gene expression was used as the internal controls. Target gene expression levels were determined using the 2−ΔΔCq method[24].
Table 1
Primer sequences used for RT-qPCR.
Gene
|
Accession Number
|
|
5’→3’
|
IRE1α
|
NM_023913.2.
|
F
R
|
CAATCGTACGGCAGTTGGAG
CTCCCGGTAGTGGTGTTTCT
|
BiP
|
NM_022310.3
|
F
R
|
GAAAGGATGGTTAATGATGCTGAGAAG
GTCTTCAATGTCCGCATCCTG
|
CHOP
|
NM_007837.4
|
F
R
|
CATACACCACCACACCTGAAAG
CCGTTTCCTAGTTCTTCCTTGC
|
BAX
|
NM_007527.3
|
F
R
|
CTGGATCCAAGACCAGGGTG
CCTTTCCCCTTCCCCCATTC
|
BCL2
|
NM_009741.5
|
F
R
|
AGCATGCGACCTCTGTTTGA
GCCACACGTTTCTTGGCAAT
|
Col2a1
|
NM_001113515.2
|
F
R
|
AGGTGTTCGAGGAGACAGTG
CAACAATGCCCCTTTGACCA
|
SOX9
|
NM_011448.4
|
F
R
|
TGAAGATGACCGACGAGCAG
GGATGCACACGGGGAACTTA"
|
DDRGK1
|
NM_029832.2
|
F
R
|
GAGCACGAGGAGTACCTGAAA
TCCTGAGTCCTTAGGCCCATC
|
Cell viability test
CCK-8 was used to evaluate cell viability of DDRGK1 O/E and O/E-C, SgNC and SgDDRGK1 ATDC5 cells. The cells were seeded into a 96-well plate at a density of 3,000 cells per well the day before treatment with thapsigargin (Tg, 6.25 nM; Apexbio; cat. no. B6614; Houston, TX, USA) for 24, 48, 72 and 96 h at 37˚C. ATDC5 chondrocytes were cultured in DMEM/F12 supplemented with 5% FBS and 1% penicillin and streptomycin at 37℃ with 5% CO2. The cell culture medium was changed every 2 days. At the end of the experiment, fresh 100 µl medium containing 10 µl CCK-8 reagent was added into each well prior to incubation at 37˚C for 1 h. Medium containing the CCK-8 reagent added to wells without cells was designated as the blank group whereas untreated cells were designated as the control group. Absorbance at 450 nm (as measured by optical density; OD) in each well was measured using the Infinite M200 Pro microplate reader (Tecan Group, Ltd., Mannedorf, Switzerland).
Co-immunoprecipitation (Co-IP) assay
293T cells or SgNC and SgDDRGK1 ATDC5 chondrocytes were transfected with Flag-PLVC, Flag (HA)-DDRGK1, HA (Flag)-IRE1α SgNC, HA (Flag)-IRE1α ΔC, HA (Flag)-IRE1α ΔN, HA (Flag)-IRE1α luminal domain (LD), HA (Flag)-IRE1α cytosolic domain (ICD), Flag-IRE1α Del468, Flag-IRE1α Del469 and HA-UFM1 plasmids (synthesized, purchased from Shanghai Ai Bosi Biological Technology Co., Ltd.) using lipofectamine 3000 (cat. no. L3000015; Thermo Fisher Scientific, Inc., Waltham, MA, USA) before they were washed three times with phosphate-buffered saline (PBS). Subsequently, 1.2 ml RIPA lysis buffer with 12 µl protease inhibitor, protein phosphatase inhibitor A + B and PMSF (Roche Diagnostics GmbH, Mannheim, Germany) was added to the cells and incubated for 20 min at 4˚C. After centrifugation at 13000 x g for 15 min at 4˚C, to 200 µl of the protein supernatant 50 µl protein loading buffer (5X) was added and this sample was boiled at 99˚C for 10 min whereas the remaining 1,000 µl of the protein supernatant was incubated with 30 µl Flag-tagged (or HA-tagged) magnetic beads (Sigma-Aldrich, Merck KGaA, St Louis, MO, U.S.A.) at 4˚C overnight. The next day, the magnetic beads were isolated from protein supernatant by Magnet Frame (Selleck Chemicals, China), and then washed three times with Tris-buffered saline (TBS) at 4˚C for 10 min with protease inhibitor, protein phosphatase inhibitor A + B and PMSF before being boiled at 99˚C for 5 min with 50 µl 1X RIPA lysis bufferto extract the proteins.
UFM1 modification assay
293T cells were transfected with Flag-PLVC, Flag-IRE1α, HA-UFM1, Myc-DDRGK1, Myc-UFM1 specific ligase 1 (UFL1) and Myc-UFM1-conjugating enzyme 1 (UFC1) or were transfected with Flag-PLVC, Flag-IRE1α, HA-UFM1, si-DDRGK1, Myc-UFL1 and Myc-UFC1 plasmids (synthesized, purchased from Shanghai Ai Bosi Biological Technology Co., Ltd.) using lipofectamine 3000 (cat. no. L3000015; Thermo Fisher Scientific, Inc., Waltham, MA, USA). After culturing for 48 h, cells were washed three times with PBS before the protein samples were extracted using 1.2 ml NETT. In total, 200 µl lysate was used as input and the remaining 1,000 µl was incubated with 30 µl Flag-tagged magnetic beads at 4˚C overnight. The next day, the beads were boiled with 50 µl 1X loading RIPA lysis buffer at 99˚C for 10 mins and finally subjected to 10 or 12.5% SDS-PAGE electrophoresis buffer followed by immunoblot analysis.
Ubiquitylation modification assay
293T cells were transfected with Flag-PLVC, HA-IRE1α and Flag-Ubiquitin, Flag-PLVC and Flag-Ubiquitin or with Flag-PLVC, Flag-IRE1α, HA-UFM1, Myc-DDRGK1, Myc-UFL1, Myc-UFC1 and Flag-Ubiquitin plasmids (synthesized, purchased from Shanghai Ai Bosi Biological Technology Co., Ltd.) using lipofectamine 3000 (cat. no. L3000015; Thermo Fisher Scientific, Inc., Waltham, MA, USA). After culturing for 40 h, cells were stimulated with MG132 (10µM; cat. no. S2619; Selleck Chemicals, China) for 8 h at 37˚C and then washed three times with PBS. After using 1.2 ml NETT to extract protein, 200 µl lysate was used as input whilst the remaining 1,000 µl samples were incubated with 30 µl HA-tagged magnetic beads at 4˚C overnight. The samples were then boiled at 99˚C for 10 min and finally subjected to 10 or 12.5% SDS-PAGE electrophoresis buffer followed by immunoblot analysis.
Hoechst stain for apoptosis
SgNC and SgDDRGK1 ATDC5 chondrocytes were seeded into a six-well plate at a density of 3 x 104 cells per well. The next day, cells were fixed with 4% PFA for 5 min at RT and washed with PBS three times. Hoechst stain solution (5µg/ml; Beyotime Institute of Biotechnology) were added for 5 min at RT and washed with PBS for three times, before the cells were imaged using fluorescence microscopy (Leica Microsystems GmbH) at x10 and x20 magnification.
Flow cytometry
According to the manufacturer's protocol, flow cytometry was used to evaluate the effect of 1x 106 DDRGK1 overexpression and knockout cells on the apoptosis rate after staining with Annexin V, 633 Apoptosis Detection Kit (cat. no. AD11; Dojindo Molecular Technologies, Inc., Kumamoto, Japan). FACSCalibur Flow Cytometer (BD Biosciences) was used to count ≥20,000 events. The percentage of cells in the upper right quadrant (Q2; annexin V and PI positive) and the lower right quadrant (Q3: annexin V positive and PI negative) was used to quantify the apoptosis rate.
Western blotting
Total protein was extracted from the ATDC cells using RIPA lysis buffer supplemented with phosphatase and protease inhibitors (Roche, Basel, Switzerland). The protein was quantified by BCA assay (Thermo Fisher Scientific, Inc.) and then equal amounts of the extracted protein were separated (20-30 µg) in a 4-20% SurePAGE™ gel and transferred onto 0.22µm PVDF membranes (MilliporeSigma). The membranes were blocked with 5% bovine serum albumin (BSA)-TBS-Tween 20 (TBST) at room temperature for 1 h and then incubated with primary antibodies (diluted 1:1,000 in 5% BSA) against myc-tag, Bax, IRE1α, PDI, BiP, CHOP, PERK, Caspase 3, Caspase 9, Cleaved Caspase 9, PARP, β-actin, GSDMD, RIP, SOX9, UFM1, DDRGK1, Bcl-2, Aggrecan, HA-tag, FLAG-tag at 4˚C overnight. The next day, all membranes were washed with TBST and incubated with the anti-rabbit IgG (H + L) (dylight)™ secondary antibody (cat. no. 5151; DyLight™ 800 4X PEG Conjugate; Cell Signaling Technology, Inc.; 1:5,000) at room temperature for 1 h in the dark. The membranes were extensively washed in TBST before the protein bands were detected using a Li-Cor Odyssey Fluorescence Imaging System (Li-COR Biosciences, Lincoln, NE, USA). Intensity of the protein immunoreactive bands was measured using the Image Pro Plus 6.0 software (Media Cybernetics, Inc.) with intensity of the β-actin band used as internal reference.
Immunofluorescence staining
The pellet culture was sectioned into 20-µm thick frozen sections for histological evaluation. The frozen sections were washed with PBS three times at RT to remove the OCT solution and stained with Safranin O-Fast green (cat. no. G1053; Servicebio, Wuhan, China) and hematoxylin and eosin dyes (cat. no. G1001; Servicebio, Wuhan, China) at RT for 2-5 min, in accordance with the manufacturer’s protocols. For immunofluorescence staining, the frozen sections were defrosted at room temperature for 30 min, washed with PBS three times and incubated at 37˚C in an antigen retrieval buffer (Roche Diagnostics, Basel, Switzerland) for 30 min. An auto-fluorescence quenching agent was added to the sections for 5 min at RT and blocked with blocking buffer at room temperature for 30 min. The sections were then incubated with primary antibody (1:100 dilution) IRE1α (cat. no. ab37073; rabbit mAb), SOX9 (cat. no. ab185966; rabbit mAb), CHOP (cat. no. l63f74; mouse mAb), DDRGK1 (cat. no. 21445-1-AP; rabbit mAb) and Anti-aggrecan (cat. no. DF7561; rabbit pAb) in a wet box at 4˚C overnight. The next day, the slices were washed with PBS and incubated with the Alexa-Fluor® 594-conjugated secondary antibody (cat. no. 8889; anti rabbit; 1:500; Cell Signaling Technology, Inc., Danvers, MA, USA) in the dark at room temperature for 50 min. The sections were washed with PBS and incubated with a DAPI solution (Sigma Aldrich, Merck KGaA, St. Louis, MO, USA) in the dark for 10 min at RT to stain the nuclei. After a final wash with PBS, the samples were air-dried and sealed with anti-fluorescence quenching tablets. A fluorescence image was then taken using the Leica DM4000 B fluorescence microscope (Leica Microsystems GmbH) at a x10 magnification, and the integrated optical density (IOD)/DAPI was measured by Image Pro Plus 6.0 software (Media Cybernetics, Inc.).
TUNEL assay
The pellet frozen sectons were washed with PBS three times at RT to remove the OCT solution and stained with Fluorescein (FITC) Tunel Cell Apoptosis Detection Kit (cat. no. G1501; Servicebio, Wuhan, China) according to the manufacturer’s protocols. A fluorescence image was then taken using the Leica DM4000 B fluorescence microscope (Leica Microsystems GmbH) at a x10 magnification, and the TUNEL-positive cells was measured with the following formula: TUNEL-positive cells/total number of cells × 100% by Image Pro Plus 6.0 software (Media Cybernetics, Inc.).
Statistical analysis
Three independent experiments were performed on all data. The data were expressed as the mean ± standard deviation. SPSS 19.0 software (IBM Corp, Armonk, NY, USA) was used to perform two-tailed unpaired Student’s t-test or one-way ANOVA with Tukey’s post hoc test on the data. Unless otherwise specified, P<0.05 was considered to indicate a statistically significant difference.