A Duplex SYBR Green I-based Real-time Polymerase Chain Reaction Assay for Rapid Detection of Canine Kobuvirus and Canine Circovirus

doi:10.21203/rs.3.rs-960132/v1

Download PDF

Research Article

A Duplex SYBR Green I-based Real-time Polymerase Chain Reaction Assay for Rapid Detection of Canine Kobuvirus and Canine Circovirus

https://doi.org/10.21203/rs.3.rs-960132/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Canine Kobuvirus (CaKoV) and Canine Circovirus (CaCV) are viruses that infect dogs causing diarrheal symptoms that are very similar. However, there is no clinical method to detect a co-infection of these two viruses.

Results: In this study, a duplex SYBR Green I-based quantitative real-time polymerase chain reaction (PCR) assay for the rapid and simultaneous detection of CaKoV and CaCV was established. CaKoV and CaCV were distinguished by their different melting temperature which was 86℃ for CaKoV and 78℃ for CaCV. The assay was highly specific, with no cross-reactivity with other common canine viruses and demonstrated high sensitivity. The detection limits of CaKoV and CaCV were 8.924 × 10¹ copies/μL and 3.841 × 10¹ copies/μL, respectively. The highest intra- and inter-assay Ct value variation coefficients (CV) of CaKoV were 0.40% and 0.96%, respectively. For CaCV, the highest intra- and inter-assay Ct value variation coefficients were 0.26% and 0.70%, respectively. In 57 clinical samples, positive detection rates of CaKoV and CaCV were 8.77% (7/57) and 15.79% (9/57), respectively. The co-infection rate was 7.02% (4/57).

Conclusions: The duplex SYBR Green I-based real-time PCR assay established in this study is a fast, efficient, and sensitive method for the simultaneous detection of the two viruses and provides a powerful tool for the rapid detection of CaKoV and CaCV in clinical practice.

Large Animal Medicine

Small Animal Medicine

Canine kobuvirus

Canine circovirus

duplex SYBR Green I

Real-time PCR

1. The study establishes a novel assay for simultaneous detection of canine kobuvirus and canine circovirus.

2. SYBR Green І-based duplex real-time qPCR method was established with high sensitivity, specificity and reliability.

3. The study provides a tool that could be beneficial for clinical diagnostics of canine kobuvirus and canine circovirus infection as well as future research on the virus.

Canine Kobuvirus (CaKoV) is a novel single-strand positive-sense RNA virus belonging to the Picornaviridae virus family[1]., with a genome of 8.1–8.2 Kb. It contains one 7,332-7,341 nucleotides (NT) open read frame (ORF) that encodes 2,442-2,475 amino acids (AA)[2, 3]. CaKoV was identified in a feces sample of a diarrhea dog brought in from the United States in 2011[4], and has since been identified in the United Kingdom, Italy, South Korea, Tanzania and Japan[1, 5–7]. CaKoV is widespread in China, it was first detected in 2015 in northeast China[8], and has been subsequently identified in southwest and estern China[2, 9]. CaKoV exists in a wide range of body parts, including the digestive system, cerebellum, amygdala and liver[10]. However, CaKoV is currently considered a pathogen associated with intestinal diseases; epidemiological investigations have shown that it has been detected both in dogs with diarrhea and in healthy dogs[11], suggesting that there may be a hidden infection of the virus, giving it a large transmission advantage.

Canine Circovirus (CaCV) is a single-stranded, non-capsule DNA virus belonging to the circovirus family[12]. It has two ORFs that encode replicase proteins and capsid proteins, respectively[13]. It was first reported in the United States in 2012[14], and has also been reported in China[15]. CaCV infects dogs of different ages, especially young dogs, with high infection rates, and also infects carnivores, such as wolves and badgers[16]. CaCV causes hemorrhagic enteritis in dogs, though this conclusion is controversial[17]. Notably, CaCV may play a role as a co-infectious factor in the development of diarrheal diseases[17].

CaKoV and CaCV are viruses that infect dogs causing diarrheal symptoms that are very similar. However, there is no clinical method to detect a co-infection of these two viruses. Therefore, it is necessary to establish a simple, sensitive and rapid method for simultaneous detection of these two viruses. Fluorescent quantitative polymerase chain reaction (PCR) technology has the advantages of high specificity, high sensitivity and good reproducibility, which results in reduced reaction time and intuitive results. Dual real-time quantitative fluorescence PCR is a method of rapid diagnosis that may be used to identify two kinds of viruses based on a difference in the melting temperature (Tm) value caused by the difference in GC content of the amplified fragments.

In this study, to effectively detect CaKoV and CaCV in dogs, a duplex SYBR Green I-based quantitative real-time PCR assay for CaKoV and CaCV was established.

2.1 Viruses and nucleic acid extraction

The CaKoV RNA and CaCV DNA genomes were extracted from positive fecal samples using the TIANamp Virus DNA/RNA kit (Tiangen, Beijing, China), according to the manufacturer’s instructions. Then, the CaKoV RNA genome was converted to cDNA using the PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa, Kusatsu, Japan). The following viral strains were used in this study: CaKoV, CaCV, canine astrovirus (CaAstV), canine distempervirus (CDV), canine coronavirus (CCV), and canine parvovirus (CPV).

2.2 Preparation of standard plasmids

The 3D of CaKoV and the Rep of CaCV were used as template DNA. Target fragments have been PCR-amplified using primers shown in Table 1 (CaKoV-F/CaKoV-R and CaCV-F/CaCV-R). Products were cloned into the pMD-19T vector in accordance with the manufacturer’s protocol and transformed into Escherichia coli DH5α cells. Recombinant plasmids were extracted using the EasyPure Plasmid MiniPrep kit (TransGen Biotech, Beijing, China) and named pMD-19T-CaKoV and pMD-19T-CaCV, respectively. General Biosystems (Chuzhou, China) sequenced the recombinant plasmids. The concentrations of the recombinant plasmids were determined using an ND-2000 spectrophotometer (Thermo Scientific, Dreieich, Germany) and the copy number was calculated according to the formula: (plasmid concentration [ng] × 6.02 × 10²³)/(genome length × 10⁹ × 660 Da/bp). Next, the standard plasmids were serially diluted 10-fold and stored at -20°C for further use.

Table 1

The primers used in this study.
Primer name	Sequences (5’-3’)	Product size (bp)
CaKoV-F	CCCTGGAACACCCAAGGCCGCT	504
CaKoV-R	TCTGGTTGCCATAGATGTGGTG	504
CaCV-F	ATAGTCTACACACAAATGGACCAGC	912
CaCV-R	TCAGTAGTTATACATGTGTGGAAAC	912
CaKoV-SYBR-F	TGGTCTCATTGACTACAT	137
CaKoV-SYBR-R	AACACTTGTAATCCAGAT	137
CaCV-SYBR-F	GTCCTGAGTGAACATTGG	84
CaCV-SYBR-R	CAAGACAGATCATCATCAAGA	84

2.3 Primers design

MN449341 was used as a reference sequence for CaKoV and MN863535 was used as a reference sequence for CaCV. Two specific primers were designed using Primer Premier 5 for the 3D and Rep genes of CaKoV (CaKoV-SYBR-F and CaKoV-SYBR-R) and CaCV (CaCV-SYBR-F and CaCV-SYBR-R), respectively. The primers for conventional PCR were designed using the same conserved region. All primer sequences used in this study are listed in Table 1. General Biosystems Company (Chuzhou, China) synthesized all primers.

2.4 Optimization of the duplex real-time PCR assay

Standard plasmids of CaKoV and CaCV were used as templates to optimize the duplex real-time PCR assay. The reaction system including the parameters of PCR reaction, concentrations of primers and reagent was optimized, in order to get the best detection results.

2.5 Standard curves for CaKoV and CaCV

The 10-fold serially diluted recombinant plasmid standards of CaKoV and CaCV were used as templates with each concentration repeated thrice. According to the optimized reaction system, duplex SYBR Green I-based real-time PCR assay was performed to obtain standard curves for CaKoV and CaCV.

2.6 Sensitivity analysis

Standard plasmid concentrations for CaKoV and CaCV ranging from 10¹ to 10⁸ copies/µL were applied to the optimized duplex real-time PCR assay to determine the minimum detection limit of this method.

2.7 Specificity analysis

The specificity of the duplex qPCR assay was evaluated using several viruses which are common in dogs. The DNA concentrations of CaCV and CPV and the cDNA concentrations of CaKoV, CaAstV, CDV, and CCV were 1 × 10⁷ copies/µL. A negative control (ddH₂O) was also included. After each amplification, 2% agarose gel electrophoresis was performed to verify whether the expected product was obtained.

2.8 Reproducibility analysis

Three different concentrations of 10⁷, 10⁵ and 10³ were elected to assess the reproducibility. Each dilution was performed three parallel tests under the same conditions at equal intervals. The Ct value variation coefficients (CV) were calculated to determine intra- and inter-assay variation.

2.9 Detection of clinical samples

A total of 57 unknown clinical samples from diarrheic dogs were collected and then nucleic acid of the virus was extracted using the DNA/RNA kit. After all products were reverse transcribed, the duplex SYBR Green I-based real-time PCR assay was used to detect the target viruses. And the same samples were also tested using conventional PCR.

3.1 Optimization of the duplex SYBR Green I-based real-time PCR assay

The total volume of the optimized duplex real-time PCR system was 40µL, including 20µL of SuperReal PreMix Plus, 0.6µL of forward and reserve primes for CaKoV, 0.4µL of forward and reserve primes for CaCV, 1µL of each template, and ddH₂O. The conditions were 95 ◦C for 15 min, followed by 40 cycles of 95 ◦C for 10 s and 60 ◦C for 30 s. As shown in Fig. 1a-b, the Tms were 86 ◦C for CaKoV and 78 ◦C for CaCV. And as shown in Fig. 2, the duplex melting curve showed the same T_m as the single experiment.

3.2 Establishment of CaKoV and CaCV standard curves

After calculation, the copy numbers of CaKoV and CaCV were 8.924×10¹⁰ copies/µL and 3.841×10¹⁰ copies/µL, respectively. The standard curves equations of y=--3.329x+32.947 and y=--3.560x+34.821, and the amplification efficiencies were 99.7%and 90.9༅, for CaKoV and CaCV, reapectively. The correlation coeefficients (R²) were all 0.999 for CaKoV and CaCV, respectively (Fig. 3a-b).

3.3 Sensitivity analysis

As shown in Fig. 4a-b, 10 folded dilution of CaKoV and CaCV were used as templates from 10⁸ to 10¹. The amplification curve showed that the lowest sensitivity detected by the duplex real-time PCR assay was 10¹ copies/µL.

3.4 Specificity analysis

As shown in Fig. 5, CaKoV, CaCV, CaAstV, CDV, CCV and CPV templates were amplified using the newly developed duplex real-time PCR assay, and ddH₂O was used as a negative control. There were no specific melting peaks for other viruses and negative control as well as the target viruses could be distinguished.

3.5 Repeatability analysis

As shown in Table 2 and Table 3, the intra- and inter-assay CVs for CaKoV and CaCV were small. The intra-assay CV values for CaKoV and CaCV ranged from 0.21–0.34% and 0.04–0.26%, respectively and the inter-assay CV values for CaKoV and CaCV ranged from 0.31–0.96% and 0.16–0.70%, respectively.

Table 2

Intra- and inter-assay CVs of CaKoV.
Category	DNA standard (copies/µL)	Mean (Ct)	SD	CV (%)
Intra-assay	1×10⁷	11.91	0.04	0.34
	1×10⁵	18.83	0.08	0.40
	1×10³	25.68	0.06	0.21
Inter-assay	1×10⁷	12.24	0.12	0.96
	1×10⁵	19.17	0.13	0.66
	1×10³	26.11	0.08	0.31

Table 3

Intra- and inter-assay CVs of CaCV.
Category	DNA standard (copies/µL)	Mean (Ct)	SD	CV (%)
Intra-assay	1×10⁷	11.61	0.03	0.26
	1×10⁵	18.91	0.03	0.16
	1×10³	25.92	0.01	0.04
Inter-assay	1×10⁷	12.17	0.09	0.70
	1×10⁵	19.12	0.07	0.34
	1×10³	26.08	0.04	0.16

3.6 Clinical sample analysis

As shown in Table 4, 57 unknown clinical samples from diarrheic dogs were used in the duplex SYBR Green I-based real-time PCR and conventional PCR assays. When using the duplex real-time PCR method, the positive rates of CaKoV and CaCV were 8.77% (5/57) and 14.04% (8/57), respectively, and the co-infection rate was 7.02% (4/57). However, positive rates of CaKoV, CaCV, and co-infection by the conventional PCR method were 5.26% (3/57), 10.53% (6/57), and 3.51% (2/57), respectively.

Table 4

Detection of CaKoV and CaCV in clinical samples by quantitative real-time PCR (qPCR) and conventional PCR (cPCR).
Virus	Total clinical samples	Positive rata (％)
Virus	Total clinical samples	qPCR	cPCR
CaKoV	57	8.77％(5/57)	5.26％(3/57)
CaCV	57	14.04％(8/57)	10.53％(6/57)
co-infection	57	7.02％(4/57)	3.51％(2/57)

The major cause of canine gastroenteritis is viral infection, especially in dogs under one year of age[18]. The main clinical symptom of canine gastroenteritis is diarrhea, and the common viruses that cause diarrhea in dogs are CPV, CDV and CCV[19–21]. In addition, there are two new viruses, CaKoV and CaCV, which can also cause diarrhea in dogs[8, 13, 22]. CaKoV and CaCV infection is a serious threat to the health of dogs, the mortality rate is as high as 50–100%, which has caused huge economic losses to the canine industry[23]. CaKoV has been detected in cattle, sheep, pigs, and dogs in different countries[24–27]. Since circovirus was first identified in the United States in 2012[13], it has been reported in Italy, Germany, China, Thailand and other countries[15, 22, 28–30]. Because the clinical symptoms of the two viruses are very similar, it is difficult to differentiate and diagnose the two viruses[17, 23]. Therefore, a test that simultaneously detects and identifies these two viruses is required.

Viruses are detected in a variety of ways, such as loop-mediated isothermal amplification, enzyme-linked immunosorbent assays, and indirect immunofluorescence assays[31–34]. Compared to these traditional detection methods, real-time fluorescence quantitative PCR has great advantages in terms of sensitivity and specificity[33, 35], and detects virus even at lower concentrations[36]. In addition, compared with TaqMan-based real-time PCR, the SYBR Green I-based real-time PCR method is cheaper and easier[12]. Compared to a single assay, a dual assay was designed with the same sensitivity, but with the ability to detect multiple viruses. Therefore, a duplex SYBR Green I-based real-time PCR was developed that simultaneously detected CaKoV and CaCV.

In this study, a duplex SYBR Green I-based real-time PCR assay was successfully established. Two specific primers were designed based on the conserved regions, 3D for CaKoV and Rep for CaCV. The method distinguished the two viruses by their different Tm values, which were 86°C for CaKoV and 78°C for CaCV. The detection limits of CaKoV and CaCV were 8.924 × 10¹ copies/µL and 3.841 × 10¹ copies/µL, respectively, demonstrating the high sensitivity of the method. Moreover, when this method was used to detect other viruses, such as CaAstV, CDV, CCV, and CPV, there was no obvious melting curve, indicating that the assay had good specificity. The intra -and inter-assay CV values were low, demonstrating that the experiment could be repeated with a high degree of reproducibility. Furthermore, the duplex SYBR Green I-based real-time PCR and conventional PCR assays were used to detect viruses within clinical samples. The positive infection rate of the former was significantly higher than that of the latter, indicating that the duplex SYBR Green I-based real-time PCR assay was more suitable for the detection of these two viruses.

In conclusion, a duplex SYBR Green I-based real-time PCR assay for the detection of CaKoV and CaCV was successfully established. This assay is rapid, has high sensitivity, high specificity, a simple operation, and low price. In addition, this method will facilitate the detection and differential diagnosis of these two viruses and has important significance for their study and prevention.

Ethics approval and consent to participate

All experiments were compliant with the ethical standards of Anhui Agricultural 220 University (Permit number: SYXK 2016-007).

Consent for publication

Not applicable.

Availability of data and materials

Availability of data and materials All data generated or analyzed in this study can be obtained within the tables and figures of the manuscript.

Conflicts of interest/Competing interests

The authors declare no conflict of interest.

Funding

This study was supported by the Ningbo Health Branding Subject Fund (No. ppxk2018-10).

Author contributions

YP and JC conceived of the study, carried out the experiment and drafted the manuscript, contributed equally to this work. JW and YXW participated in the data collection and analysis. JZ, JY, and FX participated in statistical analysis. YW conceived of the study, revising the manuscript critically. All authors have read and approved the final manuscript.

Acknowledgments

We would like to thank Editage (www.editage.cn) for English language editing.

Miyabe FM, Ribeiro J, Alfieri AF, Alfieri AA: Detection of canine kobuvirus RNA in diarrheic fecal samples of dogs with parvoviruses. Braz J Microbiol 2019, 50(3):871-874.
Li M, Yan N, Wang M, Zhang B, Yue H, Tang C: Prevalence and genomic characteristics of canine kobuvirus in southwest China. Arch Virol 2018, 163(2):459-466.
Li L, Pesavento PA, Shan T, Leutenegger CM, Wang C, Delwart E: Viruses in diarrhoeic dogs include novel kobuviruses and sapoviruses. J Gen Virol 2011, 92(Pt 11):2534-2541.
Khamrin P, Maneekarn N, Okitsu S, Ushijima H: Epidemiology of human and animal kobuviruses. Virusdisease 2014, 25(2):195-200.
Chang JT, Chen YS, Chen BC, Chao D, Chang TH: Complete genome sequence of the first aichi virus isolated in taiwan. Genome Announc 2013, 1(1).
Choi S, Lim SI, Kim YK, Cho YY, Song JY, An DJ: Phylogenetic analysis of astrovirus and kobuvirus in Korean dogs. J Vet Med Sci 2014, 76(8):1141-1145.
Di Martino B, Di Felice E, Ceci C, Di Profio F, Marsilio F: Canine kobuviruses in diarrhoeic dogs in Italy. Vet Microbiol 2013, 166(1-2):246-249.
Li C, Wei S, Guo D, Wang Z, Geng Y, Wang E, Zhao X, Su M, Wang X, Sun D: Prevalence and phylogenetic analysis of canine kobuviruses in diarrhoetic dogs in northeast China. J Vet Med Sci 2016, 78(1):7-11.
Kong N, Zuo Y, Wang Z, Yu H, Zhou EM, Shan T, Tong G: Molecular characterization of new described kobuvirus in dogs with diarrhea in China. Springerplus 2016, 5(1):2047.
Ribeiro J, Headley SA, Diniz JA, Pereira AH, Lorenzetti E, Alfieri AA, Alfieri AF: Extra-intestinal detection of canine kobuvirus in a puppy from Southern Brazil. Arch Virol 2017, 162(3):867-872.
Charoenkul K, Janetanakit T, Chaiyawong S, Bunpapong N, Boonyapisitsopa S, Tangwangvivat R, Amonsin A: First detection and genetic characterization of canine Kobuvirus in domestic dogs in Thailand. BMC Vet Res 2019, 15(1):254.
Wang Y, Li Y, Cui Y, Jiang S, Liu G, Wang J, Li Y: Establishment of a duplex SYBR green I-based real-time polymerase chain reaction assay for the rapid detection of canine circovirus and canine astrovirus. Mol Cell Probes 2020, 54:101666.
Kapoor A, Dubovi EJ, Henriquez-Rivera JA, Lipkin WI: Complete genome sequence of the first canine circovirus. J Virol 2012, 86(12):7018.
Giraldo-Ramirez S, Rendon-Marin S, Vargas-Bermudez DS, Jaime J, Ruiz-Saenz J: First detection and full genomic analysis of Canine Circovirus in CPV-2 infected dogs in Colombia, South America. Sci Rep 2020, 10(1):17579.
Niu L, Wang Z, Zhao L, Wang Y, Cui X, Shi Y, Chen H, Ge J: Detection and molecular characterization of canine circovirus circulating in northeastern China during 2014-2016. Arch Virol 2020, 165(1):137-143.
Urbani L, Tryland M, Ehrich D, Fuglei E, Battilani M, Balboni A: Ancient origin and genetic segregation of canine circovirus infecting arctic foxes (Vulpes lagopus) in Svalbard and red foxes (Vulpes vulpes) in Northern Norway. Transbound Emerg Dis 2020.
Wang Z, Shi Y, Wang Y, Zhao L, Cui X, Wen S, Liu H, Cui W, Chen H, Ge J: Detection of Antibodies Against Canine Circovirus in Naturally and Experimentally Infected Canines by Recombinant Capsid Enzyme-Linked Immunosorbent Assay. Front Vet Sci 2020, 7:294.
Ortega AF, Martinez-Castaneda JS, Bautista-Gomez LG, Munoz RF, Hernandez IQ: Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico. Braz J Microbiol 2017, 48(4):769-773.
Decaro N, Pratelli A, Campolo M, Elia G, Martella V, Tempesta M, Buonavoglia C: Quantitation of canine coronavirus RNA in the faeces of dogs by TaqMan RT-PCR. J Virol Methods 2004, 119(2):145-150.
Decaro N, Elia G, Martella V, Desario C, Campolo M, Trani LD, Tarsitano E, Tempesta M, Buonavoglia C: A real-time PCR assay for rapid detection and quantitation of canine parvovirus type 2 in the feces of dogs. Vet Microbiol 2005, 105(1):19-28.
Elia G, Decaro N, Martella V, Cirone F, Lucente MS, Lorusso E, Di Trani L, Buonavoglia C: Detection of canine distemper virus in dogs by real-time RT-PCR. J Virol Methods 2006, 136(1-2):171-176.
Sun W, Zhang H, Zheng M, Cao H, Lu H, Zhao G, Xie C, Cao L, Wei X, Bi J et al: The detection of canine circovirus in Guangxi, China. Virus Res 2019, 259:85-89.
Liu D, Liu F, Guo D, Hu X, Li Z, Li Z, Ma J, Liu C: One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus and canine kobuvirus. J Vet Med Sci 2019, 81(7):1040-1042.
An DJ, Jeoung HY, Jeong W, Lee HS, Park JY, Kim B: Porcine kobuvirus from pig stool in Korea. Virus Genes 2011, 42(2):208-211.
Reuter G, Boros A, Pankovics P, Egyed L: Kobuvirus in domestic sheep, Hungary. Emerg Infect Dis 2010, 16(5):869-870.
Zhai SL, Zhang H, Lin T, Chen SN, Zhou X, Chen QL, Lv DH, Wen XH, Zhou XR, Jia CL et al: A novel porcine kobuvirus emerged in piglets with severe diarrhoea in China. Transbound Emerg Dis 2017, 64(4):1030-1036.
Yamashita T, Ito M, Kabashima Y, Tsuzuki H, Fujiura A, Sakae K: Isolation and characterization of a new species of kobuvirus associated with cattle. J Gen Virol 2003, 84(Pt 11):3069-3077.
Hsu HS, Lin TH, Wu HY, Lin LS, Chung CS, Chiou MT, Lin CN: High detection rate of dog circovirus in diarrheal dogs. BMC Vet Res 2016, 12(1):116.
Li L, McGraw S, Zhu K, Leutenegger CM, Marks SL, Kubiski S, Gaffney P, Dela Cruz FN, Jr., Wang C, Delwart E et al: Circovirus in tissues of dogs with vasculitis and hemorrhage. Emerg Infect Dis 2013, 19(4):534-541.
Piewbang C, Jo WK, Puff C, van der Vries E, Kesdangsakonwut S, Rungsipipat A, Kruppa J, Jung K, Baumgartner W, Techangamsuwan S et al: Novel canine circovirus strains from Thailand: Evidence for genetic recombination. Sci Rep 2018, 8(1):7524.
Espy MJ, Uhl JR, Sloan LA, Buckwalter SP, Jones MF, Vetter EA, Yao JDC, Wengenack NL, Rosenblatt JE, Cockerill FR et al: Real-time PCR in clinical microbiology: Applications for routine laboratory testing (vol 19, pg 165, 2006). Clinical Microbiology Reviews 2006, 19(3):595-595.
Wan CH, Chen CT, Cheng LF, Chen HM, Fu QL, Shi SH, Fu GH, Liu RC, Huang Y: Specific detection of Muscovy duck parvovirus infection by TaqMan-based real-time PCR assay. Bmc Veterinary Research 2018, 14.
Wang J, Zhang Y, Wang J, Liu L, Pang X, Yuan W: Development of a TaqMan-based real-time PCR assay for the specific detection of porcine circovirus 3. J Virol Methods 2017, 248:177-180.
Zheng HH, Zhang SJ, Cui JT, Zhang J, Wang L, Liu F, Chen HY: Simultaneous detection of classical swine fever virus and porcine circovirus 3 by SYBR green I-based duplex real-time fluorescence quantitative PCR. Mol Cell Probes 2020, 50:101524.
Espy MJ, Uhl JR, Sloan LM, Buckwalter SP, Jones MF, Vetter EA, Yao JD, Wengenack NL, Rosenblatt JE, Cockerill FR, 3rd et al: Real-time PCR in clinical microbiology: applications for routine laboratory testing. Clin Microbiol Rev 2006, 19(1):165-256.
Zheng LL, Chai LY, Tian RB, Zhao Y, Chen HY, Wang ZY: Simultaneous detection of porcine reproductive and respiratory syndrome virus and porcine circovirus 3 by SYBR Green capital I, Ukrainian-based duplex real-time PCR. Mol Cell Probes 2020, 49:101474.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

A Duplex SYBR Green I-based Real-time Polymerase Chain Reaction Assay for Rapid Detection of Canine Kobuvirus and Canine Circovirus

Status:

Version 1

Abstract

Figures

Highlights

1 Background

2 Materials And Methods

2.1 Viruses and nucleic acid extraction

2.2 Preparation of standard plasmids

2.3 Primers design

2.4 Optimization of the duplex real-time PCR assay

2.5 Standard curves for CaKoV and CaCV

2.6 Sensitivity analysis

2.7 Specificity analysis

2.8 Reproducibility analysis

2.9 Detection of clinical samples

3 Results

3.1 Optimization of the duplex SYBR Green I-based real-time PCR assay

3.2 Establishment of CaKoV and CaCV standard curves

3.3 Sensitivity analysis

3.4 Specificity analysis

3.5 Repeatability analysis

3.6 Clinical sample analysis

4 Discussion

5 Conclusions

Declarations

References

Additional Declarations

Status:

Version 1