The Effect of Fertilized Egg White on Growth, Migration, Differentiation and Genes Expression Profile in SW480 Colon Cancer Cell Line

doi:10.21203/rs.3.rs-953583/v1

Download PDF

Research Article

The Effect of Fertilized Egg White on Growth, Migration, Differentiation and Genes Expression Profile in SW480 Colon Cancer Cell Line

https://doi.org/10.21203/rs.3.rs-953583/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Embryonic microenvironments influence cancer stem cells properties, which leads to anti-cancer effects. Therefore, the current study investigates the effects of fertilized egg white, as an embryonic/fetal microenvironment, on survival, apoptosis, self-renewal characteristic, stemness properties, and migration capacity of SW480 colon cancer cells and 5-fluorouracil (5FU) resistant subgroup.

Methods: MTT and Flow cytometry was used to study the cell viability and cell cycle analysis. Clonogenic, spheroid formation, and wound healing assays were used to evaluate cancer cells' self-renewal, stemness properties, and migration capacity. RT-PCR was performed to analyze NANOG, c-MYC, E-cadherin, and NDRG1 mRNA expression.

Results: The SW480 colon carcinoma cell line and SW480-5FU chemo-resistant subpopulation cells were subjected to Fertilized Egg White (FEW). FEW decreased cell viability and increased the percentage of the sub-G1 stage in both cell lines. In addition, colony and spheroid formations were decreased in both cells, and the FEW inhibited the migration. Expression of NANOG and c-MYC were reduced in both cells. E-cadherin and NDRG1 expression increased in SW480 cells.

Conclusion: FEW decreased the SW480 colon cancer cell line and the SW480-5FU chemo-resistant subpopulation growth and migration. Also, by the changes observed in gene expression and spheroid formation, we suggest the possibility of decreased stemness properties and induction of differentiation following fertilized egg white treatment.

Molecular Biology

Fertilized Egg White

Colorectal cancer

Microenvironment

Cancer stem cell

Stemness

Despite huge attempts to find cancer initiation and progression mechanisms, it remains the second leading cause of death globally [1]. Conventional cancer therapies, including chemo and radiotherapy, have adverse side effects and tumor cells resist them [2]. Evidence shows a compensatory mechanism that promotes proliferation in neighboring cells, enforced by apoptotic cells [3]. Even in successful therapies, remission may occur aggressively after an apparent cancer-free period [4, 5]. The adverse effects of traditional therapies persuaded scientists to search for new molecular targets and design new therapeutic approaches [4, 5].

According to the cancer stem cell paradigm, tumor cells arise from a subpopulation of tumor bulk, which drives tumorigenesis and progression [6]. Cells in this category share numerous characteristics with adult and embryonic human stem cells, specifically self-renewal, stemness, differentiation to other types of tumor cells, and resistance to conventional medications [6]. The Gene expression pattern of aggressive cancer stem cells shows similarities with adult and embryonic stem cells, particularly in stemness and differentiation-related genes expression [7]. Unlike stem cells, cancer cells are uncontrolled in expressing stemness and differentiation factors, such as c-Myc, NANOG, Sox 2, NDRG1, E-cadherin, and developing pathway including Notch, Hedgehog, and Wnt, resulting in the progression of cancer bulk [8, 9].

Despite similarities between embryos and cancer development, and between embryonic stem cells and cancer stem cells, cancer incidence in the embryo and fetus is sporadic [10, 11]. Some studies also have shown that embryonic niches could reverse the tumorigenic state of cancer cells [10, 11], and the malignancy of aggressive melanoma cells declines when transferred to chick embryos [12]. Also, the injection of cancer cells in the different fetal stages of mouse fetus impaired cancer cell growth [13].

Egg whites are well known for providing all the nutrients needed to form and grow normal embryos, including amino acids, lipids, vitamins, elements, and growth factors [14]. The protein within egg white migrates to the developing chick embryos, potentially establishing that eggs have a direct role in embryogenesis, in addition to nourishing and storing protein, and can create an embryonic niche that can be an anticancer [15, 16].

This study aimed to investigate the effect of fertilized egg white (FEW) as an in vitro embryonic/fetal microenvironment on human colorectal SW480 cell line growth, stemness and differentiation. Also, we looked at a subpopulation of SW480 that were made resistant to the chemotherapy agent 5-Fluorouracil (5-FU). We exposed cells to the FEW environments and studied the growth rate, cell cycle, colony, spheroid formations, migration, and expression of genes involved in stemness and differentiation.

2.1 Preparation of Egg white (EW)

The fertilized 9-day-old chicken egg was purchased from the chicken incubation farm. Egg white was separated in a sterile condition. In all following experiments, EW was dissolved in the DMEM medium to reach a final concentration of 10% v/v concentration, similar to FBS concentration in media.

2.2 Cell culture

The SW480 human colorectal carcinoma line was obtained from the Cell Bank of Pasteur Institute's Tehran. The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (GIBCO, Life Technologies), cell culture medium containing 10% fetal bovine serum (FBS) (GIBCO, Life Technologies), 1% glutamine (Sigma), and 1% penicillin/streptomycin antibiotic (Sigma) at 37°C and 95% humidity in a 5% CO2 humidified incubator. The cells were passaged after reaching appropriate confluency (80-90%), and media was changed every other day.

2.3 Establishment of 5FU resistant SW480 colon cancer cell line

According to our previous study, the MTT assay determined the IC50 value of 5-fluorouracil (5FU) [17]. In brief, SW480 cells were exposed to the increasing doses (0, 10, 50, 100, 150, 200, 300µM) of 5FU for 72h. MTT assay was performed, and the dose-dependent diagram was created by GraphPad prism. The IC50 dose for 5FU was calculated as 20 µM. After that, an almost fully confluent (90%) monolayer of SW480 cells was treated with 20 µM (the IC50 dose) of 5FU. Following 72 h incubation, the medium was discarded, and the plates were cultured under the standard condition for two to three weeks. When cells reached their logarithmic phase, they were used for the experiments.

2.4 Flow cytometry cell analysis

To ascertain the effect of fertilized egg white on cell cycle and apoptosis, we used the Flow cytometry cell analysis. The cells were incubated overnight in a 12-well plate and then exposed to fertilized egg white for three days (72h). Then, cells were collected, rinsed with PBS two times, and fixed by 70% ethanol at -20˚C overnight. The following day, the cells were rinsed with PBS containing 0.5 µM/ml RNase (Sigma, St. Louis, MO, USA) for 30 min. Then, cells were stained with 50 µg/ml propidium iodide (Sigma, St. Louis, MO, USA) for 30 minutes in the dark. Finally, the FACScan flow cytometer (Becton Dickinson) analyzed the Cell cycle.

2.5 Colonospheres (spheroid) formation

10⁴ cells per well were cultured in a 24-well plate covered with poly-HEMA to make it a low attachment. The media used was serum-free DMEM supplemented with 30 ng/mL epidermal growth factor (EGF) (Royan Institute, Iran), 30 ng/mL fibroblast growth factor (FGF) (Royan Institute, Iran), and pen/strep antibiotic 1% with and without FEW. In addition, EGF and FGF were added every other day for eight days. Finally, the produced colonospheres were counted under the microscope.

2.6 Clonogenic assay

100 cells/well were seeded in a 12-well plate in triplicate and incubated for 24h at 37°C. Cells were treated with 10% fertilized egg white. After two weeks, Acetic acid/methanol (1:7) was added to fix colonies, and they were stained using 0.05% crystal violet (Sigma Chemical Company, Louis, MO, USA) at 25°C for 2h. Plates were washed with water and kept at 25˚C to dry. Finally, Colonies that had greater than fifty cells were selected and counted under a microscope. The clonogenic capacity was determined based on the number of colonies formed in proportion to the number of seeded cells.

2.7 Scratch wound healing assay

The wound-healing assay was used to evaluate cell migration. The cells were cultured in a six-well plate for two days to reach 95% confluency, and then the plate was incubated overnight with no-FBS to inhibit proliferation. Gently and slowly, the monolayer was using a sterile tip. Cells were rinsed with PBS to eliminate debris, and the medium containing FEW was added. The images were captured at 0, 48 h, and 72 h following treatment and were analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA) (10). Cell migration that was calculated as the percentage of gap closure:

% of gap closure = [(At = 0 h – At = Δ h)/ At = 0 h] × 100%

At =0h is the area of gap measured at time 0 after scratching, and At = Δh is the area of gap measured later [18].

2.8 RNA extraction and Real-time PCR analysis

According to the manual, the total RNA of cells was isolated with RNX-plus Solution (Sinaclon, Tehran, Iran). Purification was evaluated by determining the 260/280 nm absorbance ratio at 260 nm and 260/280 nm. Then, 3 µg extracted RNA was used to generate cDNA by Frist Strand cDNA Synthesis Kit (2-step RT-PCR kit, Vivantis, USA). The real-time PCR was performed for NANOG, c-MYC, E-cadherin, NDRG1, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (as the endogenous control) mRNA expression using SYBR Green (Bio-Rad). Table 1 lists the sequences of the primers used.

Table 1

Primer sequences
Gene	Primer sequence
NANOG	F:AACTCTCCAACATCCTGAACCTC R: CGTCACACCATTGCTATTCTTCG
c-MYC	F:GCATACATCCTGTCCGTCCAAG R:TTCCTTACGCACAAGAGTTCCG
E-cadherin	F:TGCTAATTCTGATTCTGCTGCTC F:TCAAGTCAAAGTCCTGGTCCTC
NDRG1	F: TTCCTGCTCCCTAACCTTTCG R: ATTCACTCTGACCAAACTTCCTATG
GAPDH	F:CATCAAGAAGGTGGTGAAGCAG R:GCGTCAAAGGTGGAGGAGTG

c-MYC, highly expressed in the colon cancer stem cells, causes greater tumor sphere-forming efficiency, apoptosis resistance, invasion, migration, and tumorigenesis in cancer cells [19]. NANOG induces stem-like phenotype in colon cancer cells, similar to Nanog in prostate cancer, Oct4 in melanoma, and Sox2 in breast cancer [20].

2.9 Statistical analysis

Results are presented as mean ± SD. Data were analyzed with a Student t-test, and P<0.05 indicates a statistically significant difference. Gap closure in wound healing assay was measured by ImageJ software. Figures were generated using GraphPad Prism version 4 software (GraphPad Software, Inc., La Jolla, CA, USA).

3.1 Effect of fertilized egg white Treatment on Cell Viability

The colorimetric MTT assay was performed to assess the effect of FEW on SW480 and SW480-5FU cellular viability, using MTT assay after 72h treatment. As demonstrated in Figure 1, fertilized egg white significantly decreased SW480 cells (51%) and SW480-5FU cells (46%) viability compared to control.

3.2 Effect of fertilized egg white on Cell Cycle

To further investigate the inhibitory effect of fertilized egg white on SW480 and SW480-5FU, we used flowcytometry cell cycle analysis using propidium iodide (PI) (Sigma, USA) staining. The results demonstrated that treatment increased the percentage of the sub-G1 stage in both SW480 cell line (59 ± 26.87 vs. 17.5 ± 5.26) (P<0.05) and SW480-5FU (67 ± 0.0 vs. 6.0 ± 2.82) (mean ± SEM) (Figure 2).

3.3 Effect of fertilized egg white on colonosphere (spheroid) formation

To evaluate the presence and self-renewal of cancer stem cells, the effect of fertilized egg white on SW480 and SW480-5FU cells self-renewal was assessed by spheroid formation following 8 days incubation. The result showed that fertilized egg white decreased spheroid formation in both SW480 cells (% 35.96) and SW480-5FU cells (% 30.05) (Figure 3).

3.4 Effect of fertilized egg white on colony formation

The colony formation assay was used to semi-quantitatively study the effects of fertilized egg white on self-renewal and prolonged cell proliferation. SW480 and SW480-5FU cells were treated with FEW for two weeks, and colonies greater than fifty cells were counted. Fertilized egg white significantly reduced the colony formation after 13 days by 76% and % 80.5 in SW480 and SW480-5FU cells, respectively (P<0.05) (Figure 4).

3.5 Effect of Fertilized egg white on cell migration

We performed the scratch wound healing assay to evaluate the cell migration induced with FEW treatments. The percentage of wound area closure was calculated at 48 and 72h. FEW caused approximately 50% gap area after 72 h compared to control in both cells, inhibiting cell migration. The results are presented in Figure 5.

3.6 Effect of fertilized egg white treatment on gene expression

Growth and migration inhibition of SW480-5FU cells persuaded us to check the stemness and differentiation genes expression induced by 72h exposure to FEW. c-MYC, highly expressed in the colon cancer stem cells, causes greater tumor sphere-forming efficiency, apoptosis resistance, invasion, migration, and tumorigenesis in cancer cells [19]. NANOG induces stem-like phenotype in colon cancer cells, similar to Nanog in prostate cancer, Oct4 in melanoma, and Sox2 in breast cancer [20]. E-cadherin is one of class of type-1 transmembrane protein that originated from the epithelia and has an key role in the epithelial to mesenchymal transition in cancer progression [21].

As shown in Figure 6, our data demonstrated that FEW reduced c-MYC and NANOG expression in SW480 cells compared to the control cells. At the same time, the expression of E-cadherin and NDRG1 (3.73 fold) increased. In the SW480-5FU cells, NANOG and c-MYC expression were also decreased following FEW treatment. However, E-cadherin and NDRG1 expression did not change after treatment with FEW.

The present study provides preliminary data showing that fertilized egg white, as an embryonic/maternal microenvironment, exerted an inhibitory effect on the growth of colorectal carcinoma cell line (SW480), induced apoptosis, and decreased self-renewal and stemness-related colony and spheroid formation, inhibited migration in both SW480 cells and SW480-5FU cells. In addition, the genes involved in the stemness and differentiation of cells were modulated.

The Stemness properties of cancer cells are an essential feature in the prolonged proliferation, invasion, and metastasis of cancer [22]. We demonstrated that FEW inhibited the proliferation of SW480 cells by ceasing cells at the G0/G1 cell cycle and decreasing the stemness-related sphere formation and self-renewal characteristics of both SW480 and SW480-5FU cells. The analysis of stemness genes of c-MYC and NANOG in colorectal cancer cells also allowed us to suggest the possibility of a decrease in stemness properties by FEW. Some evidence indicated that abnormal expression of stemness genes promotes tumor growth, increases chemo-resistance, and enhances tumor invasion [23]. Previous studies have reported that the unfertilized egg white did not significantly affect the survival rate of the breast cancer cells (MCF-7, MDA-MB-231) [24] and TCam-2 seminoma cells [25]. However, similar to the present study, Klf4, c-MYC, and NANOG expression was diminished following egg white treatment [24]. Furthermore, ovomucin and lysozyme, two components of egg white, have been shown to reduce proliferation, metastasis, and angiogenesis of cancer cells [26–30]. Ovotransferrin increased caspase 9, and 6 changed the morphology of cell and mitochondrial membranes resulting in inhibition of proliferation and induction of apoptosis in colon cancer cells (HCT-116), in contrast to breast cancer cells (MCF-7‌) [26]. Therefore, the reduction of proliferation, induction of cell cycle arrest, and reduction of stemness induced by FEW in the present study could be partially due to the components of egg white mentioned above.

Metastasis is a major cause of death from cancer. Metastatic primer cells belong to a subset of stem cells that migrate to other tissues by expressing epithelial to mesenchymal transition (EMT) markers and other superficial markers involved in the invasiveness and metastasis of cancer cells [31]. Embryonic microenvironments can inhibit cell invasion and metastasis by inducing differentiation and increasing the expression of differentiation markers [32]. In the present study, FEW decreased migration in both SW480 and SW480-5FU cells. E-cadherin and NDRG1 levels were also significantly higher in SW480 cells, indicating that differentiation was induced in the subpopulation of SW480 cells that escaped the apoptosis that was induced by FEW. The results from this study are similar to findings in earlier studies using unfertilized egg white in seminoma and breast cancer cells MCF-7 and MDA-MB-231[24, 25], which demonstrated that egg white microenvironment can inhibit EMT [24].

As the embryonic/maternal microenvironment, fertilized egg white might perform a fundamental role in decreasing growth, migration, self-renewal and stemness, downregulation of stemness genes, and upregulation of differentiation genes in SW480 colon cancer cells. However, additional experiments are required to elucidate the exact mechanism of growth and metastatic inhibitory effect of FEW microenvironments. It also needs to be investigated which components of FEW mediated these stemness mitigation and differentiating induction by fertilized egg white.

Funding: This work was supported by National Nutrition and Food Technology Research Institute and Faculty of Nutrition and Food Technology, Shahid Beheshti University of Medical Sciences, Tehran, Iran under Grant [Project No. 768, Contract No. 311/1051].

Conflict of Interest: No potential conflict of interest was reported by the authors.

Ethical Review: This study does not involve any human or animal testing.

Authorship: conception and design of the study: Hamid Zand, Katayoun Pourvali, acquisition of data: Hadi Monji. Analysis and interpretation of data: Hadi Monji, Katayoun Pourvali, Arman Ghorbani. Drafting the article: Hadi Monji, revising: Katayoun Pourvali.

Acknowledgement: The present authors would like to express their gratitude to colleagues in Cellular and Molecular department of National Nutrition and Food Technology Research Institute, Faculty of Nutrition Science and Food Technology Shahid Beheshti University of Medical Sciences and Shahid Beheshti University of Medical Sciences, Tehran, Iran for supporting this study.

Loomans-Kropp HA, Umar A (2019) Cancer prevention and screening: the next step in the era of precision medicine. NPJ precision oncology 3:3. doi:10.1038/s41698-018-0075-9
Schirrmacher V (2019) From chemotherapy to biological therapy: A review of novel concepts to reduce the side effects of systemic cancer treatment (Review). Int J Oncol 54(2):407–419. doi:10.3892/ijo.2018.4661
Ryoo HD, Gorenc T, Steller H (2004) Apoptotic cells can induce compensatory cell proliferation through the JNK and the Wingless signaling pathways. Developmental cell 7(4):491–501. doi:10.1016/j.devcel.2004.08.019
Leary M, Heerboth S, Lapinska K, Sarkar S (2018) Sensitization of Drug Resistant Cancer Cells: A Matter of Combination Therapy. Cancers (Basel) 10(12):483. doi:10.3390/cancers10120483
Chen HHW, Kuo MT (2017) Improving radiotherapy in cancer treatment: Promises and challenges. Oncotarget 8(37):62742–62758. doi:10.18632/oncotarget.18409
Ayob AZ, Ramasamy TS (2018) Cancer stem cells as key drivers of tumour progression. J Biomed Sci 25(1):20. doi:10.1186/s12929-018-0426-4
Sell S (2004) Stem cell origin of cancer and differentiation therapy. Crit Rev Oncol/Hematol 51(1):1–28. doi:https://doi.org/10.1016/j.critrevonc.2004.04.007
Schoenhals M, Kassambara A, De Vos J, Hose D, Moreaux J, Klein B (2009) Embryonic stem cell markers expression in cancers. Biochem Biophys Res Commun 383(2):157–162. doi:10.1016/j.bbrc.2009.02.156
Pourvali K, Monji H (2021) Obesity and intestinal stem cell susceptibility to carcinogenesis. Nutrition Metabolism 18(1):1–15
Bailey CM, Kulesa PM (2014) Dynamic interactions between cancer cells and the embryonic microenvironment regulate cell invasion and reveal EphB6 as a metastasis suppressor. Molecular cancer research: MCR 12(9):1303–1313. doi:10.1158/1541-7786.mcr-13-0673
Hendrix MJ, Seftor EA, Seftor RE, Kasemeier-Kulesa J, Kulesa PM, Postovit LM (2007) Reprogramming metastatic tumour cells with embryonic microenvironments. Nature reviews Cancer 7(4):246–255. doi:10.1038/nrc2108
Díez-Torre A, Andrade R, Eguizábal C, López E, Arluzea J, Silió M, Aréchaga J (2009) Reprogramming of melanoma cells by embryonic microenvironments. Int J Dev Biol 53(8-10):1563–1568. doi:10.1387/ijdb.093021ad
Astigiano S, Damonte P, Fossati S, Boni L, Barbieri O (2005) Fate of embryonal carcinoma cells injected into postimplantation mouse embryos. Differ Res Biol Divers 73(9-10):484–490. doi:10.1111/j.1432-0436.2005.00043.x
Lee JH, Paik HD (2019) Anticancer and immunomodulatory activity of egg proteins and peptides: a review. Poultry science 98(12):6505–6516. doi:10.3382/ps/pez381
Akazawa T, Ogawa M, Hayakawa S (2019) Migration of chicken egg-white protein ovalbumin-related protein X and its alteration in heparin-binding affinity during embryogenesis of fertilized egg. Poult Sci 98(10):5100–5108. doi:https://doi.org/10.3382/ps/pez335
Sugimoto Y, Sanuki S, Ohsako S, Higashimoto Y, Kondo M, Kurawaki J, Ibrahim HR, Aoki T, Kusakabe T, Koga K (1999) Ovalbumin in Developing Chicken Eggs Migrates from Egg White to Embryonic Organs while Changing Its Conformation and Thermal Stability *. J Biol Chem 274(16):11030–11037. doi:10.1074/jbc.274.16.11030
Shakery A, Pourvali K, Ghorbani A, Fereidani SS, Zand H (2018) Beta-Hydroxybutyrate Promotes Proliferation, Migration and Stemness in a Subpopulation of 5FU Treated SW480 Cells: Evidence for Metabolic Plasticity in Colon Cancer. Asian Pac J Cancer Prev 19(11):3287–3294. doi:10.31557/APJCP.2018.19.11.3287
Yue PY, Leung EP, Mak NK, Wong RN (2010) A simplified method for quantifying cell migration/wound healing in 96-well plates. J BioMol Screen 15(4):427–433. doi:10.1177/1087057110361772
Zhang HL, Wang P, Lu MZ, Zhang SD, Zheng L (2019) c-Myc maintains the self-renewal and chemoresistance properties of colon cancer stem cells. Oncology letters 17(5):4487–4493. doi:10.3892/ol.2019.10081
Zhang J, Espinoza LA, Kinders RJ, Lawrence SM, Pfister TD, Zhou M, Veenstra TD, Thorgeirsson SS, Jessup JM (2013) NANOG modulates stemness in human colorectal cancer. Oncogene 32(37):4397–4405. doi:10.1038/onc.2012.461
Li S, Qin X, Chai S, Qu C, Wang X, Zhang H (2016) Modulation of E-cadherin expression promotes migration ability of esophageal cancer cells. Sci Rep 6:21713. doi:10.1038/srep21713 https://www.nature.com/articles/srep21713#supplementary-information
Aponte PM, Caicedo A (2017) Stemness in Cancer: Stem Cells, Cancer Stem Cells, and Their Microenvironment. Stem Cells Int 2017:5619472–5619472. doi:10.1155/2017/5619472
Koo BS, Lee SH, Kim JM, Huang S, Kim SH, Rho YS, Bae WJ, Kang HJ, Kim YS, Moon JH, Lim YC (2015) Oct4 is a critical regulator of stemness in head and neck squamous carcinoma cells. Oncogene 34(18):2317–2324. doi:10.1038/onc.2014.174
D'Anselmi F, Masiello MG, Cucina A, Proietti S, Dinicola S, Pasqualato A, Ricci G, Dobrowolny G, Catizone A, Palombo A, Bizzarri M (2013) Microenvironment promotes tumor cell reprogramming in human breast cancer cell lines. PloS one 8(12):e83770. doi:10.1371/journal.pone.0083770
Ferranti F, D'Anselmi F, Caruso M, Lei V, Dinicola S, Pasqualato A, Cucina A, Palombo A, Ricci G, Catizone A, Bizzarri M (2013) TCam-2 seminoma cells exposed to egg-derived microenvironment modify their shape, adhesive pattern and migratory behaviour: a molecular and morphometric analysis. PloS one 8(10):e76192–e76192. doi:10.1371/journal.pone.0076192
Ibrahim HR, Kiyono T (2009) Novel Anticancer Activity of the Autocleaved Ovotransferrin against Human Colon and Breast Cancer Cells. J Agric Food Chem 57(23):11383–11390. doi:10.1021/jf902638e
Oguro TO, Asano Y, Ebina G, Watanabe T, K (2001) Ultrastructural and immunohistochemical characterization on the effect of ovomucin in tumor angiogenesis. Japanese Journal of Clinical Electron Microscopy 33(2):89–99
Sava G (1989) Reduction of B16 melanoma metastases by oral administration of egg-white lysozyme. Cancer Chemother Pharmacol 25(3):221–222. doi:10.1007/bf00689588
Sava G, Ceschia V, Pacor S, Zabucchi G (1991) Observations on the antimetastatic action of lysozyme in mice bearing Lewis lung carcinoma. Anticancer research 11(3):1109–1113
Watanabe K, Tsuge Y, Shimoyamada M, Ogama N, Ebina T (1998) Antitumor Effects of Pronase-Treated Fragments, Glycopeptides, from Ovomucin in Hen Egg White in a Double Grafted Tumor System. J Agric Food Chem 46(8):3033–3038. doi:10.1021/jf9800615
Scheel C, Weinberg RA (2012) Cancer stem cells and epithelial-mesenchymal transition: concepts and molecular links. Semin Cancer Biol 22(5-6):396–403. doi:10.1016/j.semcancer.2012.04.001
Kulesa PM, Kasemeier-Kulesa JC, Teddy JM, Margaryan NV, Seftor EA, Seftor RE, Hendrix MJ (2006) Reprogramming metastatic melanoma cells to assume a neural crest cell-like phenotype in an embryonic microenvironment. Proc Natl Acad Sci USA 103(10):3752–3757. doi:10.1073/pnas.0506977103

Download PDF

Version 1

posted

You are reading this latest preprint version

The Effect of Fertilized Egg White on Growth, Migration, Differentiation and Genes Expression Profile in SW480 Colon Cancer Cell Line

Status:

Version 1

Abstract

Figures

1 Introduction

2 Material And Methods

2.1 Preparation of Egg white (EW)

2.2 Cell culture

2.3 Establishment of 5FU resistant SW480 colon cancer cell line

2.4 Flow cytometry cell analysis

2.5 Colonospheres (spheroid) formation

2.6 Clonogenic assay

2.7 Scratch wound healing assay

2.8 RNA extraction and Real-time PCR analysis

2.9 Statistical analysis

3 Results

3.1 Effect of fertilized egg white Treatment on Cell Viability

3.2 Effect of fertilized egg white on Cell Cycle

3.3 Effect of fertilized egg white on colonosphere (spheroid) formation

3.4 Effect of fertilized egg white on colony formation

3.5 Effect of Fertilized egg white on cell migration

3.6 Effect of fertilized egg white treatment on gene expression

4 Discussion

5 Conclusion

Declarations

References

Status:

Version 1